ID: 919847015

View in Genome Browser
Species Human (GRCh38)
Location 1:201648713-201648735
Sequence GAGCAGCGGCGGCGGCGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 3, 2: 13, 3: 116, 4: 610}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919847012_919847015 -10 Left 919847012 1:201648700-201648722 CCGAGGTGGAGCTGAGCAGCGGC 0: 1
1: 0
2: 4
3: 24
4: 195
Right 919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG 0: 1
1: 3
2: 13
3: 116
4: 610
919847010_919847015 -9 Left 919847010 1:201648699-201648721 CCCGAGGTGGAGCTGAGCAGCGG 0: 1
1: 0
2: 1
3: 31
4: 246
Right 919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG 0: 1
1: 3
2: 13
3: 116
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919847015 Original CRISPR GAGCAGCGGCGGCGGCGACG AGG Exonic
900180422 1:1308734-1308756 GCGCAGCGGCGGGCGCCACGTGG + Intronic
900249293 1:1658913-1658935 CGGCAGCGGCGGCGGCGTAGGGG - Exonic
900385663 1:2409488-2409510 GAGCAGGGGCGGCAGCGAGGGGG - Intronic
901060183 1:6468248-6468270 GGGGTGCGGCGGCGGAGACGGGG + Exonic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
901853239 1:12029247-12029269 GAGCAGTGGCAGCGGCGTGGAGG + Exonic
902169498 1:14598787-14598809 TAGCCGCGGCGGTGGCGAGGCGG - Exonic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902823137 1:18955807-18955829 GCGCACGGGCGGCGGCGGCGTGG - Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903263367 1:22142948-22142970 GGGCAGCGGCTGCGGCCGCGGGG + Exonic
903724550 1:25431053-25431075 GAGAGACGGCGGCGGCGGCGCGG + Exonic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904659323 1:32073006-32073028 CAGGAGCTGCGGCGGCGAAGCGG + Exonic
904826413 1:33276433-33276455 TAGCAACGGCTGCTGCGACGAGG - Exonic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905369204 1:37474401-37474423 GCGCAGCGGCCGCGGGGGCGGGG + Intergenic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905912278 1:41662778-41662800 GGGCCCCGGCGGCGGCGACAGGG - Intronic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906525243 1:46489841-46489863 TGGCAGCGGAGGCGGCGGCGCGG + Intergenic
906960926 1:50419117-50419139 CGGCGGCGGCGGCGTCGACGCGG + Exonic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
911618371 1:100038657-100038679 GAGGCGAGGCTGCGGCGACGAGG - Intronic
912381299 1:109249606-109249628 CAGCAGCCGCGGCGGGGACGCGG + Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913100896 1:115564388-115564410 CAGCGGCGGCGGCGGCGATCAGG - Intergenic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913703471 1:121396583-121396605 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
913959459 1:143327601-143327623 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
913979847 1:143498414-143498436 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914053819 1:144153174-144153196 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914074196 1:144323898-144323920 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914104980 1:144642548-144642570 AAGCAGCGGCGGTGGCGGAGGGG + Intergenic
914125327 1:144813191-144813213 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
915934782 1:160084067-160084089 GAGGAGCCGCCGCGGCGCCGCGG + Exonic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917962337 1:180154930-180154952 CAGCAGCGACGGCGGCGGCCCGG - Exonic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
920219300 1:204384784-204384806 GACAAGCGGCGGCGGCGTCCTGG + Intergenic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
921029720 1:211326804-211326826 GGCCGGCGGCGGCGGCGAAGCGG - Intronic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
921707983 1:218345849-218345871 AAGCGGCGGCGGCAGCAACGTGG + Intergenic
922485907 1:225972796-225972818 GAGCAGGGTCAGCGGCGAGGAGG + Intergenic
922648637 1:227318191-227318213 CAGCAGCTGCGGCGGCGGCGCGG + Exonic
922676799 1:227558540-227558562 GTGCTGTGGCGGCGGCGAGGTGG - Intergenic
922753741 1:228082874-228082896 CCGCGGCGGCGGCGGCGACAGGG + Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923372332 1:233327322-233327344 GAGCACCTGCGGCGGGGGCGGGG + Intergenic
924436699 1:244048952-244048974 ACGCGGCGGCGGCGGGGACGCGG + Intronic
924626179 1:245698273-245698295 GAGCGCCTGCAGCGGCGACGAGG + Exonic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1062920420 10:1274921-1274943 GAGCAGCTGCGGCCGGGACACGG + Intronic
1063452946 10:6163663-6163685 GAGCAGCTGCGGGCCCGACGGGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064422232 10:15200212-15200234 GAGCAGAGGCTGCGGCTACAAGG + Intergenic
1064859772 10:19815550-19815572 AAGCCGCGGCGGCAGCGGCGGGG + Intergenic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065024380 10:21526594-21526616 GAGGCGCGGCGGGGGCGTCGAGG - Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464512 10:35640817-35640839 GGGCGGTGGCGGCGGGGACGCGG - Exonic
1068669570 10:59709709-59709731 CCGCAGCGGCGGCGGCCACATGG + Exonic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069424686 10:68279045-68279067 CAGCAGCGGCGGCGGGGGAGGGG + Intergenic
1069544542 10:69319017-69319039 GACCAGCGGCGGCGCGGGCGGGG - Intronic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070329167 10:75405612-75405634 GAGCAGCGGCGAGGGCCGCGCGG - Intergenic
1071086778 10:81875118-81875140 GAGGAGCGGGGGAGGGGACGGGG - Intergenic
1071966590 10:90858102-90858124 AGGCGGCGGCGGCGGGGACGCGG - Intergenic
1072673149 10:97446295-97446317 GAGCGGCGGCAGAGGCTACGGGG + Exonic
1073059430 10:100724546-100724568 GCTCCGCGGCGGCGGCGACCAGG + Intergenic
1075430159 10:122373901-122373923 CAGTAGCGGTGGCGGGGACGGGG - Intergenic
1075430295 10:122374763-122374785 GAGCCGGGGCCGCGGCGGCGCGG + Exonic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076554119 10:131311245-131311267 GAGCAGGGGAGACGGCGACCCGG + Intronic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1077514213 11:2992071-2992093 AGGCAGCGGCGGCCGCGGCGGGG - Intronic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078210384 11:9265292-9265314 TAGCTGCAGCGGCGGCGGCGCGG - Exonic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1079071541 11:17351956-17351978 CAGCAGCCGCGGCGATGACGTGG + Exonic
1079076726 11:17389151-17389173 GTGCAGCGGCGGCGGCGGGCGGG - Intronic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080593178 11:33741921-33741943 GAGCAGCGGCGTCTGCGAATGGG + Exonic
1082076934 11:47981453-47981475 GAGGGGCGGCGGGGGCGACAGGG + Intronic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1082816966 11:57515419-57515441 GAGCAGCGTGGGCGGGGAGGGGG - Intronic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083656906 11:64234357-64234379 GGGTAGTGGCGGCGGCGACTGGG + Intergenic
1083883222 11:65558386-65558408 GCGGCGCGGCGGCGGCGAGGGGG + Intronic
1083922313 11:65787501-65787523 GGGCACCCGCGGCGGCGTCGAGG + Intronic
1084148557 11:67277636-67277658 GAGCAGCTGCGGCCGCGCCAAGG - Intronic
1084285487 11:68128260-68128282 GATGAGCGGCGGCGGGGAGGAGG + Intergenic
1084295987 11:68213621-68213643 GCTCACCGGGGGCGGCGACGCGG - Intronic
1084546641 11:69818162-69818184 CAGCAGCGGGGGCGGCCACCTGG + Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085666234 11:78417699-78417721 CATGAGCGGCGGCGGCGACGTGG - Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090042335 11:123301898-123301920 CAGCAGGGGCGGCGGCGGCCTGG + Intergenic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1091874322 12:3920976-3920998 GAGCAGCTGCGGTGGCAACACGG - Intergenic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1093465023 12:19440032-19440054 CAGCAGCGGCGGGGGTGAGGAGG + Exonic
1096786852 12:54021766-54021788 CAGGAGCGGCTGCGGCGCCGTGG - Intronic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098255429 12:68611075-68611097 AAGCCGCGGCGGCGGCCGCGCGG + Intronic
1098320710 12:69240146-69240168 GAGCGGCAGCGGCGGGGAAGGGG - Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1098963681 12:76764148-76764170 GAGCCCCGCCGGAGGCGACGCGG - Exonic
1100844396 12:98644581-98644603 GAGCAGCGGAGGCGGGGGCTGGG - Exonic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102997540 12:117361511-117361533 GAGCAGCGGCCGAGCGGACGGGG - Exonic
1103308951 12:119989473-119989495 CAGCAGCGGCAGCGGCAACAGGG + Intergenic
1103377716 12:120469643-120469665 CTGAGGCGGCGGCGGCGACGTGG - Exonic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1104030921 12:125065446-125065468 GGTCAGCGACGGCGGCGGCGGGG - Exonic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104376223 12:128267232-128267254 GAGCTGCGGCGGCGTGGACCCGG + Intergenic
1104697097 12:130872011-130872033 GAGCAGGGGCGGGGCCGGCGCGG - Exonic
1104707951 12:130961962-130961984 CAGGAGAGGCGGAGGCGACGTGG - Intronic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104930920 12:132339100-132339122 GGGCAGAGGCTGCGGCGAGGTGG + Intergenic
1104961626 12:132490769-132490791 GACTCGCGGCGGCGGCGGCGCGG - Exonic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1106187805 13:27424565-27424587 GCGCAGCAGCGGCGCCGACGCGG + Exonic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1107604034 13:42040820-42040842 CAGCGGCGGCGGCGGGGACCCGG + Intronic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1112294779 13:98177080-98177102 GAGCAGCAGCAGCGGGGACGAGG - Exonic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113231636 13:108218569-108218591 GAGGAGCGACGGAAGCGACGCGG + Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113794765 13:113050708-113050730 GAGCAGGGGGGGCGGGGGCGGGG + Intronic
1113820194 13:113208428-113208450 GAACAGCGGCGGCCGGGACTCGG - Intronic
1114318322 14:21526272-21526294 GAGCAGCGGCGGAGGGGGAGGGG + Intronic
1115028336 14:28767242-28767264 GGGAAACGGCGGCGGCGGCGCGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1117602581 14:57390672-57390694 GAGTGGCGGCAGCGGCGGCGGGG + Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1118186544 14:63543136-63543158 CGGCGGCGGCGGCGACGACGTGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118809215 14:69261206-69261228 GCACAGCGGGGGCGGCGGCGGGG + Intronic
1119249036 14:73136548-73136570 GAGCCGCGGCGGCAGCGGGGCGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1121050439 14:90816332-90816354 GCGCCGCGGCGGCGGCGGTGGGG - Exonic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121352632 14:93185251-93185273 GGTCTCCGGCGGCGGCGACGGGG + Exonic
1121645672 14:95516122-95516144 GAGCAGAGCAGGCGGCGAAGAGG - Exonic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221177 14:100239823-100239845 GGGCGGCGGCGGCGCCGACCCGG + Exonic
1122959422 14:105087664-105087686 GAGCAGCGGCGGGGCGGGCGGGG + Intergenic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1124019747 15:25909537-25909559 GCGCAGGGGCTGCGGCGAGGTGG - Intergenic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125200730 15:37098988-37099010 GCGCAGCGGCTGCGGCAGCGCGG + Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125719548 15:41838782-41838804 GAGCAGAGGCGGCGGGTAGGAGG + Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127439017 15:58987699-58987721 AGGCGGCGGCGGCGGCGAAGCGG + Intronic
1127458798 15:59179133-59179155 GAGCAGGGGCAGAGGCGCCGAGG - Intronic
1128322518 15:66703342-66703364 CGGCGGCGGTGGCGGCGACGAGG + Exonic
1128322667 15:66703914-66703936 GAGCAGCAGCTGCGGCGGCGCGG - Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128454949 15:67827103-67827125 TGGGAGCGGCGGCGGCGGCGCGG + Intronic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132576848 16:668261-668283 GAGCTGCGGCGGCCGTGAGGCGG + Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132747677 16:1443740-1443762 AGGCGGAGGCGGCGGCGACGTGG + Intronic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133972881 16:10580091-10580113 GAGCAGCGGCGGGGGCCTAGAGG + Intronic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1135250866 16:20900307-20900329 AAGAAGAGGCGGCGGCGGCGGGG - Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136237764 16:28925108-28925130 GATGAGCGGCGGCGGCGGCCGGG - Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1139402925 16:66696598-66696620 CGGCGGCGGCGGCGGCGATGCGG - Exonic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139469449 16:67170487-67170509 CAGCAGCTGCGGCGGGGGCGGGG - Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141627116 16:85267149-85267171 GAGCAGCGGCGGTGGCTGCCTGG + Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141989702 16:87602832-87602854 GGGCAGGAGCGGCGGCGGCGGGG - Intronic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1203070913 16_KI270728v1_random:1073770-1073792 AAGCAGCGGCGGTGGCGGCGGGG + Intergenic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142876400 17:2853939-2853961 GAGCCGGGGCTGCGGGGACGCGG + Intronic
1143063341 17:4222164-4222186 TAGCAGCAGCGGCGGCGGCGGGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143545638 17:7593514-7593536 GGGCAGCGGTGGCAGCGACAAGG - Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143772525 17:9177766-9177788 CAGAAGAGGCGGCGGCGAGGAGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144724540 17:17495253-17495275 CGGCGGCGGCGGCGGCGACCCGG - Exonic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1145305751 17:21674258-21674280 GAGCGGCGGCTGCGGGGACTGGG + Intergenic
1145370900 17:22305224-22305246 GAGCGGCGGCTGCGGGGACTGGG - Intergenic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1146799817 17:35809595-35809617 GAGCAGCGGCAGCGACGAGAAGG + Intronic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1147486389 17:40818992-40819014 AAGCTCCGGCGGCGGCTACGGGG - Exonic
1147700136 17:42388465-42388487 GAGCTGCGGCGGCGCAGACTGGG - Exonic
1147792493 17:43022176-43022198 GCGCAGCAGTGGCGGCGAGGCGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148126934 17:45241982-45242004 GGGCAGCGGCGGCGCAGGCGGGG - Exonic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148437208 17:47694065-47694087 GAGACCCGGCGGCGGCGACAGGG + Intronic
1148467236 17:47872503-47872525 CGGCGGCGGCGGCGGCGATGGGG + Intergenic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148556596 17:48582227-48582249 GCGCACCGGCGGCGGCGGCGCGG + Intronic
1148768986 17:50056191-50056213 GGGCAGGGACGGCGGCGACCCGG + Intronic
1149599649 17:57885264-57885286 CAGCAGCGGCGGCGTCTATGAGG - Exonic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149682219 17:58514506-58514528 GTGCAGCCGCGGCGGCCAAGAGG + Intronic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150150851 17:62808047-62808069 GCGGAGCGGCGGGGGCGAGGGGG + Intronic
1150259155 17:63774243-63774265 TGGCGGCGGCGGCGGCGAAGGGG + Exonic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150692297 17:67377231-67377253 CAGCAGCGGCCGCGGCGGGGAGG - Intergenic
1150692751 17:67378866-67378888 GAGCGGCGGGGGCTGCGACGCGG + Intronic
1151370849 17:73645251-73645273 GCGCGGCGGAGGCGGAGACGCGG + Intergenic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151478545 17:74356881-74356903 GGCCAGCAGCGGCGGCGACGCGG - Exonic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1152077511 17:78168598-78168620 CAGCGGCGGCGACGGCGACATGG + Exonic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152542055 17:80981480-80981502 CAGCGGCCGCGGCGGCCACGCGG - Intergenic
1152628601 17:81399638-81399660 GCGCAGAGGCGGCGGCGTCCGGG - Exonic
1152697278 17:81803617-81803639 GAGCCGCGGTGGGGGCGACTGGG + Intergenic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152729216 17:81961498-81961520 TGGAAGGGGCGGCGGCGACGGGG + Intronic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152924158 17:83079889-83079911 CAGCAGCGGGAGCGGCGGCGGGG - Exonic
1203192332 17_KI270729v1_random:200551-200573 AAAAAGCGGCGGCGGCGGCGGGG - Intergenic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1156446939 18:37243912-37243934 CGGCGGCGGCGGCGGCGACCCGG + Exonic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160853510 19:1205940-1205962 GCGCGGCGGCCGCGGCGAGGGGG + Intronic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160904642 19:1446414-1446436 GAACAGCGGGCGCGGCGGCGGGG + Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160947906 19:1652105-1652127 GCGCCGGGGGGGCGGCGACGTGG - Intronic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161816392 19:6502257-6502279 GGGGAGCTGCGGCGGCGGCGAGG + Exonic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162470876 19:10871496-10871518 TGGCGGCGGCGGCGGCGAGGCGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162817921 19:13207549-13207571 GGGCAGCGGGGGCGGCGAGGAGG - Exonic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162951349 19:14073575-14073597 CAGCGGCTGCGGCGGCGACCGGG - Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163631397 19:18419620-18419642 GGGCCCCGGCGGCGGCGGCGTGG + Exonic
1164835580 19:31353138-31353160 CAGAAGCGGCCGCGGCGGCGCGG + Intergenic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165721603 19:38082921-38082943 GAGCAGCGGCGAGGGCCACCTGG + Exonic
1166073042 19:40397715-40397737 GAGGAGCGGCGGCGGCCAGCCGG + Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1166938069 19:46347006-46347028 CGGCAGCGGCGGCGGCCACCCGG + Exonic
1167149868 19:47702327-47702349 GTGCAGGGGCGGCGGGGATGCGG - Exonic
1167157124 19:47745656-47745678 GCGCTGAGGCGGCGGCGGCGAGG + Exonic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
1167505717 19:49870058-49870080 GGGCTGCGGGGACGGCGACGGGG + Exonic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168339090 19:55613660-55613682 GAGCAGCGGCATCGGGGGCGAGG + Exonic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
1202693295 1_KI270712v1_random:105832-105854 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
924962169 2:45578-45600 GCACAGCGGCGGCGACGACGAGG - Exonic
925375377 2:3380069-3380091 GAGCAAGGGCCGCGGCGACGTGG - Intronic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
926718661 2:15942793-15942815 GACCAGCGGCGGCGACCACAAGG + Exonic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
930700925 2:54456994-54457016 GAGCGGGGGCGGCGGTGACAGGG + Intronic
930872604 2:56184109-56184131 GAGCAGCCGGGGAGGCGCCGCGG + Exonic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931517832 2:63059941-63059963 GGGCAGCGGCGGCGGGAACGCGG + Intergenic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932820707 2:74897501-74897523 GGGCGGCGGCGGCGGGGAGGGGG - Intergenic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933953273 2:87348727-87348749 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934237504 2:90245072-90245094 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934251559 2:90359969-90359991 GGGCAGTGGCGGGGGTGACGCGG - Intergenic
934258000 2:91443429-91443451 GGGCAGTGGCGGGGGTGACGCGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
934567039 2:95346829-95346851 GGGCGGCGGCGGCGGCGAGCGGG - Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936390783 2:112071310-112071332 GGGCAGTGGTGGCGGCGGCGGGG - Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
940265135 2:151828362-151828384 GTGCCGCGGCGGCAGCGGCGGGG - Exonic
940639817 2:156333915-156333937 AAGCAGAAGCGGCGGCGACTTGG - Intronic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941476181 2:165953898-165953920 GAGCAGGGGCGGCGGGGACCCGG + Intergenic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942748619 2:179264310-179264332 GAGCAGAGGCGGTGGCGGGGCGG + Intronic
943811509 2:192194749-192194771 GAGAAGCTGCGCCGGAGACGCGG + Exonic
944412672 2:199458594-199458616 GCGCGGAGGCGGCGGCGACAAGG + Intronic
944517401 2:200526184-200526206 GAGCAGCAGCGGCTGCGGCTTGG - Exonic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946865635 2:224039197-224039219 GCCAAGCGGCGGCGGCGAGGAGG + Intronic
946921427 2:224585155-224585177 GGGCAGCCGCGGCGGCGGCGGGG + Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948824796 2:240568924-240568946 GGGCAGCGGGGGCGGCGGCGCGG - Exonic
1168804448 20:664207-664229 GGGCGGGGGCGGCGGGGACGCGG - Exonic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1170578727 20:17682390-17682412 GAGCCGCGGCGGCGGCCATTGGG + Intergenic
1171531006 20:25853725-25853747 GAGCGGCGGCTGCGGGGACTGGG + Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172109407 20:32536484-32536506 GGGCAGGGGCGGGGGCGAGGCGG + Intronic
1172277230 20:33686292-33686314 GACAGGCGGCGGCGGCGGCGCGG + Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1173729089 20:45316476-45316498 GCTGAGCGGCGGGGGCGACGTGG + Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1174404438 20:50294345-50294367 GAGCAGCCGCGGCTGGGACTTGG + Intergenic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175859715 20:62143656-62143678 GAGGCGCGGCGACGGCGACGGGG + Intergenic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556825 21:8257546-8257568 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575764 21:8440587-8440609 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1177166556 21:17611711-17611733 GAGCAGCCGCCGCGGTGACGAGG - Intronic
1178493996 21:33071502-33071524 GAGCAGTGGCGGGGGCGGAGGGG + Exonic
1178914671 21:36699664-36699686 GGGCTGCGGCGGCGGGGATGGGG - Exonic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179561584 21:42219215-42219237 CGGCGGCGGCGGCGGGGACGAGG - Exonic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179663569 21:42893590-42893612 GGGCAGCGGCGGCGGCGGACCGG - Intronic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181235462 22:21445603-21445625 GAGCAGCGGGGGCTGCGAGCAGG + Exonic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1181710696 22:24685942-24685964 GTGCCGCGGCGGCAGCGTCGGGG + Intergenic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1183370128 22:37427490-37427512 GAGGCGCGGCGGCGGGGAGGAGG - Intergenic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1184000097 22:41666961-41666983 GAGCTGCTGCGGCGGCCACAAGG - Intergenic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185397649 22:50600959-50600981 GGGCTGGGGCGGCGGGGACGGGG - Intronic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185420264 22:50731023-50731045 GGGCAGCGGCGACGGCGAGGGGG - Intergenic
1203253815 22_KI270733v1_random:129641-129663 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203261871 22_KI270733v1_random:174720-174742 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950902998 3:16513710-16513732 GACGCGCGGCGGCGGCGGCGGGG - Intronic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954194919 3:48990688-48990710 GAGCAGCGCCGGGGGCAGCGTGG - Intronic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954468883 3:50675006-50675028 GAGCAGCGGCGACGGACAGGTGG + Intergenic
954733551 3:52685803-52685825 CAGCAGCCGTGGCGGCCACGGGG - Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
955916488 3:63912663-63912685 GAGCAGCGGCCGCGGCCGCCCGG + Exonic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956678145 3:71754073-71754095 TGGCAGCGGCGGCGGCGAGGCGG + Exonic
959849759 3:111072115-111072137 CAGCAGCGGAGGTGGCGTCGGGG - Exonic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
963904456 3:150762660-150762682 GGGCCCCGGCGGCGGCGGCGGGG - Exonic
964720620 3:159764763-159764785 GACCCGCAGCGGCGGCGGCGGGG + Exonic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966886511 3:184380335-184380357 GAGCAGCAGCGGGGCCGGCGGGG - Exonic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
969357752 4:6640550-6640572 AGGCACCGGCGGCGGCGTCGCGG - Exonic
969715851 4:8867786-8867808 GAGCAGCGGTGGGGGCGGCGCGG + Exonic
970194637 4:13542442-13542464 GTGCAGCGGGGCCGGCGGCGGGG - Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970333046 4:15003833-15003855 GGGCTGGGGTGGCGGCGACGCGG - Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
973137315 4:46724423-46724445 GGGCCGCGGCGGCGGCGGCAGGG + Intergenic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
976297250 4:83484870-83484892 GAGGAGGCGCGGCGGCGTCGGGG + Intronic
976398563 4:84583117-84583139 GAGCAGAGAAGGCGGAGACGCGG - Exonic
977257685 4:94758383-94758405 GGGCAGCGGCGGCGGCGGGCGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978741847 4:112145742-112145764 GGGGAGGGGCGGCGGCGAAGCGG + Intronic
980827380 4:138089051-138089073 GAGGAGCGGCGGCAACGGCGCGG - Intergenic
981615458 4:146639371-146639393 CAGCAGCGGCGGCGGGGGCTCGG + Exonic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982288804 4:153759970-153759992 GATCTGCGGCGGCGGCGGAGCGG + Exonic
982484779 4:155953778-155953800 GTGCCGGGGCGGCGGCGATGCGG - Exonic
982712276 4:158769194-158769216 GAGCTGCGGCGGCGGCATCATGG + Exonic
982745993 4:159104020-159104042 AAACCGCGGCGGCGGCGGCGCGG - Intergenic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
983624820 4:169791790-169791812 GAGAAGAGGCAGCGGCGACCAGG - Intergenic
983904383 4:173169032-173169054 GAGCAGGGGCGGCGGGGTCGCGG + Intronic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955102 5:61332653-61332675 CAACACCGGCGGCGGCGCCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998374483 5:141681976-141681998 GGGCAGCGCAGGCTGCGACGAGG + Intronic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1002401660 5:178994569-178994591 CGGCCGCGGCGACGGCGACGAGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002926549 6:1608973-1608995 GATCAGAGGGGGCGGCGGCGCGG + Intergenic
1002927148 6:1611183-1611205 GGGCAGCGGCAGCGCCGCCGCGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004272928 6:14211274-14211296 GGGCATCGGCGGCAGCGGCGCGG - Intergenic
1006155986 6:32013050-32013072 GAGGAGCAGCGGCAGTGACGGGG + Intergenic
1007032370 6:38639906-38639928 CAGCAGCCGGGGCGGCGGCGAGG - Exonic
1008520901 6:52362003-52362025 TCGCAGCGGCGGCAGCGGCGCGG + Intronic
1009437591 6:63635917-63635939 GGGCGGCGGCGGCTGCAACGAGG + Exonic
1010781177 6:79947429-79947451 GCGCCGCGGCGGCGGGGATGCGG + Exonic
1011194007 6:84763998-84764020 CTGCAGCCGCGGCGGCGGCGCGG - Exonic
1012137540 6:95577681-95577703 CAGCAGCGGCGGCAGGCACGAGG + Intronic
1013099482 6:106974874-106974896 TGGCAGTGGCGGCGGCGGCGGGG - Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014632377 6:123803361-123803383 AAGCGGCGGCGGCGGGGACCGGG - Intergenic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015366356 6:132401491-132401513 GAGCGGCAGCGGCGGCGAGCGGG + Exonic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1017146686 6:151240909-151240931 GAGCAGCGGCGAGCGCGGCGGGG + Intronic
1017164140 6:151391490-151391512 AGGCAGAGGCGGCGGCGGCGGGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1017842352 6:158232220-158232242 AGGCGGCGGCGGCGGCGATGCGG + Intronic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1019111916 6:169723980-169724002 CGGCAGCGGCGGCGGCGGCCGGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019473375 7:1232914-1232936 GGGCGGCGGCGGCGGAGACAGGG - Exonic
1019511491 7:1419796-1419818 GAGGAGCTGAGGCGGCGACCTGG - Intergenic
1019616572 7:1965624-1965646 GAGCAGAGGCAGGGGCCACGGGG - Intronic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019765063 7:2844065-2844087 GGGCAGCGGCGCGCGCGACGCGG - Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020238525 7:6374699-6374721 GGGCCGCGGCGGCGGCGGCAGGG - Exonic
1021313185 7:19117171-19117193 GCGCAGCGCGGGCGGCGGCGCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022101918 7:27174003-27174025 GGGCAGCGGTGGCGGTGGCGGGG - Exonic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1024639365 7:51316884-51316906 GAGCAGCCGGGGCGGGGGCGCGG - Intergenic
1025296189 7:57776714-57776736 GAGCGGCGGCTGCGGGGACTCGG - Intergenic
1025478693 7:60957085-60957107 GAGCTGTGGCGGGGGTGACGCGG + Intergenic
1026765165 7:73155458-73155480 GCGAAGCGGCGGCGGGGGCGGGG - Intergenic
1027041638 7:74965213-74965235 GCGAAGCGGCGGCGGGGGCGGGG - Intronic
1027082004 7:75237156-75237178 GCGAAGCGGCGGCGGGGGCGGGG + Intergenic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1029123187 7:98281711-98281733 CGGCGGCGGCGGCGGGGACGCGG - Exonic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029270775 7:99375334-99375356 GAGCAGCGGGAGCGGCCAGGAGG - Intronic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029390587 7:100271701-100271723 GCGAAGCGGCGGCGGGGGCGGGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1032525590 7:132576748-132576770 GAGCAGCGGCGGCGGCTCTCGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033311752 7:140266784-140266806 GAGCTGCGGCGGCGGTGGAGGGG - Intergenic
1033390531 7:140924195-140924217 GGGCGGCGGCGGCCTCGACGTGG - Intronic
1033654318 7:143362670-143362692 GAGCGGCTGGGGCGGCGGCGCGG - Exonic
1034182121 7:149147335-149147357 GGGGAGGGGCGGAGGCGACGCGG + Intronic
1034243129 7:149624672-149624694 GAGCAGCGGCGGCAGAGACAGGG - Intergenic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037656064 8:20885186-20885208 AAGCAGCTGCTGCGGCGAGGAGG + Intergenic
1037769189 8:21789074-21789096 CTGCAGCGGCGGCGGCGACAAGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1039453895 8:37695841-37695863 GAGGAGGGGAGGCGGCGAGGAGG + Exonic
1039921461 8:41896788-41896810 CGGCGGCGGCGGCGGCGAAGCGG + Intergenic
1040014802 8:42691523-42691545 GAGGAACGGTGGCGGCGGCGAGG + Intergenic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1041919833 8:63168978-63169000 GGCCGGCAGCGGCGGCGACGGGG - Intronic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1043053343 8:75407903-75407925 GAGATGCGGCGGCGGCCGCGCGG + Intronic
1043502783 8:80873784-80873806 AAGCAGCAGCACCGGCGACGAGG + Intronic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1043847321 8:85177657-85177679 GAGCTCCGGAGGCGGGGACGGGG + Intronic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1048214132 8:132480478-132480500 GGCTGGCGGCGGCGGCGACGGGG - Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049419586 8:142510871-142510893 CGTCAGCGGCGGCGGGGACGCGG - Intronic
1049548524 8:143246057-143246079 GAGGAGCGGCAGGGGCCACGTGG + Intergenic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049762070 8:144336251-144336273 GAGGAGCGGCGGAGGCAGCGCGG + Exonic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054440856 9:65258893-65258915 AAGCCGCGGCGGCGGCGGGGGGG + Intergenic
1054489421 9:65762594-65762616 AAGCCGCGGCGGCGGCGGGGGGG - Intergenic
1054842666 9:69760048-69760070 CGGCCGCGGCGGCGGGGACGCGG - Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1058937188 9:109780220-109780242 GGCCGGCGGCGGCGGCGACCGGG + Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060916929 9:127397400-127397422 GGGCAGCGGCGAAGGCGGCGAGG - Exonic
1060979954 9:127786099-127786121 GAGCGGCGGCAGCAGCGACTGGG + Exonic
1061129864 9:128702799-128702821 GGGAAGCGGCGCCGGAGACGCGG - Exonic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061293682 9:129666092-129666114 GGGCAGCAGCGGCAGCGAGGCGG + Exonic
1061666390 9:132162911-132162933 GAGCAGAGGCGGCGGGAAGGCGG + Intronic
1061726955 9:132587276-132587298 GGGCACCGGCGGCGGCTGCGAGG + Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1062084519 9:134641872-134641894 GCGGGGCGGCGGCGGCGAGGAGG + Exonic
1062254728 9:135615457-135615479 GACCAGGGACGGCGGGGACGTGG + Intergenic
1062491723 9:136808135-136808157 GCTCAGCGGCGGCGGGGAAGGGG - Exonic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062599827 9:137314738-137314760 GGGCAGCGTCGGCGGCGAGAAGG + Intronic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203470215 Un_GL000220v1:112789-112811 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478036 Un_GL000220v1:156761-156783 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1185621487 X:1453411-1453433 GAGCGCCGGGGGCGGGGACGGGG - Intronic
1185641539 X:1591724-1591746 GGCCAGCGGCGGCGGCGGCCTGG + Exonic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1187067465 X:15854726-15854748 CGGCGGCGGCGGCGGCGAAGGGG + Exonic
1187181451 X:16946929-16946951 CAGCAGCAGCGGCGGCGGCCCGG - Exonic
1187403658 X:18984142-18984164 GAGGCGCGGGGGCGGGGACGGGG + Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189035652 X:37491907-37491929 GGGCAGTGGCGGCAGCGGCGGGG - Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1190984478 X:55488693-55488715 CAGCAGCGGCGGCGACGAGAAGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1192177645 X:68895816-68895838 GAGCAGCGGGGGCAGGGAGGTGG - Intergenic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1195716840 X:107826301-107826323 TAGCGGCGGCGGCGGCGACCGGG + Exonic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1200003192 X:153072525-153072547 GCGCCGCTGCGGCGGCGGCGGGG - Exonic
1200004531 X:153077484-153077506 GCGCCGCTGCGGCGGCGGCGGGG + Intergenic