ID: 919851357

View in Genome Browser
Species Human (GRCh38)
Location 1:201675121-201675143
Sequence TCATCCCCAGGTCAGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919851357_919851366 6 Left 919851357 1:201675121-201675143 CCCCACCTCTGACCTGGGGATGA 0: 1
1: 0
2: 4
3: 49
4: 440
Right 919851366 1:201675150-201675172 CACATGAGATTTAGAGGGAACGG 0: 1
1: 0
2: 6
3: 34
4: 314
919851357_919851367 24 Left 919851357 1:201675121-201675143 CCCCACCTCTGACCTGGGGATGA 0: 1
1: 0
2: 4
3: 49
4: 440
Right 919851367 1:201675168-201675190 AACGGCCTCCAGACTACACCAGG 0: 1
1: 0
2: 0
3: 6
4: 62
919851357_919851364 1 Left 919851357 1:201675121-201675143 CCCCACCTCTGACCTGGGGATGA 0: 1
1: 0
2: 4
3: 49
4: 440
Right 919851364 1:201675145-201675167 CTTTCCACATGAGATTTAGAGGG 0: 1
1: 5
2: 141
3: 1460
4: 3219
919851357_919851363 0 Left 919851357 1:201675121-201675143 CCCCACCTCTGACCTGGGGATGA 0: 1
1: 0
2: 4
3: 49
4: 440
Right 919851363 1:201675144-201675166 CCTTTCCACATGAGATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919851357 Original CRISPR TCATCCCCAGGTCAGAGGTG GGG (reversed) Intronic
900816460 1:4850733-4850755 TCATCCCCAGTTCAAATCTGTGG - Intergenic
901125246 1:6924433-6924455 TCAGCCCCAGCTCAGGGGTGGGG - Intronic
901685078 1:10939236-10939258 TCATCCCCATTTCACAGATGAGG + Intergenic
901770089 1:11525588-11525610 GCATCCCCATGTCACAGATGAGG - Intronic
901856301 1:12046426-12046448 TTATCCCCAGTTTAGAGATGGGG + Intergenic
901911282 1:12460387-12460409 GCGGCCCCAGGTCAGTGGTGTGG + Exonic
902110215 1:14072104-14072126 TCATCCCCATTTCACAGGTGAGG - Intergenic
902227282 1:15004494-15004516 TTGTCCCCAGTTCACAGGTGAGG - Intronic
902361550 1:15944931-15944953 TCATCCACAAGTGCGAGGTGAGG - Exonic
902556788 1:17251447-17251469 TCATCCCCAGGCAACAGGTGAGG - Intronic
902627755 1:17686622-17686644 TCATGGCCAGGGCAGGGGTGCGG + Intronic
903336779 1:22629671-22629693 TCATTCCCAGTTTATAGGTGAGG + Intergenic
903341937 1:22660194-22660216 TCATCCCCATTTCACAGATGAGG + Intronic
903521394 1:23953196-23953218 TTATCCCCAGTTCACAGATGGGG + Intergenic
903651542 1:24925515-24925537 TCATCCCCATCTCACAGATGAGG + Intronic
903663549 1:24993300-24993322 TCATCCCCATTTCACAGATGAGG - Intergenic
904114480 1:28151491-28151513 TAATCCCCAGTGCAGAGGTGTGG + Intronic
904412091 1:30330660-30330682 TCATCCCCATTTCACAGATGAGG + Intergenic
906144478 1:43551679-43551701 TTATCCCCATTTAAGAGGTGGGG - Intronic
906304954 1:44711894-44711916 TCATCCCCAGTTTACAGATGAGG + Intronic
906695791 1:47822689-47822711 TTATCCCCATTTCAGAGATGAGG + Intronic
907269127 1:53280358-53280380 TCATCCCCATTTTATAGGTGAGG - Intronic
907326200 1:53640148-53640170 ACAACCCAAAGTCAGAGGTGGGG + Intronic
907401847 1:54229230-54229252 TCATCCCCACTTCACAGGTGAGG + Intronic
907489869 1:54801907-54801929 TCATCCTCATGTCACAGGTGAGG - Intergenic
907813466 1:57895257-57895279 TAATCCCCAGGTCAGACCTATGG + Intronic
907831605 1:58069758-58069780 TTATCCCCATTTCAGAGCTGAGG + Intronic
908318428 1:62957664-62957686 TGAACCCTAGGTCAGAGTTGGGG + Intergenic
908322483 1:62991738-62991760 TCAGCCACAGGTGGGAGGTGGGG - Intergenic
910435496 1:87201632-87201654 TCATCCCCATTTTACAGGTGAGG - Intergenic
912906180 1:113710120-113710142 TTATCCCCAGTTTAGAGGTGAGG - Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914334899 1:146705123-146705145 TCAGCCCCATGTCATAGGGGTGG + Intergenic
916611245 1:166393952-166393974 TCATCCTAAGGTCAGATGTGAGG - Intergenic
917100280 1:171438232-171438254 TAATCCCCATGTTGGAGGTGGGG - Intergenic
917205006 1:172562838-172562860 TAATCCCCACGTTAGAGGAGCGG + Intronic
917256512 1:173121989-173122011 TTATCCCCATTTCAGAGATGGGG + Intergenic
917976756 1:180244871-180244893 TGACTCCCAGGGCAGAGGTGCGG + Intronic
918375284 1:183902786-183902808 TCATCCTCAATTCAAAGGTGAGG + Intronic
919777258 1:201202341-201202363 TTATCCCCAGTTCACAAGTGAGG - Intronic
919851357 1:201675121-201675143 TCATCCCCAGGTCAGAGGTGGGG - Intronic
919895620 1:202008166-202008188 TCAGCTCCATGTCAGCGGTGAGG + Exonic
919899607 1:202034394-202034416 TCAACCACATGTGAGAGGTGGGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920493609 1:206438247-206438269 TCATCCCCTGGTGGGAGGGGAGG + Intronic
920657150 1:207885722-207885744 TCTTCCCTAGGACAGAGGGGAGG - Intronic
921194461 1:212741402-212741424 TAATCCCAATGTTAGAGGTGGGG + Intronic
921260975 1:213384829-213384851 TCATCCCCATTTCATAGGTGAGG + Intergenic
922412377 1:225389236-225389258 TCATCCCCATTTTAGAGATGAGG + Intronic
922485932 1:225972939-225972961 TCATCCCCATTTTACAGGTGAGG - Intergenic
923802576 1:237224888-237224910 TCATCCCCACTTTACAGGTGAGG + Intronic
924549222 1:245059051-245059073 TCATCCCCATTTTACAGGTGTGG + Intronic
924683566 1:246263355-246263377 ACATACCCAGGTCAGAGTTAGGG + Intronic
1064316703 10:14264165-14264187 TTATGCCCAGTTCAGAGATGGGG + Intronic
1065286112 10:24189145-24189167 TCATCCCCAGATTCCAGGTGAGG - Intronic
1065852330 10:29801182-29801204 TAATCCCCAGCTTGGAGGTGGGG - Intergenic
1069531896 10:69225809-69225831 TTGTCCCCAGGTGAGAGGTGAGG - Intronic
1069590741 10:69640217-69640239 TCATCCCCATTTCACAGATGAGG - Intergenic
1069634844 10:69918838-69918860 TCTTCCCCAGGTGAGGGGTGTGG - Intronic
1069638199 10:69938252-69938274 GAAGCCCCAGGTCAGAGGTGGGG + Intronic
1069784758 10:70980890-70980912 TCATCCCCATTTCACAGATGAGG - Intergenic
1070156505 10:73838973-73838995 TCATCCCCATTGGAGAGGTGAGG + Intronic
1070379093 10:75863575-75863597 TCATCCCCATTTTACAGGTGAGG - Intronic
1071172817 10:82887185-82887207 TCATGCCCAGCTCAGAGATTAGG + Intronic
1072081149 10:92033415-92033437 TCATCACAAGGTGATAGGTGTGG - Intergenic
1072199622 10:93146501-93146523 TCATCCCCATTTCACAGATGAGG + Intergenic
1072239640 10:93483555-93483577 TTATCCCCAGTTCATAGATGAGG - Intergenic
1072277242 10:93835151-93835173 TAATCCCCAAGTTGGAGGTGGGG - Intergenic
1072479148 10:95793764-95793786 TCAGCCCCATGTCAGAGGGTAGG - Intronic
1072941275 10:99766361-99766383 TCATCCCCATTTCACAGATGGGG + Intergenic
1073118038 10:101103442-101103464 CCATCCCCATGTCACAGATGAGG - Intronic
1073674110 10:105626037-105626059 TTATCCCCATGTCAAAGATGAGG - Intergenic
1074100720 10:110353084-110353106 TCATCCCCATTTTAGAGGTGAGG + Intergenic
1074253958 10:111781981-111782003 TCATTCCCAGTACAGAGCTGGGG + Intergenic
1074600943 10:114912620-114912642 GCAGCCCCAGGGCAGAGGTTGGG - Intergenic
1075051552 10:119186114-119186136 TCATCCCCATTTCCAAGGTGAGG + Intergenic
1075100336 10:119502177-119502199 TCATAGCCAGGGCTGAGGTGGGG + Intronic
1075420763 10:122298743-122298765 TTATCCCTAGGTCACCGGTGGGG - Intronic
1076460383 10:130640221-130640243 TAATCCCAATGTCAGAGGAGGGG - Intergenic
1076942068 10:133616568-133616590 TCGTCCCCGGGGCAGGGGTGGGG + Intergenic
1077123698 11:922950-922972 TATTCCCAAGGGCAGAGGTGGGG - Intergenic
1077541443 11:3148336-3148358 GCCTCCCCAGGTCAGGGGTGGGG - Intronic
1077991054 11:7412874-7412896 TCTTCCCAGGGTCTGAGGTGCGG - Intronic
1078359696 11:10658710-10658732 TCAGTCCCAGGTCAGTGCTGTGG + Intronic
1078418775 11:11189394-11189416 TAATCCCCACATCAGAGGAGGGG - Intergenic
1078436751 11:11331734-11331756 TTATCTCCATGTCACAGGTGGGG - Intronic
1079299987 11:19269350-19269372 TCATCCCCATTTTAGAGATGAGG + Intergenic
1079394017 11:20045946-20045968 TCATCCCCATTTTACAGGTGAGG - Intronic
1079788245 11:24702683-24702705 TAATCCCCATGTTGGAGGTGGGG - Intronic
1080451827 11:32384408-32384430 TCATGACCAGGGCAGGGGTGGGG - Intergenic
1081304436 11:41494310-41494332 ACATCCCCATGTTATAGGTGAGG - Intergenic
1081743300 11:45455958-45455980 TCATCCTCATTTCATAGGTGAGG + Intergenic
1081810536 11:45911613-45911635 TCATCCCCATCTTACAGGTGAGG + Intronic
1082030992 11:47603347-47603369 TTATCCCCATTTCACAGGTGGGG - Intergenic
1082795828 11:57377168-57377190 TCATCCCCATTTCACAGATGAGG + Intronic
1083628296 11:64083054-64083076 TCATCCCCATTTCACAGGTGAGG + Intronic
1083694705 11:64434828-64434850 TAATCCCCATTTCACAGGTGAGG + Intergenic
1083969924 11:66068691-66068713 TCAGCCCCAGGACAGCCGTGGGG + Exonic
1084007678 11:66331953-66331975 CCCTCCCCACGTCAGAGGTTGGG + Intronic
1084241365 11:67822816-67822838 TCATCCCCAAGTTACAGATGAGG - Intergenic
1084404906 11:68966070-68966092 CCATCCCCAGGTCACAGCTGAGG - Intergenic
1084831079 11:71769813-71769835 TCATCCCCAAGTTACAGATGAGG + Intergenic
1085273045 11:75281619-75281641 TCATCCCCATTTCACAGATGGGG - Intronic
1085523035 11:77149338-77149360 TCACTCCCAGCTCAGAGGGGTGG + Intronic
1087290236 11:96313315-96313337 TCATCCCCATCTCAGAACTGGGG + Intronic
1088019756 11:105105216-105105238 TCATCTCTCAGTCAGAGGTGAGG - Intergenic
1088990035 11:114945504-114945526 TGATCCCCATGTTAAAGGTGAGG - Intergenic
1089214263 11:116826312-116826334 CCTTCCCCAGGCCAGAGGGGAGG + Intergenic
1089340817 11:117756175-117756197 GCAGCCCCAGTTCAGAGCTGGGG + Intronic
1090352349 11:126115440-126115462 TCAGCCACAGGCCAGAGGTAGGG - Intergenic
1090415102 11:126535121-126535143 GCATCCTCAGATCAGTGGTGGGG + Intronic
1090732236 11:129581776-129581798 ACATCCCCACTGCAGAGGTGAGG + Intergenic
1091188515 11:133669414-133669436 TCTTCCCCATTTCACAGGTGGGG + Intergenic
1091758723 12:3073173-3073195 TCATCTCCATGTCAGAGGGGTGG + Intergenic
1091941850 12:4492609-4492631 TCAGCCCCAGGGCAGAGGGGGGG - Intronic
1092118973 12:6030531-6030553 TCATCCCCAGGCCACAGTTTTGG - Intronic
1092751551 12:11724028-11724050 GCACCCTCAGGTCAGGGGTGGGG - Intronic
1096810733 12:54168079-54168101 ACCTCCCCAAGTCAGGGGTGAGG + Intronic
1098255690 12:68612685-68612707 TCATCCTCAGGTTTTAGGTGAGG + Intronic
1100234628 12:92648364-92648386 TCTTCAGCAGGTCTGAGGTGGGG + Intergenic
1100276862 12:93079586-93079608 TCATCCTCATTTCATAGGTGAGG - Intergenic
1100572416 12:95855457-95855479 TCATCCCCATTTTAGAGATGAGG - Intergenic
1100870611 12:98906497-98906519 TCCTCCTCAGATCAGAGTTGTGG - Intronic
1101442859 12:104716397-104716419 TCATCCCCATTTCACAGATGAGG - Intronic
1102000003 12:109551436-109551458 TCCTCCCCATTTCACAGGTGAGG - Intergenic
1102259934 12:111437549-111437571 TCATCCCCATTTTACAGGTGAGG + Intronic
1102344570 12:112151340-112151362 ACATCTCCAGGGCAGAGATGGGG - Intronic
1102514009 12:113434562-113434584 TTATCCCCATTTCATAGGTGAGG + Intronic
1102795569 12:115686411-115686433 TCATCCCCAGGACACAGATGTGG - Intergenic
1103009152 12:117444639-117444661 TCATCCCCAATTCACAGATGAGG - Intronic
1103763853 12:123268662-123268684 TCATCCCCACGTGGGAGGCGTGG - Intronic
1104245997 12:127041951-127041973 TCATCCCCAGTGTTGAGGTGGGG - Intergenic
1104779470 12:131410835-131410857 TAAGCCCCAGGGCACAGGTGTGG - Intergenic
1108066352 13:46581583-46581605 TCATCCCCGTGTTAGATGTGAGG + Intronic
1109050328 13:57472586-57472608 TGATCCTCAGGTTGGAGGTGGGG - Intergenic
1109271146 13:60256452-60256474 TCATCCTCAGGTTGGAAGTGGGG - Intergenic
1111233207 13:85372332-85372354 TGATCCCCAAGTTGGAGGTGGGG + Intergenic
1112073647 13:95883483-95883505 TAATCCCCACGTCAGGGGAGGGG + Intronic
1113875595 13:113592731-113592753 TCCTGCCCAGGTGACAGGTGTGG + Intronic
1114901964 14:27072771-27072793 TCATTCCCAGGACAGATGCGTGG + Intergenic
1115179064 14:30601070-30601092 TCATCCCTACCCCAGAGGTGGGG - Intronic
1115303773 14:31913771-31913793 GTAGCACCAGGTCAGAGGTGTGG + Intergenic
1115456662 14:33612051-33612073 TCTGCCCCAGGTGACAGGTGGGG + Intronic
1118106232 14:62663153-62663175 TCATCACAAGGTGATAGGTGTGG + Intergenic
1118883108 14:69845219-69845241 TTATCCCCATTTCACAGGTGAGG - Intergenic
1118977788 14:70692437-70692459 GCATCTCCAGCTCAGAAGTGAGG + Intergenic
1119282634 14:73422820-73422842 TGATTCCCAGGTTGGAGGTGGGG - Intronic
1121542749 14:94740959-94740981 TCATCCCCATTTCACAGATGAGG + Intergenic
1121674315 14:95740146-95740168 TTATCCCCAGTTCACAGATGAGG + Intergenic
1121812617 14:96904677-96904699 CCTTCCCCTGGGCAGAGGTGAGG + Intronic
1122087376 14:99317101-99317123 GCATCCCCATTTCACAGGTGAGG - Intergenic
1122930244 14:104929820-104929842 TCATCCCCATTTTATAGGTGAGG - Intronic
1122965123 14:105119915-105119937 TCATGCCAAGGAGAGAGGTGCGG + Intergenic
1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG + Intronic
1127660563 15:61096581-61096603 TAATCCCCATTTCAGAGATGGGG + Intronic
1128129281 15:65214967-65214989 TCATCCCCTGGGCAGGGATGGGG - Intergenic
1129417279 15:75392748-75392770 TCATACGCAAGTGAGAGGTGTGG + Exonic
1130090644 15:80818254-80818276 CCATCACCAGGGCAGAGGAGAGG + Intronic
1130120538 15:81043729-81043751 TTATCCCCATTTTAGAGGTGAGG + Intronic
1130126163 15:81095802-81095824 GCATCACAAGGTCAGAGGAGGGG - Intronic
1130235181 15:82126707-82126729 ACATCCCTGGGCCAGAGGTGAGG - Intergenic
1131117913 15:89805758-89805780 TCATCCCCAGCTCCCTGGTGAGG + Intronic
1131562113 15:93453815-93453837 TCATTCCCATTTTAGAGGTGAGG - Intergenic
1131861894 15:96662519-96662541 TCATCCCCAGATCACAGGTGAGG + Intergenic
1131900023 15:97077637-97077659 CCATCCCCAAGTGAGAGATGAGG - Intergenic
1132028880 15:98424577-98424599 TCATCCCCTTTTCACAGGTGAGG + Intergenic
1132214297 15:100051324-100051346 TCACCCATAGGTCAGAGCTGTGG + Intronic
1132263828 15:100448922-100448944 TCATCCCCAGGTAGCAGCTGTGG - Intronic
1132408694 15:101560969-101560991 ACATCCCCAGCTAAGAAGTGGGG + Intergenic
1132738523 16:1399178-1399200 CCATCCCCAGGACAGACGCGTGG + Intronic
1132881052 16:2161883-2161905 TCAGCCCTGGGACAGAGGTGTGG - Intronic
1133042823 16:3069472-3069494 ACAGCACCAGGTCAGAGCTGCGG - Exonic
1133044864 16:3082114-3082136 ACAGCGCCAGGTCAGAGCTGCGG - Intronic
1133045552 16:3086667-3086689 TCATCCCCCGGGCAGGGCTGGGG + Intergenic
1133294588 16:4745157-4745179 TCATCCCCATTTTAGAGATGGGG + Intronic
1133433347 16:5757725-5757747 TCATCCCCACTTCACAGATGTGG + Intergenic
1133805831 16:9125480-9125502 TCATTCCCAGGTGAGAAGAGGGG + Intergenic
1133922545 16:10166530-10166552 TCATCCACAGGTCTGAGGGTAGG - Intronic
1134189946 16:12113265-12113287 TCATGCCCATTTCAGAGGTGGGG + Intronic
1134514836 16:14878711-14878733 TCATCCCCAGATAAAAGCTGAGG + Exonic
1134702513 16:16277360-16277382 TCATCCCCAGATAAAAGCTGAGG + Exonic
1134965030 16:18434755-18434777 TCATCCCCAGATAAAAGCTGAGG - Exonic
1134969317 16:18517290-18517312 TCATCCCCAGATAAAAGCTGAGG - Intronic
1135349513 16:21716752-21716774 TCATCCCCATTTCACAGGTGAGG - Intronic
1136083316 16:27867347-27867369 TCATCCCCATTTTAGAGATGAGG - Intronic
1137070731 16:35902279-35902301 TCATCACAAGGTGATAGGTGTGG + Intergenic
1137703998 16:50520936-50520958 TCAACCCCAGAGCAGAGGTCAGG - Intergenic
1138207345 16:55134581-55134603 TGAGCCCCAGGTGAGAGCTGTGG + Intergenic
1138425511 16:56929500-56929522 TTTTCCACAGGCCAGAGGTGGGG + Intergenic
1139305796 16:65985305-65985327 TTATCCCCAGGTGAGGGCTGAGG + Intergenic
1139852756 16:69960864-69960886 CGATCCTCAGGTCACAGGTGTGG - Exonic
1139881727 16:70183772-70183794 CGATCCTCAGGTCACAGGTGTGG - Exonic
1139998724 16:71006113-71006135 TCAGCCCCATGTCATAGGGGTGG - Intronic
1140370781 16:74411734-74411756 CGATCCTCAGGTCACAGGTGTGG + Exonic
1140768518 16:78182158-78182180 TCATCCCCAAGTTACAGATGAGG - Intronic
1141510539 16:84509257-84509279 CCAGCAGCAGGTCAGAGGTGGGG + Intronic
1141518022 16:84559383-84559405 TGCTCCCCAGGTGCGAGGTGTGG - Intergenic
1141574382 16:84954720-84954742 TGATCCCCAGTTCACAGATGGGG + Intergenic
1142864843 17:2784611-2784633 TGATCCCCTGGCCACAGGTGAGG + Intronic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1144795961 17:17891450-17891472 GCATCCTCAGGGTAGAGGTGTGG + Intronic
1145254658 17:21316046-21316068 TCATCCCCAGGCCAGGAGGGTGG + Intergenic
1145321939 17:21771919-21771941 TCATCCCCAGGCCAGGAGGGTGG - Intergenic
1145971265 17:28957793-28957815 TCATCCCCATTTCACAGATGAGG + Intronic
1146474631 17:33153122-33153144 TCATCCCCATTGCAGAGATGAGG + Intronic
1147141521 17:38463233-38463255 GCATCCCCAGGGCAAAGGGGAGG - Intronic
1147328381 17:39681353-39681375 TCATCCCCAGTTTATAGATGAGG - Intronic
1147691182 17:42315774-42315796 TCAACTCCATGTCAAAGGTGAGG + Exonic
1147725030 17:42561811-42561833 TCATTCCAGGGACAGAGGTGGGG - Intronic
1147780854 17:42940863-42940885 TCATCCCCATTTCACAGCTGAGG - Intergenic
1148173805 17:45547265-45547287 TGATCCCCAGTTTAAAGGTGAGG + Intergenic
1148215155 17:45830250-45830272 CCAAACCCAGGTCAGAGGAGGGG + Intronic
1148275463 17:46298182-46298204 TGATCCCCAGTTTAAAGGTGAGG - Intronic
1148297569 17:46515761-46515783 TGATCCCCAGTTTAAAGGTGAGG - Intronic
1148362121 17:47020240-47020262 TGATCCCCAGTTTAAAGGTGAGG - Intronic
1148724088 17:49776237-49776259 TCATCCCCATTTCACAGGTGAGG + Intronic
1150227032 17:63529893-63529915 CCACCCACAGGGCAGAGGTGGGG - Intronic
1150230139 17:63545255-63545277 TCCTGCACAGGTAAGAGGTGAGG + Exonic
1150405017 17:64894187-64894209 TGATCCCCAGTTTAAAGGTGAGG + Intronic
1150448933 17:65249492-65249514 ACATCCTAAGCTCAGAGGTGAGG - Intergenic
1151459985 17:74248773-74248795 TCATCTCCATGTCACAGATGAGG + Intronic
1151533757 17:74725381-74725403 GCATCCCTAGGTCTGTGGTGTGG - Intronic
1151681939 17:75626973-75626995 CCTTGCCCAGGTCAGAGCTGTGG - Exonic
1151757542 17:76083276-76083298 TCCAGCCTAGGTCAGAGGTGGGG - Exonic
1152169864 17:78738272-78738294 CCATCCCCAGATCACAGATGAGG + Intronic
1156331508 18:36128591-36128613 TCATTCCCAGGAGAGAGGCGAGG + Intronic
1156491269 18:37497877-37497899 TCATCCCCATTTCACAGGTGAGG + Intronic
1156721412 18:40074573-40074595 TTATGCCCATGTAAGAGGTGTGG - Intergenic
1156912547 18:42427462-42427484 TCATCTCCACTTTAGAGGTGAGG - Intergenic
1157432817 18:47643744-47643766 TGATCCCAATGTTAGAGGTGGGG + Intergenic
1157434614 18:47657919-47657941 TCAGTCTCAGGTAAGAGGTGGGG - Intergenic
1157485847 18:48086293-48086315 TCATCCCCATTTTATAGGTGAGG + Intronic
1158652541 18:59300812-59300834 TCATTGCTAGGTCAGAGGTAAGG - Intronic
1159194868 18:65100484-65100506 CCACCCCCAGGTCATAGGTCCGG + Intergenic
1159319805 18:66831686-66831708 TAATCCCCATGTTGGAGGTGGGG - Intergenic
1160583634 18:79901174-79901196 TGAGGGCCAGGTCAGAGGTGGGG + Intergenic
1161120306 19:2522038-2522060 TCATCCCCAGATGAGATCTGGGG - Intronic
1161468327 19:4444283-4444305 GCATCCCCAAGTCAGCAGTGGGG + Intronic
1161993461 19:7698472-7698494 CCATCCCCAGCTGGGAGGTGGGG - Intronic
1161993515 19:7698655-7698677 TCACCCCCATCTCAGAGCTGGGG - Intronic
1162192384 19:8957116-8957138 TCTTCACTAGGCCAGAGGTGGGG + Exonic
1162786176 19:13036378-13036400 TCCTCTCCAGGCCAGGGGTGGGG + Intronic
1163670100 19:18622634-18622656 TCATCCCCTGGGCAGAGCTCAGG + Intergenic
1164403362 19:27919038-27919060 TCCTCCCCAGGTGAGGGCTGTGG + Intergenic
1164776324 19:30856478-30856500 CCATCTCCAGGTCAGGGGTGAGG - Intergenic
1165341384 19:35214545-35214567 TCATCCCTGAGTCAGGGGTGAGG - Intergenic
1165886926 19:39084925-39084947 TCATCCCCATATCACAGATGAGG - Intronic
1166647133 19:44540669-44540691 TTATCCCCATTTCACAGGTGAGG + Intergenic
1166978210 19:46617412-46617434 AGACACCCAGGTCAGAGGTGGGG + Intergenic
1167301290 19:48679428-48679450 TCATCCCCATTTAACAGGTGAGG + Intergenic
1168269408 19:55241464-55241486 GCCTCCCAAGGTCAGGGGTGTGG - Exonic
925139509 2:1540144-1540166 TCATCTCCAGGTCGGGGCTGGGG + Intronic
926221939 2:10942182-10942204 TGATCTCCAGGTCAGAGGTGTGG - Intergenic
927268422 2:21179673-21179695 GGATCACCAGGTCAGAGCTGTGG - Intergenic
927786694 2:25979835-25979857 AAATCCCCATTTCAGAGGTGAGG - Intronic
928198177 2:29229631-29229653 TTATCCCCAAGCCACAGGTGAGG - Intronic
931691785 2:64839818-64839840 TCATCCCCAGTACACAGGTGAGG - Intergenic
934558469 2:95299956-95299978 TCATCCCCACTTCACAGATGGGG + Intronic
934651447 2:96093431-96093453 TCATTCTCAGGTCAGAAATGTGG - Intergenic
934999209 2:98995234-98995256 TCAGCCTCAGGTCAGTAGTGAGG - Intergenic
935187379 2:100746434-100746456 ACATGCCTAGGTAAGAGGTGCGG + Intergenic
935378283 2:102422498-102422520 GCATTCCCAGGGCAGAGGGGTGG - Intronic
937298138 2:120822010-120822032 TCACCTCCATGTCAGAGGTGTGG - Intronic
939214222 2:139215283-139215305 TCATCCTAAGGTCAGAAATGAGG + Intergenic
939379310 2:141414006-141414028 GCATCACGAGGTCAGAGGTCAGG + Intronic
939681635 2:145142155-145142177 TCATCCCCACGTGACAGATGGGG + Intergenic
941632432 2:167899341-167899363 GAATCCCCAGGTCTGAGTTGTGG - Intergenic
943634915 2:190295939-190295961 TCATCCCCATTTCAGAACTGAGG + Intronic
944609787 2:201390844-201390866 TCTTCCTCTGGTCAGGGGTGAGG + Intronic
946336915 2:219043789-219043811 TTATCCCCAGGTAACAGATGAGG - Intergenic
946389267 2:219405588-219405610 GCCTCTCCAGGACAGAGGTGTGG + Intergenic
948665044 2:239529326-239529348 TCATCCCCAGTTTATAGATGAGG - Intergenic
1168975270 20:1961146-1961168 TCATCTCCTAGACAGAGGTGGGG + Intergenic
1169491696 20:6076578-6076600 ACAACCCAAGGTCAGAGGAGTGG - Exonic
1169941315 20:10941006-10941028 TAATGTCCAGGTCTGAGGTGAGG + Intergenic
1170579829 20:17690131-17690153 TTATCCTCAGTTCACAGGTGAGG + Intergenic
1170693753 20:18638633-18638655 TCAACCCCAGGTCACAGCTCTGG - Intronic
1171466142 20:25329191-25329213 TCATCCACAGGCCTGGGGTGGGG + Intronic
1172099010 20:32474522-32474544 TTGTCCTCAGGTGAGAGGTGTGG - Intronic
1172408914 20:34708624-34708646 TCTTCCCCAGGCCAGGAGTGGGG + Intronic
1172640755 20:36439209-36439231 TCATCCCCATTTTAGAGATGAGG + Intronic
1172766164 20:37352153-37352175 TCATCCCCATTTCACAGATGGGG - Intronic
1173475397 20:43355658-43355680 TGCTCCCCAGGTCAGCTGTGAGG - Intergenic
1173672553 20:44809117-44809139 TGATCCCCATTTCAGAGATGAGG + Intronic
1173828217 20:46060917-46060939 CTTTCCCCAAGTCAGAGGTGAGG - Intergenic
1173843272 20:46172882-46172904 TCAGCCCCAGTTCACAGATGAGG - Intergenic
1174265040 20:49325264-49325286 TCAAACCCAGCTCAGAGATGAGG - Intergenic
1174526197 20:51173535-51173557 TCATCCCCACCTCATAGGTAAGG - Intergenic
1174550158 20:51356356-51356378 TCATCCCCATTTTACAGGTGGGG - Intergenic
1174715663 20:52755242-52755264 TAATCCCCATGTTGGAGGTGGGG - Intergenic
1175192923 20:57223632-57223654 TCATCCCCATTTTACAGGTGCGG - Intronic
1175258750 20:57662327-57662349 TCATCCCCATTTCACGGGTGAGG + Intronic
1175302881 20:57955446-57955468 TCCTACCCAGGTCTGCGGTGAGG + Intergenic
1175981870 20:62742789-62742811 TGCTCCCCATGCCAGAGGTGGGG - Intronic
1175985980 20:62764368-62764390 ACCTGCCCAGCTCAGAGGTGGGG + Intergenic
1176383919 21:6127623-6127645 TCCTCCCAAGATCAGAGGTGGGG - Intergenic
1176866165 21:14056271-14056293 GCATGCCCAGGGCAGAGGTAGGG + Intergenic
1178721570 21:35015198-35015220 TGATCCCCACGTCACAGGTGTGG - Intronic
1179486860 21:41716067-41716089 TGTCCCCCAGGGCAGAGGTGGGG + Intergenic
1179739555 21:43410615-43410637 TCCTCCCAAGATCAGAGGTGGGG + Intergenic
1179980863 21:44895025-44895047 TCATCCCCAAGTCAGCCGTGGGG - Exonic
1181032798 22:20156396-20156418 GCTTCCCCATGTCAGAGGTGAGG + Intergenic
1181510522 22:23386860-23386882 GCCTTCCCATGTCAGAGGTGAGG - Intergenic
1182093040 22:27609053-27609075 TCATCCCCATTTTACAGGTGAGG + Intergenic
1182517896 22:30869331-30869353 CCATCCCCAGGTGACAGATGAGG - Intronic
1182543985 22:31062284-31062306 TCATCCCCATGTCACAGACGGGG + Intergenic
1183165502 22:36144378-36144400 TGAACAGCAGGTCAGAGGTGGGG - Intronic
1183171903 22:36194547-36194569 TGAACTCCAGGTCAAAGGTGGGG - Intronic
1183176844 22:36230630-36230652 GCAACTCCAGGTCAAAGGTGGGG - Intronic
1183178898 22:36245323-36245345 TGAACTCCAGGTCAAAGGTGGGG + Intergenic
1183181388 22:36262459-36262481 GCAACTCCAGGTCAAAGGTGGGG + Intronic
1183475976 22:38035938-38035960 CCAGCCTGAGGTCAGAGGTGAGG + Intronic
1183545260 22:38452054-38452076 TCATCCCCATTTTACAGGTGGGG + Intronic
1184205515 22:43000011-43000033 TGATCCCCATTTCAAAGGTGAGG + Intronic
1184511146 22:44934077-44934099 CCATGCCCACGTCAGAGGAGAGG - Intronic
1184643764 22:45885456-45885478 GCACCCCCAGTGCAGAGGTGGGG + Intergenic
1184747737 22:46465799-46465821 CCACCCCCAGTTCACAGGTGAGG + Intronic
1185268538 22:49917984-49918006 CCAGCCCCAGGTGAGAGGTCGGG + Intronic
950098142 3:10342058-10342080 CTATCCCCAGGTCACAGATGGGG - Intronic
950239824 3:11358687-11358709 CCTTCCCCAGGGCAGAGATGTGG + Intronic
950684052 3:14603736-14603758 TCCTTCCCAGGACAGAGCTGAGG - Intergenic
951710588 3:25581963-25581985 TCTTCCCAAGGTCACAGATGGGG + Intronic
951860878 3:27251124-27251146 TCATCCCCAGGTTGCAGATGAGG + Intronic
952491791 3:33880854-33880876 TCACCCACTGGTCAGATGTGAGG + Intergenic
953044260 3:39281115-39281137 CCAACCCCAGGACAGAGCTGGGG + Intronic
953722927 3:45372148-45372170 GCATCCCCAGGTCTAAGGTGCGG - Intergenic
953902520 3:46851389-46851411 CCAGCCCCAGGGCATAGGTGTGG + Intergenic
954363347 3:50133894-50133916 ACATGCCCAGGTCAGAGGTGGGG - Intergenic
954465163 3:50649999-50650021 TCATCGCCAGGACACAGCTGAGG - Intergenic
954583618 3:51716895-51716917 CCTTCCCCAGGACAGAGGTGTGG + Intronic
954590703 3:51779055-51779077 TCCTCCCAAGATCAGAGATGGGG - Intronic
955001181 3:54929193-54929215 TTGTCCCCATGTCAGAGATGGGG - Intronic
955104763 3:55887179-55887201 TTATACTCAGTTCAGAGGTGAGG - Intronic
955530730 3:59870284-59870306 CCATTCCCATGTCACAGGTGAGG + Intronic
955558130 3:60159719-60159741 TTATCCCCAGTTCAAAGCTGAGG + Intronic
957056837 3:75449722-75449744 TCATCCCCAAGTTACAGATGAGG - Intergenic
959820448 3:110729401-110729423 TCATCCCCATTTTAGAGATGGGG + Intergenic
960408380 3:117290852-117290874 TCATCCCCATTTCACAGATGAGG + Intergenic
961296634 3:125889993-125890015 TCATCCCCAAGTTACAGATGAGG + Intergenic
961409478 3:126708243-126708265 TTATCCCCATCTCAGAAGTGAGG + Intronic
962282928 3:134065889-134065911 TCATCCCCACTTCACAGATGAGG + Intronic
962755334 3:138461693-138461715 TTAGCTCCAGGTTAGAGGTGAGG + Intronic
963078181 3:141367408-141367430 TCAACACCAGGTCTGAGGTTTGG - Intronic
963853256 3:150228151-150228173 ACATCCCAAGGACTGAGGTGAGG - Intergenic
964256366 3:154778989-154779011 TAATCTCCAGGAGAGAGGTGAGG - Intergenic
964869298 3:161295583-161295605 CCATCCCCTGGAAAGAGGTGTGG - Intergenic
965404257 3:168250086-168250108 TCCGCACCAGGTCCGAGGTGGGG - Intergenic
966705726 3:182911520-182911542 TCATCCCCAGTTTACAGATGAGG - Intronic
967201703 3:187077606-187077628 TCATCCCCACTTTACAGGTGTGG - Exonic
968489019 4:880249-880271 TGATCCACATGTCAGAGCTGTGG - Intronic
968609965 4:1552452-1552474 CCATGCCCAGGGCAGGGGTGTGG - Intergenic
968848704 4:3062998-3063020 TCCTCCCCAGGCCAGGGGAGGGG + Intergenic
969237362 4:5875211-5875233 TCAGCCTCAGCTCAGAGGGGAGG + Intronic
969446272 4:7246443-7246465 TAAGCCCCAGGTGAGATGTGTGG - Intronic
969446278 4:7246473-7246495 TAAGCCCCAGGTGAGACGTGTGG - Intronic
969446284 4:7246503-7246525 TAAGCCCCAGGTGAGATGTGTGG - Intronic
969446496 4:7247759-7247781 GCATCCCCAGTTCAAAGATGAGG - Intronic
969598743 4:8163391-8163413 TCATCCCGATGTCACAGATGGGG + Intergenic
971150644 4:24027995-24028017 TCATCCCCATTTAATAGGTGAGG + Intergenic
974515000 4:62897364-62897386 TCATCCCTAGCTTGGAGGTGGGG - Intergenic
975509562 4:75178764-75178786 CCATCCACAGTTCAGAGGTTAGG + Intergenic
976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG + Intronic
977341263 4:95761693-95761715 TCATCCCCAGACCAGATTTGTGG + Intergenic
978521498 4:109620275-109620297 TCAGCAACAGGTCAGAGGTGAGG + Intronic
981098728 4:140808151-140808173 TCATCTCCATTTCAGAGATGGGG + Intergenic
981284307 4:142997166-142997188 TAATCCCCATGTTGGAGGTGGGG - Intergenic
981889219 4:149716054-149716076 CCATCCCCAGCTCGAAGGTGAGG + Intergenic
982426946 4:155275401-155275423 TCATCATGAGGTCAAAGGTGAGG - Intergenic
983040953 4:162925431-162925453 CCATCTCCAGTTCAGTGGTGTGG - Intergenic
983742962 4:171158008-171158030 TCATCACAAGGTGATAGGTGCGG - Intergenic
984314697 4:178113006-178113028 CCATCCCCAGCTCAGAGCAGTGG - Intergenic
984708229 4:182863287-182863309 TCATCTCCAGTTCAGAGACGGGG - Intergenic
985031488 4:185794872-185794894 TTCTCCCCAGGCCAGAGGTCTGG - Intronic
986689818 5:10305125-10305147 TCATCCCCAGGTCAGTTCTGTGG + Intronic
986874950 5:12096282-12096304 TGATCCCCAGTTTAGAAGTGGGG - Intergenic
989393163 5:40923888-40923910 TAATCCCCATGTTGGAGGTGGGG - Intronic
989497985 5:42131725-42131747 TCATCCCAATGTTGGAGGTGGGG - Intergenic
990336100 5:54774352-54774374 TCTCCCCCAGGTCTGAGCTGGGG + Intergenic
990410426 5:55535372-55535394 TCATCCCCATGGAAGGGGTGGGG - Intergenic
991216995 5:64166317-64166339 CCCTCTCCAGGTCTGAGGTGGGG + Intronic
992412880 5:76524247-76524269 TCAAGCACAGGTCAGAAGTGAGG - Intronic
992557313 5:77916295-77916317 TAATCCCCAGTGCTGAGGTGGGG + Intergenic
992654462 5:78894821-78894843 GCATGCCCTGGTCAGAGGTGGGG - Intronic
992671998 5:79070052-79070074 TTATCCCCATTTCACAGGTGAGG + Intronic
992827804 5:80567935-80567957 TTATCCCCATTTCAGGGGTGAGG - Intronic
994170887 5:96658765-96658787 TCATCCACAGGTAACAGGTTAGG + Intronic
995731496 5:115247876-115247898 GCATTCCCAGGTCAGATGTCTGG - Intronic
995964737 5:117891150-117891172 TTATCCCCATTTCAGAGATGAGG + Intergenic
996205093 5:120724388-120724410 TCATCCCCAGTTTACAGATGAGG - Intergenic
998029067 5:138848224-138848246 TCATCCCCAGTTCCCAGTTGAGG - Intronic
999699450 5:154214902-154214924 TTATCCCCATTTCAGAAGTGGGG - Intronic
999720963 5:154399057-154399079 TCATCCCCACATCACAGTTGAGG + Intronic
999925412 5:156370422-156370444 TCATCACAAGGTCACAGATGAGG + Intronic
1000686948 5:164262189-164262211 TAATCCCCATGTTGGAGGTGAGG + Intergenic
1001198035 5:169691302-169691324 TAATCCCCAGGCTGGAGGTGGGG - Intronic
1001289109 5:170443886-170443908 TCAGGCCCAGGGCAGGGGTGGGG + Intronic
1001573160 5:172744113-172744135 TCATCCCCATGTCACAGATGAGG - Intergenic
1001857956 5:175029117-175029139 TTATCCCCAGTTGATAGGTGAGG - Intergenic
1002189067 5:177469481-177469503 TCATCCCCATTTCAGAGAGGCGG - Intronic
1002440059 5:179259569-179259591 GCATCCCCAGGGCAGAGGCTGGG + Intronic
1003452262 6:6245799-6245821 TCATCCCCAGGTGAGAGTGAAGG - Intronic
1003916409 6:10790787-10790809 TAATCCCCAGTTTTGAGGTGGGG + Intronic
1006002840 6:30979327-30979349 TCAGCCCAAGGTCATGGGTGGGG + Intergenic
1007138710 6:39549425-39549447 TTATCCCCATGTCATAGGTGAGG + Intronic
1007420168 6:41714516-41714538 TCATCACCAGATCAGAGGTGCGG + Intronic
1007627410 6:43254338-43254360 TCATCCCCATTTTAGAGATGAGG - Intronic
1008502314 6:52195790-52195812 TCATCTCTCAGTCAGAGGTGGGG - Intergenic
1012395713 6:98794897-98794919 TCATCCCCATTTCAAAGATGGGG - Intergenic
1012667420 6:101991267-101991289 TCATTCCCATTTCAGAAGTGAGG + Intronic
1013923967 6:115445851-115445873 TCCTCACCATGACAGAGGTGTGG + Intergenic
1014167547 6:118243013-118243035 ACATGCCCACGTCAGAGGAGTGG - Intronic
1015555028 6:134452113-134452135 GCATCCCCTGGGCAGAGGTGAGG + Intergenic
1016266634 6:142239895-142239917 TCCTCCCTAGGTCTGAGGAGTGG - Intergenic
1016521293 6:144950033-144950055 AAATCCCCAGGACAGGGGTGAGG + Intergenic
1016702982 6:147074992-147075014 TTATCCCCATTTTAGAGGTGGGG - Intergenic
1017010508 6:150060188-150060210 TCAGCCAAAGGTCAGAGATGTGG + Intergenic
1017073704 6:150599746-150599768 TCACCCTCAGGGCAGAGGGGAGG + Intergenic
1018998228 6:168726161-168726183 TCAAGTCCAGGCCAGAGGTGAGG + Intergenic
1019545889 7:1575955-1575977 TCATCAGCAAGTTAGAGGTGAGG - Intergenic
1022038148 7:26553603-26553625 TTATCCCCATTTCACAGGTGAGG - Intergenic
1022214485 7:28244794-28244816 TCATCCACAGGTTTGAAGTGAGG - Intergenic
1022291690 7:29010880-29010902 TTATCCCCATTTCACAGGTGAGG + Intronic
1022376299 7:29814654-29814676 TCATCCCCATTTCACAGATGAGG - Intronic
1022385579 7:29895854-29895876 TAATCCCCAATTTAGAGGTGGGG - Intronic
1022509857 7:30928236-30928258 TCATCCACTGGTCAGAGATGTGG + Intergenic
1023981180 7:45071122-45071144 TCATCCCCATTTTAGAGATGGGG + Intronic
1024060563 7:45695341-45695363 TTATCCCCATGTAACAGGTGAGG + Intronic
1024293981 7:47828290-47828312 TCATCCCAACCTCAGAGGTGAGG - Intronic
1030128794 7:106179465-106179487 TCATCCCCATTTCACAGATGAGG + Intergenic
1032070841 7:128805799-128805821 TCATCGCCAGGTCAGTGAGGAGG + Exonic
1032651981 7:133888846-133888868 TCATCCCCAGTTTAAAGATGAGG - Intronic
1033805991 7:144954645-144954667 TAATCCCCATGCCAGAGATGGGG - Intergenic
1035065722 7:156103848-156103870 TGATGCCCAGGTCAGACTTGTGG + Intergenic
1035227222 7:157440378-157440400 TGAAGCCCAGGTCAGATGTGAGG + Intergenic
1035338622 7:158146133-158146155 TGATCCTCAGGTGAGAAGTGAGG + Intronic
1036120543 8:6012762-6012784 TCATCCCCAGGTCATTTGTGTGG + Intergenic
1037738452 8:21585524-21585546 TCATCCCCACTTTAAAGGTGAGG - Intergenic
1040545337 8:48394480-48394502 TCATCCCCATTCCACAGGTGAGG - Intergenic
1041215277 8:55594403-55594425 TCATGCCCATGTTAGAGATGGGG - Intergenic
1042113595 8:65407888-65407910 CCTTCCCCAGTTCAGAGATGAGG + Intergenic
1042306945 8:67343044-67343066 GCTTCCCGAGGTCAGAGGCGCGG + Intronic
1042471699 8:69196997-69197019 TGATGCCCAGGTTTGAGGTGTGG - Intergenic
1044765101 8:95563250-95563272 TCATCTTCAGGTCAGAGGTCTGG - Intergenic
1045347410 8:101305430-101305452 TCATCCCCAGTTCACAGATGAGG - Intergenic
1046473688 8:114712756-114712778 TAATCCCCAGGTTAGAAGTTAGG - Intergenic
1047228859 8:122979129-122979151 TCATCTCCAGGTCTCAGATGAGG - Intergenic
1048294384 8:133203517-133203539 TCATCCCTAGTTCACAGATGAGG - Intronic
1048503494 8:134999920-134999942 TCATCCCCATTGCACAGGTGAGG - Intergenic
1048516258 8:135114220-135114242 TCATCTCCAGGTGAGATGTTGGG + Intergenic
1048809467 8:138272954-138272976 CCATCCCCAGTTCACAGATGAGG - Intronic
1049921314 9:367063-367085 TCATCCCCATGTCACAAGTGAGG - Intronic
1052342735 9:27379494-27379516 TCATCCCCTGTTCACAGATGAGG + Intronic
1052881258 9:33602117-33602139 CCATCCCTAGCTCAGAGGTTAGG + Intergenic
1053822154 9:41979019-41979041 TCATCCCCAGGTGGGATGTGGGG + Intronic
1054608420 9:67208394-67208416 TCAGCCCCAGGTGGGATGTGGGG - Intergenic
1056465052 9:86845615-86845637 TCATCCCCACTTCACAGATGAGG + Intergenic
1056730415 9:89161147-89161169 TAATCCCCATGTTGGAGGTGGGG + Intronic
1056792257 9:89633499-89633521 TCACCCCCAGATCAGAGGAAGGG - Intergenic
1056817361 9:89811637-89811659 CCCTCCCCAGGTATGAGGTGTGG + Intergenic
1056819096 9:89824355-89824377 ACTGCCCCAGGTGAGAGGTGGGG - Intergenic
1057091646 9:92263553-92263575 TCACCCCCAGGACAGTGGTCAGG - Intronic
1057270639 9:93648856-93648878 GCATCACCAGGTCAGAGGAGTGG + Intronic
1058370339 9:104259003-104259025 TCATCACAAGGTGATAGGTGTGG - Intergenic
1058755481 9:108079313-108079335 TCATGCCCAGTTGAGAGATGAGG + Intergenic
1059699607 9:116762322-116762344 TCATCCCCATTTCAGAGATGTGG - Intronic
1059708903 9:116849290-116849312 TTCTCCCCAGTTCAGAGGTTGGG + Intronic
1059758805 9:117318912-117318934 GCTTCCCCAGCTCAGAGGAGCGG - Intronic
1060306484 9:122417404-122417426 TGATCCCAAGGTGAGAGGAGTGG + Intergenic
1060426579 9:123511487-123511509 TCATCCCCAGCACAGGGCTGAGG + Intronic
1060758963 9:126232969-126232991 TTATCCCCATGTTACAGGTGAGG + Intergenic
1060913010 9:127365721-127365743 TTATCCCCAGTTTAGAGATGAGG + Intronic
1061008928 9:127943924-127943946 ACATCCCCAGGGAAGAGGCGTGG - Intronic
1061294054 9:129667433-129667455 CCAACCCCAGGACAGAGGAGAGG + Intronic
1062010515 9:134264386-134264408 CCATCCCCATTTCAGAGATGAGG - Intergenic
1062540004 9:137037378-137037400 CCAGCCCAAGGTCACAGGTGAGG + Exonic
1186623259 X:11263842-11263864 TCATCCCCATTTCATAGATGAGG - Intronic
1187820830 X:23286228-23286250 TCTTCCCCATGTTAGAGTTGAGG - Intergenic
1188616801 X:32167442-32167464 TCATCTCCAAGTCACAGTTGAGG - Intronic
1191953497 X:66619546-66619568 ACAACCCCATGTCAGAGTTGGGG - Intronic
1192174971 X:68879786-68879808 TCATCCCCATTTCACAGATGAGG + Intergenic
1192215649 X:69156443-69156465 TCAACCCCAGGTGAGTGGTAAGG - Intergenic
1192332347 X:70186355-70186377 TCATCTCCCGGTCAGAATTGAGG - Intronic
1194602008 X:95933532-95933554 TCATCTCCATGTTAGAGATGAGG + Intergenic
1197723160 X:129758672-129758694 TTATCCCCAGTTCACAGATGAGG - Intronic
1197770703 X:130087343-130087365 TCAACCCCAAGGCAGAGCTGGGG - Intronic
1197829690 X:130628220-130628242 TCATCCCCAGTTCACAGCTGAGG + Intronic
1197944612 X:131825829-131825851 TCTTCCCTAAATCAGAGGTGTGG + Intergenic
1198131609 X:133701305-133701327 TCATCCCCATTTTAGAGATGAGG + Intronic
1198736553 X:139792090-139792112 CCTTCCCCAGGTCAGGTGTGGGG - Intronic
1199367360 X:147002690-147002712 TCACCACCAAGTCATAGGTGAGG - Intergenic
1201283703 Y:12361696-12361718 TCATCACAAGGTGATAGGTGCGG + Intergenic
1201297671 Y:12478284-12478306 TCATCACAAGGTGATAGGTGCGG + Intergenic
1202338355 Y:23833290-23833312 TCATCACAAGGTGACAGGTGAGG - Intergenic
1202532411 Y:25836781-25836803 TCATCACAAGGTGACAGGTGAGG + Intergenic