ID: 919856169

View in Genome Browser
Species Human (GRCh38)
Location 1:201707645-201707667
Sequence CTGTTCCAGTGTCAGAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919856169_919856175 20 Left 919856169 1:201707645-201707667 CCCCTGTTCTGACACTGGAACAG 0: 1
1: 0
2: 1
3: 20
4: 169
Right 919856175 1:201707688-201707710 TCATCCTCACAGTGCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 157
919856169_919856174 19 Left 919856169 1:201707645-201707667 CCCCTGTTCTGACACTGGAACAG 0: 1
1: 0
2: 1
3: 20
4: 169
Right 919856174 1:201707687-201707709 ATCATCCTCACAGTGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919856169 Original CRISPR CTGTTCCAGTGTCAGAACAG GGG (reversed) Intronic
902170648 1:14607812-14607834 ATGTTCCAGGATCAGAACTGGGG + Intronic
903729079 1:25476909-25476931 CTGTTCCATTGTGAGCACTGAGG + Intronic
905942405 1:41874598-41874620 CTGTTTCAGTATCTGAGCAGCGG + Intronic
906108363 1:43307834-43307856 CAGTGCCAGTGTCAGAATGGTGG + Exonic
908506106 1:64801894-64801916 CTGCTCCATAGGCAGAACAGTGG + Intronic
908935728 1:69373748-69373770 CAGTGGCAGTGTCAGCACAGGGG + Intergenic
913176560 1:116278045-116278067 CAGTTCCAGTGTCAAATCCGAGG - Intergenic
914435892 1:147658959-147658981 CTTTTCCAGTGTCAGAAAGAAGG - Exonic
915691718 1:157697098-157697120 CTCTTCCAGAGTCAGAGCTGGGG - Intronic
917735912 1:177920143-177920165 CAGTTCCAGAATTAGAACAGTGG - Intergenic
919856169 1:201707645-201707667 CTGTTCCAGTGTCAGAACAGGGG - Intronic
919873375 1:201841901-201841923 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
924561476 1:245159717-245159739 CTGTTCCAAAGACAGAACGGGGG - Intronic
1063507960 10:6618695-6618717 TTGTTCTAGTGTGAGAACAGAGG + Intergenic
1063615784 10:7599417-7599439 CAGTTAGCGTGTCAGAACAGCGG - Intronic
1063904349 10:10766985-10767007 CTGTTCCATTGACAGAGAAGTGG - Intergenic
1065036104 10:21640012-21640034 CTGATGCAGCTTCAGAACAGCGG - Intronic
1065494333 10:26313282-26313304 CTGTCAAAGTGTCAGAAGAGAGG + Intergenic
1067402195 10:45987254-45987276 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1067578357 10:47421845-47421867 CTGTTCCTATCTGAGAACAGAGG - Intergenic
1067870547 10:49956894-49956916 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1075070770 10:119318662-119318684 CTGTGGCAGTGTCAGCCCAGTGG - Intronic
1079919696 11:26417561-26417583 CTGCTCCATAGACAGAACAGAGG + Intronic
1081225756 11:40520132-40520154 TTGTTCCAGTTGCAGAACATGGG - Intronic
1081871609 11:46385131-46385153 CTGTGCCAGTATCGGAACATCGG - Exonic
1083701808 11:64484347-64484369 TTACTCCAGTGGCAGAACAGCGG + Intergenic
1083954728 11:65977080-65977102 CTGCTCCTGTGTCAGAACAAAGG + Exonic
1086276269 11:85133312-85133334 TCGTTCCAGTGCCAGAATAGCGG + Intronic
1088986143 11:114910169-114910191 CAGTCCCAGTCTCAGAACAATGG + Intergenic
1089486167 11:118847796-118847818 GTGTCCCATTGTCAGAGCAGAGG + Intergenic
1092872669 12:12820034-12820056 CAGTTACACAGTCAGAACAGGGG + Intronic
1093703271 12:22246617-22246639 GTGTTGTAGTGTGAGAACAGAGG + Intronic
1095643720 12:44517265-44517287 CTATTCTAATGTTAGAACAGAGG + Intronic
1098750160 12:74282230-74282252 CAGTTCCAGTCCCAGAACTGAGG - Intergenic
1100118815 12:91344119-91344141 CAGTTCCAGAAACAGAACAGTGG - Intergenic
1103594276 12:122014191-122014213 CTGTTCCTGTGTCAGAGGAATGG + Intergenic
1104720147 12:131040859-131040881 CTGTTTCAGTTTCAAGACAGTGG + Intronic
1106612533 13:31297479-31297501 TTATTGCAGTGTGAGAACAGAGG - Intronic
1107240661 13:38230730-38230752 CAGTTCCAATGTGAGAACCGGGG - Intergenic
1107425258 13:40286813-40286835 CAGTTCCTGTGTCAGCACAGTGG + Intergenic
1109454241 13:62563123-62563145 TTGCTCCAGTGTCAGAACTGTGG + Intergenic
1111942502 13:94625532-94625554 CTGTTTGAGGGTTAGAACAGAGG - Intronic
1113898942 13:113785236-113785258 CTTTGCCAGTGACAGAGCAGGGG - Intronic
1115475586 14:33810271-33810293 CTGTTTCAGTCACAGAAAAGTGG - Intergenic
1116777495 14:49198059-49198081 CTGTTCGAGTATCCCAACAGCGG - Intergenic
1117476008 14:56095781-56095803 CTCTTTCAGTGCCAGGACAGTGG - Intergenic
1118085127 14:62405672-62405694 TTGTTTCAGTGGCAGCACAGTGG + Intergenic
1118955013 14:70473002-70473024 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
1118959986 14:70520455-70520477 CTGTTTCATTGACAGAACACAGG - Intergenic
1119291973 14:73502488-73502510 CTGGTCCAGGGTCCGTACAGAGG + Intronic
1119925462 14:78489380-78489402 CTGTCCCTGTCTCAGAACTGGGG - Intronic
1120945073 14:89987206-89987228 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1121037397 14:90717817-90717839 CTGGGCCAGAGCCAGAACAGGGG + Intronic
1121050048 14:90814488-90814510 CTGTGCCAGTCACAGAACAGTGG - Intronic
1121436443 14:93923641-93923663 CTGCTGCAGGGTCAGCACAGTGG + Intronic
1121625945 14:95385463-95385485 CTGTCCCTGGGTCAGAAGAGTGG - Intergenic
1125581520 15:40789161-40789183 ATGGTTCAGTCTCAGAACAGGGG + Intronic
1126257837 15:46649015-46649037 CTGTTGCAGTGTCAGCACTGAGG + Intergenic
1128667957 15:69552471-69552493 CTCTTCCTGAGACAGAACAGAGG - Intergenic
1128968546 15:72086116-72086138 ATGTGCCAGTGGCAGCACAGAGG + Intronic
1129189003 15:73926907-73926929 CTGATCCAGTGGGAGAACAACGG + Exonic
1129976443 15:79826316-79826338 CCGTTCCAGAATCAGAACAGAGG - Intergenic
1130896852 15:88177368-88177390 CTGTCACAGTGTCAGAGGAGGGG + Intronic
1132863589 16:2083159-2083181 CTGTGCCAGCGTCAGGACAGGGG - Intronic
1132886240 16:2183467-2183489 CTGCCCCAGTGACAAAACAGGGG + Intronic
1138776503 16:59729804-59729826 CAGTAGCAGTGTCAGCACAGGGG - Intronic
1140598319 16:76442558-76442580 CTTTTGCAGGGTCAAAACAGTGG + Intronic
1141541589 16:84726925-84726947 CTCTGCCAGAGTCAGAACACTGG - Intronic
1143266167 17:5639613-5639635 CTGCTCCAGTGTCTGAGCTGGGG + Intergenic
1143274498 17:5700047-5700069 CTGAGGCAGTGTCAGAAGAGGGG + Intergenic
1144022635 17:11250756-11250778 CTGCTCACGTGTCAGGACAGTGG + Intronic
1144326283 17:14184687-14184709 ATGTTCTAGTGGAAGAACAGAGG - Intronic
1149307016 17:55357828-55357850 CTGTTCCAGCTTCAGTGCAGTGG + Intergenic
1150467795 17:65409242-65409264 CTGCTCCATTGACAGAACAGTGG - Intergenic
1152839962 17:82561095-82561117 CTTTTTCAGTGTCTTAACAGGGG + Intronic
1153193787 18:2571149-2571171 CTCTTCCCTTGTCAGAAAAGCGG + Exonic
1153415071 18:4837551-4837573 CTGTTGTGGTGTGAGAACAGAGG - Intergenic
1153896503 18:9566759-9566781 CTTTTCCAGTGACAGAGCACAGG - Intronic
1154312820 18:13280821-13280843 GTCTTCCAGTGTGAGACCAGTGG + Intronic
1154415676 18:14174135-14174157 CAGTGCCAGGGTCAGGACAGGGG + Intergenic
1157093222 18:44660974-44660996 ATGTTCCAGCCTCAGAACTGTGG + Intergenic
1157966789 18:52217541-52217563 CTTTTCCAGGGCCAGAGCAGGGG - Intergenic
1158398517 18:57098695-57098717 CAGATCCAGTGTCAGAGCAGAGG + Intergenic
1158800245 18:60898373-60898395 ATGTGCCAATATCAGAACAGAGG - Intergenic
1161268938 19:3378813-3378835 CTGTTTCTGTATCAGCACAGTGG + Intronic
1162457926 19:10796976-10796998 CTTTTCCAGACTAAGAACAGAGG - Intronic
1164155719 19:22595954-22595976 CTGCTCCAGGGGCAGAACGGCGG - Intergenic
1164752524 19:30667294-30667316 CTGTCCCAGTAGCAGAACAGGGG + Intronic
1166587416 19:43961861-43961883 GTGTTGAAGTGTCATAACAGGGG + Intronic
1167284494 19:48591503-48591525 CTGCTTCAGGGTCAGAAGAGAGG + Intronic
925416491 2:3673399-3673421 CTGTTTGAGTGGCAGAGCAGAGG - Intronic
926977711 2:18531840-18531862 GTGATGCAGTGTCAGAAGAGAGG + Intergenic
927403927 2:22746607-22746629 CTGTGCCAGTGCCAGGATAGTGG + Intergenic
929757846 2:44782543-44782565 TTGTTCCATTGACAGAACACAGG - Intergenic
930193638 2:48486286-48486308 CTGTTACACTATCAAAACAGTGG + Intronic
930194686 2:48497306-48497328 TTGTTAAAGTGTGAGAACAGAGG + Intronic
931177954 2:59872079-59872101 GTGTTCCAGAGTCTGAACTGTGG + Intergenic
931434695 2:62236289-62236311 CTGTTCCAGCCTCAGCAGAGGGG - Intergenic
933997880 2:87683232-87683254 CTGTTGCAGTGTGAGAGCAGAGG + Intergenic
935526103 2:104169659-104169681 CTATTCCAGTATATGAACAGTGG + Intergenic
936295970 2:111267634-111267656 CTGTTGCAGTGTGAGAGCAGAGG - Intergenic
938215907 2:129514774-129514796 TTGTTCCAGTATAATAACAGTGG - Intergenic
940040935 2:149359929-149359951 CTGTTCCATAGGCAGAGCAGCGG + Intronic
940908703 2:159191399-159191421 CTGCTCCAGTGCCAGGACATGGG - Intronic
942327046 2:174784671-174784693 CTGCCCCAGTTTCAGAATAGTGG - Intergenic
943189584 2:184658728-184658750 CTCTTCAAGTATCAGAACATAGG + Intronic
948273507 2:236691505-236691527 CTGTTCCATTATAAGAACACTGG - Intergenic
948594381 2:239070028-239070050 CTGACCCAGTCTCAGAAGAGAGG - Intronic
1169090237 20:2856110-2856132 CTGTTCAAGTGAAAGAAGAGTGG - Intronic
1169385084 20:5141888-5141910 TTGTTACAGTGTGAGAACAGAGG + Intronic
1174430866 20:50467792-50467814 CTTTGTCAGTGTCAGAAGAGAGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175012508 20:55754077-55754099 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
1176325841 21:5499944-5499966 CTGTTGCAGTGTCAGGACCAAGG - Intergenic
1176401916 21:6321007-6321029 CTGTTGCAGTGTCAGGACCAAGG + Intergenic
1176435241 21:6668097-6668119 CTGTTGCAGTGTCAGGACCAAGG - Intergenic
1176459503 21:6995167-6995189 CTGTTGCAGTGTCAGGACCAAGG - Intergenic
1176805479 21:13477191-13477213 TTGTTCCAGTGGAACAACAGTGG - Intergenic
1180901802 22:19378539-19378561 GTATTGCAGTGTCAGAACTGAGG + Intronic
1183465731 22:37979617-37979639 CTGTTCCAGGGTCTGAGGAGAGG - Intronic
1185344849 22:50306733-50306755 CTGTGGCAGAGTCAGGACAGGGG - Intronic
950136670 3:10585872-10585894 ATATTCTAGTGACAGAACAGAGG - Intronic
950740172 3:15044525-15044547 CTTTTCCTGTTTGAGAACAGTGG + Exonic
950930541 3:16784677-16784699 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
951131515 3:19051581-19051603 CATTTGCAGTGACAGAACAGGGG + Intergenic
952686513 3:36155352-36155374 GAGTTCCAGTGTGATAACAGTGG + Intergenic
954377267 3:50201805-50201827 CTGGCCCAGAGTCAGCACAGTGG + Intergenic
955027422 3:55183171-55183193 CAATTTCAGTGTCAGAACACTGG + Intergenic
956561512 3:70581601-70581623 CTGTTTCAGTGTCTGTAAAGTGG - Intergenic
960044132 3:113179837-113179859 CTGCTCAAGGGTCAGTACAGGGG - Intergenic
962717063 3:138135663-138135685 TTGTTCCAACTTCAGAACAGTGG - Intergenic
964418732 3:156478261-156478283 CTGTTTAAGTGACACAACAGTGG + Intronic
964519819 3:157552847-157552869 CTTTCTCAGTGTCAGAACAAGGG - Intronic
965340813 3:167488867-167488889 ATGTTCCAGGGACAGAAAAGAGG - Intronic
965400960 3:168211574-168211596 CTGTGCTAGTCTCAGAATAGTGG - Intergenic
966101472 3:176274262-176274284 TTGTTCCAGCCTCAGAAGAGAGG + Intergenic
967922238 3:194622063-194622085 CTGTCTCACTGACAGAACAGTGG - Intronic
969708478 4:8829158-8829180 CTATGCATGTGTCAGAACAGGGG + Intergenic
973658313 4:53074812-53074834 TTGTTCCACTGACAGAACACAGG + Intronic
977888892 4:102283752-102283774 CTGTTTAAGTGTTAGAACACAGG + Intronic
979933718 4:126665580-126665602 CTGTTCCATTTATAGAACAGAGG - Intergenic
981505199 4:145492118-145492140 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
981919184 4:150068272-150068294 CTCTTCCAGTGGCAGAAGGGGGG + Intergenic
983852555 4:172600051-172600073 TTGTTCCAGTGTCATAGTAGAGG + Intronic
984807033 4:183760553-183760575 TTCTTCCAGTATCAGAGCAGAGG - Intergenic
985177590 4:187218424-187218446 GAGTTCCAGTGTTAGAATAGGGG - Intergenic
985250514 4:188019973-188019995 CAGTTCCATTGTCATAAAAGAGG + Intergenic
985379486 4:189377293-189377315 ATGTTCCAGGATCATAACAGTGG + Intergenic
986554448 5:8997474-8997496 CTCTTTCAGTGTGAGCACAGTGG + Intergenic
989186959 5:38635279-38635301 CAGTTCCAGAGTCAGTACTGGGG - Intergenic
989190011 5:38661372-38661394 CTGATCCAGTGGCAGCTCAGAGG - Intergenic
995292178 5:110469636-110469658 CTGTTCCCGTGTCAGCACTGAGG + Intronic
995972798 5:117993067-117993089 CTGTGCCAGTATCAGAATAATGG + Intergenic
996522961 5:124447929-124447951 CTGTTCCAGGGGCAGAATTGAGG - Intergenic
997851370 5:137335783-137335805 TTGTTCCAGTGTGTTAACAGGGG - Intronic
999633511 5:153596623-153596645 CTTTTCCAGCGTCAGAACAGGGG - Intronic
1000060173 5:157647941-157647963 TTCTTCCAAAGTCAGAACAGTGG + Intronic
1001185389 5:169566683-169566705 CTGTTCCATCTCCAGAACAGTGG - Intergenic
1007191563 6:40023196-40023218 CTGTTCAAGGGTCAGAAGAGGGG - Intergenic
1007952682 6:45886247-45886269 CTGGGCCAGTGTCAGGACTGGGG - Intergenic
1008952527 6:57176085-57176107 TTGTTACAGTGTGAGAGCAGAGG + Intronic
1009521994 6:64694758-64694780 CTGATCCAGTCTCACAAAAGTGG - Intronic
1012314664 6:97771227-97771249 CTGTTACAGTGTAAGAATACTGG - Intergenic
1012537202 6:100313308-100313330 TGGTTGCAGTGTCTGAACAGAGG - Intergenic
1014937164 6:127398258-127398280 CTGTTCCATAGGCAGAGCAGTGG - Intergenic
1015994249 6:138981587-138981609 CTGTTCCAGTGTCAAGATAGTGG + Intronic
1016917552 6:149258871-149258893 CTGGACCAGTGTTAGCACAGAGG + Intronic
1017360015 6:153557250-153557272 CTGTTCAAGAGTAAGAACAATGG - Intergenic
1019788967 7:2997987-2998009 CTGTACCAGTGTCTGGACTGAGG + Intronic
1020595911 7:10207346-10207368 CCTTTCCAGAGTCAGCACAGAGG - Intergenic
1022239526 7:28496525-28496547 CTGTCCCAGGCTCAGAACACAGG + Intronic
1023967308 7:44969672-44969694 CTGTCCCAGTGCCACCACAGTGG - Intronic
1025635315 7:63315885-63315907 CTGGTCCAGTGACAGACTAGGGG + Intergenic
1025647380 7:63432285-63432307 CTGGTCCAGTGACAGACCAGGGG - Intergenic
1030137393 7:106268463-106268485 CTGTTCCAGCAGCAGAACACAGG - Exonic
1033028890 7:137805891-137805913 CTAAGCCAGTGTCAGAACTGTGG + Intronic
1035387157 7:158481209-158481231 TTGTTCCAGTGACAGAGCACAGG - Intronic
1038433597 8:27519358-27519380 CAGTTTCTGTGTCAGGACAGTGG + Intronic
1044392714 8:91670731-91670753 CTGTACCAAAGTCAGAACAAGGG + Intergenic
1044462072 8:92457349-92457371 GTGTTCCACTGCCAGGACAGGGG - Intergenic
1045089803 8:98730124-98730146 CTGTTACAGTTTTAGAACAATGG - Intronic
1045490460 8:102664580-102664602 CTGTTCCAGTGTCAGAATTCTGG + Intergenic
1048683522 8:136874374-136874396 CTGCTCCAGAGTCACAACATGGG + Intergenic
1051908922 9:22130219-22130241 CTGTGTCAGTGTCAGAGCACTGG + Intergenic
1052547850 9:29903402-29903424 TTTTACCCGTGTCAGAACAGTGG + Intergenic
1052815602 9:33100545-33100567 CTACTCCACTGGCAGAACAGCGG + Intergenic
1059523393 9:114965197-114965219 CAGGTCCAGGGTCAGCACAGTGG + Intergenic
1186799312 X:13077356-13077378 CTGTGCCAGTGTCAGAGCATGGG - Intergenic
1187345882 X:18463132-18463154 CTGGTCAAGTGTCAGGAAAGAGG + Intronic
1196138760 X:112237927-112237949 CTGTTCCAGTGTTAGGAAGGTGG + Intergenic
1198521559 X:137458579-137458601 CTGTGCTAGTGTCAAAAAAGTGG - Intergenic