ID: 919846941

View in Genome Browser
Species Human (GRCh38)
Location 1:201648432-201648454
Sequence CCCTGCTCTTTCCTTTTTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 523}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919846928_919846941 14 Left 919846928 1:201648395-201648417 CCTTTTCCTCCGACCCCGCCCTA 0: 1
1: 0
2: 0
3: 11
4: 209
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846930_919846941 5 Left 919846930 1:201648404-201648426 CCGACCCCGCCCTATCGCTCCCC 0: 1
1: 0
2: 3
3: 26
4: 396
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846919_919846941 29 Left 919846919 1:201648380-201648402 CCCCGCCGCCCCGCCCCTTTTCC 0: 1
1: 1
2: 7
3: 93
4: 862
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846929_919846941 8 Left 919846929 1:201648401-201648423 CCTCCGACCCCGCCCTATCGCTC 0: 1
1: 0
2: 0
3: 8
4: 155
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846926_919846941 16 Left 919846926 1:201648393-201648415 CCCCTTTTCCTCCGACCCCGCCC 0: 1
1: 0
2: 1
3: 42
4: 417
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846922_919846941 24 Left 919846922 1:201648385-201648407 CCGCCCCGCCCCTTTTCCTCCGA 0: 1
1: 1
2: 1
3: 15
4: 383
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846923_919846941 21 Left 919846923 1:201648388-201648410 CCCCGCCCCTTTTCCTCCGACCC 0: 1
1: 0
2: 0
3: 24
4: 348
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846927_919846941 15 Left 919846927 1:201648394-201648416 CCCTTTTCCTCCGACCCCGCCCT 0: 1
1: 0
2: 1
3: 24
4: 311
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846925_919846941 19 Left 919846925 1:201648390-201648412 CCGCCCCTTTTCCTCCGACCCCG 0: 1
1: 0
2: 1
3: 47
4: 510
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846935_919846941 -4 Left 919846935 1:201648413-201648435 CCCTATCGCTCCCCGGCTTCCCT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846932_919846941 1 Left 919846932 1:201648408-201648430 CCCCGCCCTATCGCTCCCCGGCT 0: 1
1: 0
2: 0
3: 6
4: 117
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846933_919846941 0 Left 919846933 1:201648409-201648431 CCCGCCCTATCGCTCCCCGGCTT 0: 1
1: 0
2: 0
3: 4
4: 117
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846924_919846941 20 Left 919846924 1:201648389-201648411 CCCGCCCCTTTTCCTCCGACCCC 0: 1
1: 0
2: 2
3: 54
4: 690
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846936_919846941 -5 Left 919846936 1:201648414-201648436 CCTATCGCTCCCCGGCTTCCCTG 0: 1
1: 0
2: 2
3: 19
4: 188
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846934_919846941 -1 Left 919846934 1:201648410-201648432 CCGCCCTATCGCTCCCCGGCTTC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846920_919846941 28 Left 919846920 1:201648381-201648403 CCCGCCGCCCCGCCCCTTTTCCT 0: 1
1: 1
2: 3
3: 55
4: 499
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523
919846921_919846941 27 Left 919846921 1:201648382-201648404 CCGCCGCCCCGCCCCTTTTCCTC 0: 2
1: 1
2: 4
3: 117
4: 883
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919846941 Original CRISPR CCCTGCTCTTTCCTTTTTCC CGG Exonic