ID: 919856437

View in Genome Browser
Species Human (GRCh38)
Location 1:201709455-201709477
Sequence CTCTGCAGCCTCTGGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 810}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919856430_919856437 -7 Left 919856430 1:201709439-201709461 CCTCAACCTAGGCCCCCTCTGCA 0: 1
1: 0
2: 1
3: 14
4: 248
Right 919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG 0: 1
1: 0
2: 6
3: 68
4: 810
919856427_919856437 28 Left 919856427 1:201709404-201709426 CCTTCAGGGTCATGGGTGTGAAT 0: 1
1: 0
2: 0
3: 15
4: 137
Right 919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG 0: 1
1: 0
2: 6
3: 68
4: 810

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919856437 Original CRISPR CTCTGCAGCCTCTGGAGCTC TGG Intronic
900145773 1:1158138-1158160 CCCAGGAGCCTCTGGAGCTGCGG - Intergenic
901313795 1:8291477-8291499 CGCTGCAGCCTCTGCTGCCCGGG + Intergenic
901556968 1:10039503-10039525 CACTGCAGCCTCTGGTTCCCGGG + Intronic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
901664492 1:10818737-10818759 CTCCCCAGTCTCTGGAGCTTGGG - Intergenic
901758227 1:11454260-11454282 CTCTGCAGCCTGCGAGGCTCTGG - Intergenic
902007664 1:13245285-13245307 CACTGCAAACTCTGGACCTCGGG + Intergenic
902040338 1:13487677-13487699 CTCTTCACCCTCTCCAGCTCAGG - Intronic
902121082 1:14166237-14166259 CACTGCAGCCTCTGCCGCCCAGG - Intergenic
902234294 1:15047831-15047853 CTCAGCAGCCCCTGCAGCTGGGG + Intronic
902552928 1:17229979-17230001 CTGTGCAGCCTCTGGGGTACAGG - Intronic
902572748 1:17357241-17357263 CTCTGCAGCCTCTGCATCCCGGG + Intronic
902676111 1:18009508-18009530 CTCTGCAGCATCTGGGGCAGGGG + Intergenic
902928326 1:19712542-19712564 CACTGCAACCTCTGCATCTCAGG - Intronic
903222183 1:21875129-21875151 CCTCGCAGCCTCTGGAGATCTGG - Intronic
903251900 1:22060260-22060282 CACTGCAGCCTCTGCATCCCAGG - Intronic
903591900 1:24462689-24462711 CACTGCAACCTCTGCCGCTCGGG - Intronic
904217608 1:28935357-28935379 CTCTGCAACCTCTGCCTCTCAGG - Intronic
905025146 1:34844666-34844688 GTCTGCAGGCTTTGGAGCTCTGG - Intronic
905275668 1:36816368-36816390 CTTTGCAGCTTCTGGTTCTCAGG + Intronic
905352421 1:37356790-37356812 CTCTGCATTCTCTGAAGCCCTGG + Intergenic
905568311 1:38983876-38983898 CTCTGCAACCTCTGCCTCTCGGG + Intergenic
905752624 1:40479028-40479050 TTCTGCAGATTCTGGAGTTCTGG + Exonic
905884812 1:41485893-41485915 CCCTGCCTCCTCTGGGGCTCTGG - Intergenic
905945636 1:41899480-41899502 CACTGCAGCCTCTGCTGCCCGGG + Intronic
906135739 1:43499571-43499593 CTCTGCAACCTCTGCCTCTCGGG + Intergenic
906483212 1:46214788-46214810 CACTGCAGCCTCTGCCTCTCGGG - Intronic
908445772 1:64198273-64198295 CTCTGCAGCCCCTTCTGCTCTGG + Intergenic
908844760 1:68313183-68313205 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
909253923 1:73393734-73393756 CTCTGCAACCTCTGCCTCTCAGG - Intergenic
909391816 1:75128878-75128900 CTCTGGAGCCTCTGCAGCCCAGG + Intronic
909663210 1:78106754-78106776 CTCTGCAACCTCTGTTGCCCAGG + Intronic
910226977 1:84945820-84945842 CACTGCAGCCTCTGCCTCTCAGG + Intronic
910573802 1:88736437-88736459 CTCTGCAGCCTCTGCCTCTCAGG + Intronic
910586883 1:88890500-88890522 TTCTACAGCTTCTGGAACTCTGG - Intronic
910646160 1:89517498-89517520 CACTGCAACCTCTGAAGCCCGGG - Intergenic
910708734 1:90156961-90156983 CTCTCCAGCCTCTGCACTTCAGG - Intergenic
910798907 1:91126073-91126095 CTCTGCAACCTGTGCTGCTCGGG + Intergenic
911499237 1:98664778-98664800 CTCTGCATTCTCTTGAGGTCTGG - Intronic
911588735 1:99721672-99721694 CACTGCAACCTCTGCCGCTCAGG + Intronic
911718929 1:101168740-101168762 CACTGCAGCCTCTGCTGCCCAGG + Intergenic
912085483 1:105997417-105997439 CACTGCAGCCTCTGCCCCTCTGG + Intergenic
912763167 1:112386552-112386574 CTCTGCACCCTCAGGGGCCCAGG + Intergenic
915147029 1:153801400-153801422 CTCTGCAGCCCCTGCTGCCCTGG + Intergenic
916702133 1:167308140-167308162 CACTGCAGCCTCTGCCGCCCGGG + Intronic
917345559 1:174024652-174024674 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
918046979 1:180947550-180947572 CTCTGCCTACTCTGGACCTCAGG + Exonic
918136177 1:181675813-181675835 CTTTGCAGCCTCCCGGGCTCTGG + Intronic
918407717 1:184226895-184226917 CACCGCAGCCTCTTGACCTCCGG - Intergenic
918763707 1:188450249-188450271 CTCTGCAGCCTCTGCCTCCCGGG + Intergenic
919083318 1:192891728-192891750 CTCTGCACTCTTTGGAGCCCGGG - Intergenic
919125159 1:193384393-193384415 CGCTGCAGCCTCTGCCTCTCAGG + Intergenic
919768672 1:201143374-201143396 CTCCCCAGACCCTGGAGCTCTGG + Intronic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
919992029 1:202714220-202714242 CTCTGCAGCCTCTGCCTCCCGGG - Intergenic
920841508 1:209559292-209559314 CACTGCAACCTCTGGCTCTCAGG + Intergenic
920874532 1:209821874-209821896 CACTGCAGCCTCTGCCTCTCTGG - Intergenic
920885971 1:209928278-209928300 CACTGCAGCCTCTGCATCCCAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921398315 1:214692853-214692875 CACTGCAACCTCTGCTGCTCAGG + Intergenic
921867758 1:220104457-220104479 CACTGCAGCCTCTGGATCCTAGG + Intronic
922165529 1:223112798-223112820 AGCTGCAGCTGCTGGAGCTCGGG - Exonic
922516389 1:226211199-226211221 CTCTGCACCCTCAGGAGTTGGGG + Intergenic
922779412 1:228239950-228239972 CTCTCCACCCTCGGGACCTCGGG - Intronic
922796801 1:228343540-228343562 CTCTGCAGACTCTGGAAGTGGGG - Intronic
923071394 1:230568136-230568158 CTCTTCAGCCTCTGGTGGCCAGG - Intergenic
923618078 1:235554307-235554329 CTCAGCAGCTTCTGCATCTCTGG - Intronic
923833976 1:237589498-237589520 CTATGCAGCCCCTGGTCCTCCGG - Intronic
924179350 1:241424759-241424781 CTCTGCACCCTCGGGGGCCCAGG + Intergenic
924367412 1:243309937-243309959 CTCTGCAACCTCTGCTTCTCGGG + Intronic
1063585483 10:7348869-7348891 TTCTGCAGCCTCAGGCTCTCAGG + Intronic
1063708328 10:8452700-8452722 CACTGCAGCCTCTGACGTTCTGG + Intergenic
1063725811 10:8636482-8636504 CTCTGGAGACTTTGAAGCTCAGG - Intergenic
1064960689 10:20961694-20961716 CTCTTCAGTCTCTGTAGCTCAGG + Intronic
1065536918 10:26723832-26723854 TTCTGCAGCATCTATAGCTCTGG + Exonic
1066288683 10:33993646-33993668 CAGTGCAGCCTCTGCATCTCAGG + Intergenic
1066341115 10:34534650-34534672 TTCTGCAGCCGCTGGACCTTGGG - Intronic
1066375035 10:34850097-34850119 CACTGCAGCCTCTGGCTCCCTGG - Intergenic
1066425712 10:35306108-35306130 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1067725278 10:48765833-48765855 CACTGCAGCCTTTAGATCTCTGG - Intronic
1067751321 10:48973663-48973685 ACCTGCAGCCTCTGGAGTGCTGG + Intronic
1068120010 10:52775375-52775397 CTCTGCAGCCTCTTGGGGTGAGG - Intergenic
1068508738 10:57936987-57937009 CTCTGCAGCCTCCCATGCTCAGG + Intergenic
1068612529 10:59076149-59076171 CTTTGGTGCCCCTGGAGCTCTGG - Intergenic
1068613405 10:59085797-59085819 CTCAGCAGCTTCTGAAGTTCTGG + Intergenic
1069540191 10:69288415-69288437 CACTGCAGCTTCTGTTGCTCAGG - Intronic
1069592865 10:69652669-69652691 CTCTGCAGTCTCTGGTGCCTAGG + Intergenic
1069794936 10:71046070-71046092 CTCTGCAGCCTGGGTACCTCGGG - Intergenic
1069862667 10:71481271-71481293 CTCTGCACCCTCTGGAGGCAGGG - Intronic
1070759749 10:79016675-79016697 CTCTCCTGCCTCTGGACTTCTGG - Intergenic
1070767950 10:79067302-79067324 CCCTGCAGCCTCCGAAGCCCCGG + Intergenic
1071173729 10:82898795-82898817 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1071555048 10:86595162-86595184 CTCTGCAGCCTCTGCCTCCCGGG + Intergenic
1071803372 10:89089763-89089785 CACTGCAACCTCTGGATCCCGGG + Intergenic
1072185784 10:93037513-93037535 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1072217355 10:93298626-93298648 CACTGCAGCCTCTGTCTCTCAGG + Intergenic
1072456031 10:95576789-95576811 CACTGCAGCCTCTGTCTCTCAGG - Intergenic
1072456527 10:95581170-95581192 ATCTGCTGACTCTAGAGCTCTGG - Intergenic
1072457169 10:95586885-95586907 CACTGCAACCTCTGCCGCTCTGG + Intergenic
1072953016 10:99864781-99864803 CACTGCAGCCTCTGGCTCCCAGG + Intergenic
1073141694 10:101252709-101252731 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1073219088 10:101854638-101854660 CCCTGAAGCCTCTGGAGGTAAGG + Intronic
1074545436 10:114398782-114398804 GTCTGCACCCTCGGGAGCCCTGG + Intronic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1075101542 10:119509851-119509873 CACTTCTGCCTCTGGTGCTCAGG + Intronic
1075202050 10:120412662-120412684 CTCTGGAGCTCCTGGTGCTCTGG - Intergenic
1075259410 10:120949678-120949700 GTCTGCAGCCGCGTGAGCTCGGG + Intergenic
1075337690 10:121620256-121620278 CACTGCAGCCTCTGCTTCTCAGG - Intergenic
1075408356 10:122209763-122209785 CTCTGCAACCTCTGGCTCCCAGG + Intronic
1076339105 10:129730530-129730552 CTCTGCTGTCTTTGGAGCACTGG - Intronic
1076637404 10:131891460-131891482 GACAGCAGCCTCTGGAGCACAGG - Intergenic
1076695046 10:132243309-132243331 CACCGCAGCCTCTGGAACCCCGG + Intronic
1076697897 10:132255933-132255955 CTCTGCACACCCTGGAGCCCTGG + Intronic
1076838680 10:133033838-133033860 CTCTCCAGCCTCACGGGCTCTGG - Intergenic
1077048836 11:557753-557775 CTCAGGTGCCTCTGGAACTCTGG - Intronic
1077119493 11:900278-900300 CTCTCCAGCCTGTGAGGCTCTGG - Intronic
1077722002 11:4638866-4638888 CACTGCAGCCTCTGCCGCCCAGG + Intergenic
1078358743 11:10652168-10652190 CTCCCCAGCCTGTGGAGCCCAGG - Exonic
1078512997 11:11999547-11999569 CACTGCAACCTCTGCAGCCCAGG - Intronic
1078909565 11:15718299-15718321 CCCTGCAGCTCCTGGAGCTGGGG - Intergenic
1079182905 11:18209326-18209348 CTCTGCTCCCTCCGGAGCTCAGG - Exonic
1079328427 11:19513936-19513958 CCATGCTCCCTCTGGAGCTCAGG - Intronic
1079544285 11:21613921-21613943 CTCTGAAGTCTCTGGGGCTTGGG + Intergenic
1080444239 11:32322987-32323009 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
1080541487 11:33270051-33270073 CACTGCAACCTCTGAATCTCAGG + Intronic
1081503388 11:43689620-43689642 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1082171477 11:49010529-49010551 CTTTGCAGCATGGGGAGCTCAGG - Intergenic
1082746319 11:56967104-56967126 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1083259328 11:61514680-61514702 TTCTGCAGCCTCTGTGGCCCTGG - Intergenic
1083487767 11:62994410-62994432 CCCTGCACTCTCTGGGGCTCAGG - Intronic
1083665468 11:64271789-64271811 CTCTGCAGGCGCTGGGGCTGTGG - Exonic
1083840146 11:65299576-65299598 TTCTGCAGCCACTGGGGCTTGGG + Intronic
1083993491 11:66260670-66260692 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1083999109 11:66286549-66286571 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1084008303 11:66334597-66334619 CCCTGCAGCTCCTGGGGCTCGGG + Exonic
1084036551 11:66514889-66514911 CACTGCAGCCTCTGGCTCCCGGG + Intronic
1084096600 11:66915540-66915562 CACGGCAGCCCCTGGAGCTGAGG + Intronic
1084287542 11:68141830-68141852 TTCCCCAGCCTCTAGAGCTCAGG - Intergenic
1084311175 11:68317178-68317200 CTCTGCATTCTCTTCAGCTCTGG + Intronic
1084909074 11:72373057-72373079 TCCTGCAGGCCCTGGAGCTCTGG + Intronic
1085004384 11:73071623-73071645 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1085139181 11:74124679-74124701 CTCTGCAGCTTCTGCAGCCCAGG + Intronic
1085491154 11:76918903-76918925 CTCTGAAGTCTCTGAAGCTCTGG + Intronic
1086178059 11:83916389-83916411 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1086579606 11:88384051-88384073 CTCTGAAGCTTCAGGAACTCTGG + Intergenic
1086694422 11:89826562-89826584 CTTTGCAGCATGGGGAGCTCAGG + Intergenic
1086711724 11:90017949-90017971 CTTTGCAGCATGGGGAGCTCAGG - Intergenic
1086841294 11:91687861-91687883 CACTGCAACCTCTGCATCTCAGG - Intergenic
1088558016 11:111082724-111082746 GTCTGCATCCTCTGGAGTTTGGG + Intergenic
1089569573 11:119395594-119395616 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1090152976 11:124404583-124404605 CTCTGCAGCCTCACTATCTCTGG + Intergenic
1090226142 11:125073290-125073312 CCCTGAAGCTCCTGGAGCTCTGG - Intronic
1090490880 11:127159645-127159667 GCCTGCAGTCTCTGGAGCTGTGG + Intergenic
1092104741 12:5913368-5913390 CTCTGTGGCCTCTGAAGCACAGG - Intronic
1092433791 12:8430246-8430268 CACTGCAGCCTCTGCATCCCAGG + Intergenic
1092828144 12:12416855-12416877 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1092866136 12:12763054-12763076 CACTGCAGCCTCTGCTTCTCAGG - Intronic
1092882306 12:12897149-12897171 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1094353694 12:29555211-29555233 CACTGCAACCTCTGCATCTCAGG + Intronic
1096154605 12:49334995-49335017 CTCTGCAGCCTGTGCAGCTCTGG + Intronic
1096290173 12:50335566-50335588 CACTGCAACCTCTGTTGCTCGGG - Intronic
1096292275 12:50352464-50352486 CTCAGCAGGCTCAGGAGCTGGGG - Exonic
1096387905 12:51207097-51207119 CACTGCAGCCTCTGCCCCTCGGG + Intronic
1096833699 12:54334343-54334365 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1096842276 12:54386692-54386714 AGCTTCAGCCTCTGGTGCTCTGG - Intronic
1096883874 12:54697998-54698020 CTCTGCAGCCTGTGCTCCTCAGG + Intergenic
1097175987 12:57143185-57143207 CTCTGAGGCCTCTAGGGCTCCGG + Intronic
1097976947 12:65696714-65696736 CTCTAGTGCCTCTGTAGCTCTGG - Intergenic
1098174535 12:67777241-67777263 CACTGCAGCCTCCGCTGCTCAGG - Intergenic
1098244695 12:68504293-68504315 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1098507558 12:71271718-71271740 CTCTACAGCCTCTGGAGGGAAGG + Intronic
1098751575 12:74299176-74299198 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1099186083 12:79516735-79516757 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1099238851 12:80115461-80115483 CTCTGCTTCCTCTGGAGCAGAGG + Intergenic
1100240076 12:92702223-92702245 CTCTCCAACCCCTGGAACTCTGG - Intergenic
1100543583 12:95580486-95580508 CACTGCAGCCTCTGCTCCTCAGG - Intergenic
1100744914 12:97635124-97635146 CTCTACAGTCTCTGGCTCTCTGG + Intergenic
1100913097 12:99387740-99387762 CTCCCCAGCTTCTGGAACTCAGG + Intronic
1101616720 12:106345074-106345096 CACTGAAGCCTCATGAGCTCAGG + Intronic
1101781694 12:107843948-107843970 CTCTGCAGCCACCAGAGATCTGG + Intergenic
1101996994 12:109532786-109532808 CTCTGCAGCCTCACTGGCTCTGG + Intronic
1102608532 12:114090151-114090173 CTCTGCAGCCTCCAAAGCTGTGG - Intergenic
1102688896 12:114745040-114745062 CTCTGCAGACTCTGCAGGTTTGG + Intergenic
1102786242 12:115607230-115607252 CACTGCAGCCTCTGGCTCCCAGG - Intergenic
1102987604 12:117291136-117291158 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1103506036 12:121442856-121442878 CGCGTCAGCCTCTGGGGCTCAGG + Intronic
1103721170 12:122976331-122976353 CTCAGCAACCTCTGGAACACAGG + Exonic
1103897993 12:124286534-124286556 CTCTGCCCTTTCTGGAGCTCCGG + Intronic
1103902969 12:124312879-124312901 CTCTGAAGCTGCTGGGGCTCAGG + Intronic
1104584372 12:130036196-130036218 CTCTGCTTCCACTGGAGATCAGG + Intergenic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1105599748 13:21876218-21876240 CACTGCAACCTCTGGCGCTCAGG + Intergenic
1106287707 13:28332150-28332172 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1107515925 13:41129741-41129763 CTCTGCAGCCTCTGACTCCCGGG + Exonic
1107534035 13:41311097-41311119 CTCGGCACCCCCTGGGGCTCAGG - Intergenic
1107613349 13:42139311-42139333 TTCTGCCAACTCTGGAGCTCTGG + Intronic
1108633842 13:52313199-52313221 TTCTCCAGCCTCCAGAGCTCTGG - Intergenic
1109622295 13:64925763-64925785 CTCTGCATCCTCAGTAGCCCGGG - Intergenic
1109653015 13:65353546-65353568 CTCTGCATCTGCTGGAGCTTGGG - Intergenic
1110110323 13:71737145-71737167 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1111787916 13:92814583-92814605 CACTGCAGCCTCTGGCTCCCAGG - Intronic
1111981100 13:95016459-95016481 CACTGCAGCCTCTGTCTCTCAGG + Intergenic
1112012708 13:95305330-95305352 CACTGCAACCTCTGCAGCCCAGG - Intergenic
1112272857 13:97986030-97986052 GTCTCCAGCTTCTGGGGCTCAGG - Intronic
1112278305 13:98040751-98040773 CTCTGCAGCCTCTGCCTCCCGGG - Intergenic
1112394221 13:99013803-99013825 CTCTGGACCTTCTGCAGCTCAGG - Intronic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1113111929 13:106832346-106832368 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
1113599608 13:111559190-111559212 CTTTGCAGCCCCTGGAGCCTGGG - Intergenic
1114161950 14:20178122-20178144 CACTGCAGCCTCTGCCGCCCCGG - Intergenic
1114763525 14:25344741-25344763 TCCTGCAGCCTCTGAAGCTGTGG + Intergenic
1116491320 14:45506860-45506882 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1116678474 14:47936433-47936455 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1117243676 14:53861806-53861828 CCCTGCATCCCCGGGAGCTCTGG + Intergenic
1118373486 14:65157335-65157357 CACTGCAACCTCTGGTGCCCGGG + Intergenic
1118390597 14:65292128-65292150 CTCTGCAGCCACTGTGGCTAAGG + Intergenic
1118459779 14:65977306-65977328 CTCTGCAGCCCCTGCTGCTTAGG + Intronic
1118544271 14:66868467-66868489 CACTGCAGCCTCTGCAACCCGGG + Intronic
1119347346 14:73937196-73937218 CTCCCCAGCCTCTAGAGCTGTGG - Intronic
1119469613 14:74886815-74886837 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1119646053 14:76349276-76349298 CTTTGCACCCTTTGGAGCCCAGG - Intronic
1119657654 14:76428926-76428948 CTCTGCACGCTCTGGAGCTCAGG - Intronic
1119719918 14:76883707-76883729 ACCTGCAGCCTGTGGAGGTCAGG - Intergenic
1119831573 14:77707686-77707708 CTCTGCAGCCAAAGGAGGTCAGG + Intronic
1119842320 14:77802524-77802546 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1120481432 14:85054231-85054253 CTTTGCACCCTCTGAAGCTTTGG + Intergenic
1120578224 14:86210871-86210893 CTCTGTAGCCTCTGGAGTCTGGG + Intergenic
1121319014 14:92980295-92980317 CTCGGCTGCCTCAGGGGCTCTGG - Intronic
1121549001 14:94784026-94784048 CTCTGCAGCCTCTGCTTCTTGGG + Intergenic
1121635307 14:95450015-95450037 CTCTGCAGGATCTGCAGCTGTGG - Exonic
1121752736 14:96371518-96371540 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1121816578 14:96933489-96933511 CTGTGCACCCTCAGGAGCTTAGG + Intergenic
1122072469 14:99213629-99213651 CTCTGCAGCCTGTGGCGTCCGGG - Intronic
1122110700 14:99499113-99499135 CACTGCAGCCTCTGCCGCCCAGG + Intronic
1122984812 14:105207168-105207190 CTTTGCAGCCCATGGAGCTGGGG - Intergenic
1123068337 14:105629130-105629152 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123092356 14:105747454-105747476 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123097932 14:105775155-105775177 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123113630 14:105884095-105884117 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123115855 14:105893734-105893756 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123117509 14:105901341-105901363 GTCTCCAGCCTCTGCAGGTCGGG - Intergenic
1123117880 14:105902844-105902866 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123120097 14:105912449-105912471 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123402835 15:20004035-20004057 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123512172 15:21010689-21010711 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123685383 15:22793271-22793293 CACTGCAACCTCTGCAGCCCAGG - Intronic
1124632994 15:31347779-31347801 CCCTCCAGCCTCTGGGGCCCTGG + Intronic
1124644424 15:31426959-31426981 CTCTCCAGCCTTTGGAGTCCAGG + Intronic
1124927063 15:34080656-34080678 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1125706864 15:41745678-41745700 CCCTGCAGCCTCTACATCTCAGG + Intronic
1125748290 15:42012122-42012144 CTTTGCTGTCTCTGGGGCTCAGG + Intronic
1125873072 15:43120136-43120158 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1126828350 15:52573632-52573654 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1127117942 15:55745432-55745454 CACTGCAGCCTCTGGCTCCCGGG - Intergenic
1127419538 15:58791539-58791561 CACTGCAGCCTCTGGATCCCAGG - Intronic
1127922556 15:63504754-63504776 CAATGCAGACGCTGGAGCTCAGG - Exonic
1127994342 15:64144394-64144416 CTCTGTAGCCTCCTGAGCTCTGG + Intronic
1128206186 15:65854357-65854379 CACTGCAGCCTCTGCTGCCCGGG - Intronic
1128548845 15:68584801-68584823 CCCTGCAGCCTGGGGAGCTTGGG + Intronic
1128615971 15:69110009-69110031 CTCTGCAGCCCCAGGATCACTGG + Intergenic
1128713010 15:69886003-69886025 CTGAGCAGCCTGTGGGGCTCTGG + Intergenic
1129932618 15:79425113-79425135 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1131055280 15:89371269-89371291 CTCTCCGGCCTGTGGAGATCCGG - Intergenic
1131436907 15:92430293-92430315 CTCTGCAGCCTCTAGACCTTGGG - Intronic
1131441287 15:92461495-92461517 CACTGCAGCCCCTGGCGCACAGG + Intronic
1131530029 15:93183031-93183053 CACTGCAGCCTGGGGAGCACGGG - Intergenic
1132022479 15:98374474-98374496 CACTGCAACCTCTGCTGCTCAGG - Intergenic
1132153187 15:99476573-99476595 CTGTGCAGGCTCCGGGGCTCCGG + Intergenic
1132470557 16:100495-100517 CTCTGCAGCCTGTGCACGTCGGG - Exonic
1132684020 16:1154754-1154776 CTCTGCAGTCTGTGCCGCTCTGG - Intronic
1132921324 16:2396111-2396133 CACTGCAGCCTCTGCATCCCAGG + Intergenic
1132994026 16:2813570-2813592 CTCTGCAGCCTCAGCATCCCAGG - Intergenic
1133035224 16:3030579-3030601 CTCTGCAGCATCTGGTTCTGGGG + Exonic
1133323842 16:4931478-4931500 TGCTGCAGCCTCTGGAGCCCGGG - Intronic
1133813698 16:9180348-9180370 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1134033248 16:11009519-11009541 CTTTGCAGCCTCATGAGCTGTGG + Intronic
1134126547 16:11620090-11620112 CTCTGCAGCCTCTGCCTCCCAGG - Intronic
1134248383 16:12556926-12556948 CACTACAGCCTCTGCCGCTCAGG + Intronic
1134367701 16:13594660-13594682 CTCTTAAGCCTCTGCATCTCTGG + Intergenic
1134473679 16:14551491-14551513 CACTGCAACCTCTGGTTCTCGGG - Intronic
1134666122 16:16019995-16020017 CTCTGCAGCCTCTGCCTCCCAGG + Intronic
1134745506 16:16584992-16585014 CGCTGCAGCCTCTGCATCCCTGG - Intergenic
1134999966 16:18768751-18768773 CGCTGCAGCCTCTGCATCCCTGG + Intergenic
1135095607 16:19562027-19562049 CACTGCAACCTCTGCATCTCAGG - Intronic
1135277707 16:21127737-21127759 CTCTGCAGCCTCAGGAATTTTGG - Exonic
1135342591 16:21662171-21662193 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1136134437 16:28246455-28246477 CACTGCAGCCTCTGGCTCCCAGG + Intergenic
1136287560 16:29253393-29253415 CTCTGCAGCCTGGGGAGGTGGGG - Intergenic
1137406917 16:48196487-48196509 CTTTCCAGGCTCTGGAGCCCAGG - Intronic
1138340923 16:56288679-56288701 CTCTGGAGAGTCAGGAGCTCAGG + Intronic
1138688341 16:58746246-58746268 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1138848911 16:60603191-60603213 CTCTGCAGCCTCTGAACATCTGG - Intergenic
1139357157 16:66373259-66373281 GGCTGCAGCCTCTGGAGATGTGG - Intronic
1139427081 16:66888141-66888163 CACTGCAACCTCTGCAGCCCAGG + Exonic
1139529270 16:67534916-67534938 CTCTGCAGCCTCTGCGTCCCAGG + Intronic
1139658485 16:68404089-68404111 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1139680964 16:68562603-68562625 CTCTGCAGCATTTGGAGACCTGG + Intronic
1139775258 16:69312686-69312708 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1139910851 16:70396640-70396662 CTCTGCAGACCCTGGTCCTCGGG + Intronic
1139942089 16:70612696-70612718 ATCTGGAGCCTTTGGGGCTCAGG + Intronic
1139973574 16:70791458-70791480 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1140208446 16:72952162-72952184 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1140572970 16:76130222-76130244 CACTGCAACCTCTGCAGCCCAGG - Intergenic
1140615007 16:76651486-76651508 CTCTACAGCCTCTAGGGCTCAGG - Intergenic
1140738413 16:77919689-77919711 CTCTGCAAACTCAGGAGCTAAGG - Intronic
1141138217 16:81480462-81480484 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1141429061 16:83961584-83961606 CTCTGAAGCCCCTGTACCTCTGG - Intronic
1142126622 16:88413808-88413830 CTCTGCAGCCTCCGCAGCAGTGG + Intergenic
1142212640 16:88815809-88815831 CTCTGCTGCCCCTGGAGTTTGGG - Intronic
1142375607 16:89705526-89705548 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1142385826 16:89763855-89763877 CACTGCAGCCTCTGCCTCTCTGG - Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1142971277 17:3613442-3613464 CACTGCAACCTCTGCATCTCGGG + Intronic
1143162689 17:4881687-4881709 CTCTGTAGCATCTGGGGTTCTGG - Intronic
1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG + Exonic
1143545062 17:7590782-7590804 CACAGCAGCCTCTGGAGCCCGGG - Intronic
1143694297 17:8599980-8600002 CTCTGCAGGCTCCAGATCTCTGG - Intronic
1143757195 17:9075735-9075757 CTCTGCAGCCCCCGGAGGTGTGG + Intronic
1144090194 17:11849446-11849468 CTCCGGAGCCTCTGGTGGTCTGG + Intronic
1144204437 17:12969574-12969596 CTCCACAGCCTCTCCAGCTCAGG - Intronic
1144298584 17:13902033-13902055 CACTGCAGCCTCTGCCTCTCCGG - Intergenic
1144790637 17:17856691-17856713 CTCTGCATTCTCTCCAGCTCAGG + Intronic
1145715635 17:27017853-27017875 CACTGCAACCTCTGCAGCCCGGG + Intergenic
1145847561 17:28055166-28055188 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1145868974 17:28258186-28258208 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1146509992 17:33438797-33438819 CACTTCAGCCTCTGGGGTTCTGG + Intronic
1146547104 17:33749146-33749168 CACAGCTTCCTCTGGAGCTCTGG + Intronic
1146914996 17:36672812-36672834 TTCTGCAGCCTTAGGAGCTCTGG + Intergenic
1147297409 17:39495152-39495174 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1147438742 17:40433836-40433858 CTGTGCTGCCTCTGGAGGTGGGG + Intergenic
1147442618 17:40456624-40456646 CTCTGCAGCCTCCAGAGCACAGG - Exonic
1147677183 17:42215692-42215714 CACTGCAACCTCTGCCGCTCGGG + Intronic
1147803375 17:43111023-43111045 CACTGCAGCCTCTGCCTCTCTGG - Intronic
1148191785 17:45683898-45683920 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1148260689 17:46180420-46180442 CACTGCAACCTCTGCCGCTCAGG - Intronic
1148338134 17:46855193-46855215 CTCTGCAGCCACTGCTGCCCTGG - Intronic
1148343253 17:46886102-46886124 CTGTGCATCCTCTGAAGCGCTGG - Intronic
1148669698 17:49401505-49401527 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1149933734 17:60782659-60782681 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1150392579 17:64798499-64798521 CTCTTCAGCCTGTGGAGGCCAGG - Intergenic
1150492763 17:65585704-65585726 CTCTGGAGACTCAGGAGGTCAGG + Intronic
1150672528 17:67214339-67214361 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1150753111 17:67884489-67884511 CACTGCAGCCTCTGGCTCTTGGG + Intronic
1151101950 17:71565927-71565949 CACTGCAGCCTCTGGCTCCCAGG - Intergenic
1151638425 17:75369782-75369804 CACTGCAGCCTCTGCCTCTCTGG - Intronic
1151678098 17:75610230-75610252 CTCTGCCGCCTCTGGAGCAGGGG - Intergenic
1151880281 17:76890577-76890599 CCCTGCAGCCTCTGCCTCTCAGG + Intronic
1151980091 17:77503474-77503496 CCCTGCATTCTCTGGAGCTCAGG + Intergenic
1151991597 17:77578613-77578635 CTCTGCAACCTCTGCCTCTCTGG + Intergenic
1152116218 17:78389136-78389158 CACTGCAACCTCTGGCGCCCAGG + Intronic
1152146627 17:78572469-78572491 CTCTGCAGCCCCTGGGGCTCTGG - Intronic
1152215138 17:79027635-79027657 CGCTGCAGCCTCTAGTTCTCTGG + Intronic
1152231974 17:79118249-79118271 CTCTGCAGACTCTGAAACTGGGG + Intronic
1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG + Intronic
1152473198 17:80501620-80501642 CCGTGCAGCCTGTGGAGCCCAGG - Intergenic
1152759355 17:82099839-82099861 CTCTGCAGCCTGTCGAGGGCTGG + Intergenic
1152914058 17:83023766-83023788 CCCTGCAGCTGCTGGAGGTCGGG - Intronic
1152946378 17:83199658-83199680 CTCTGCTGCCGCTGCAGCTCCGG - Intergenic
1153342774 18:3992600-3992622 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1153914047 18:9730360-9730382 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1155054613 18:22172213-22172235 CTCTGCAGGCTGTGCAGCACCGG - Exonic
1155073689 18:22337534-22337556 ATCTGCAGCCTCCAGAGCTTGGG + Intergenic
1155437470 18:25827995-25828017 CTCTGCTGCCTCTGGGACCCAGG - Intergenic
1155456004 18:26013856-26013878 CACTGCAGCCTCCGCCGCTCAGG - Intergenic
1156085505 18:33395454-33395476 CTCTACAGTGTCTTGAGCTCTGG - Intronic
1156204171 18:34867838-34867860 CTCAGCAGCTTCTGCATCTCAGG + Intronic
1156725678 18:40123597-40123619 CACTGCAGCCTCTGCATCCCAGG + Intergenic
1157151579 18:45223736-45223758 ATCTCCTGCCTCTGGACCTCAGG - Intronic
1157722346 18:49935023-49935045 CTCTGCAGTCTCTTCTGCTCTGG - Intronic
1158115975 18:53995885-53995907 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1158599412 18:58844574-58844596 CTCTGCAACCTCTGCATCCCAGG + Intergenic
1158653427 18:59307825-59307847 CACTGCAGCCTCTGCATCCCGGG + Intronic
1159185141 18:64961398-64961420 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1159372459 18:67546042-67546064 CTCTGCTGCCTCTGCCTCTCTGG - Intergenic
1159767079 18:72503216-72503238 CTCTGTGGCCTCTGGCGCTCAGG + Intergenic
1160586148 18:79914703-79914725 CACTGCAGCCTGTGGGGCACAGG - Intronic
1160800178 19:964048-964070 CTCTGCACCCTCTCGAGCAGAGG + Intronic
1160961262 19:1722170-1722192 CTCTGCAGCCTCTGCCTCTCGGG + Intergenic
1161830087 19:6596518-6596540 ATCTGCAGACTCTAGAGCTGAGG + Intronic
1162488558 19:10977397-10977419 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1162504400 19:11074501-11074523 CTCTGCAGCCTCTGCCTCCCGGG - Intergenic
1162682403 19:12355923-12355945 CTCTGCAGCCTCTGCTTCCCTGG - Intronic
1162800600 19:13108364-13108386 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1162816214 19:13196485-13196507 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1162948529 19:14057526-14057548 CTCGGGAGCCCCGGGAGCTCCGG - Intronic
1163087521 19:14993016-14993038 CTCTGCTCCCTCTGGGGCCCTGG - Intronic
1163373612 19:16916309-16916331 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1163712690 19:18856190-18856212 TGCTGCAGCTTCTGCAGCTCAGG - Exonic
1163738009 19:18993593-18993615 CTCTGCAGTCTCTGGGGCGGAGG - Exonic
1163788077 19:19287484-19287506 CACTGCAGCCTCTGCCCCTCTGG - Intronic
1163811290 19:19433848-19433870 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1164571631 19:29378952-29378974 TTCTGCAGCCTTTGGTGCTCTGG - Intergenic
1164624265 19:29715741-29715763 CTCTGGAGCCTCTGGGTCTGGGG + Intronic
1164653598 19:29903548-29903570 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1165152786 19:33770805-33770827 CTCAGCTGGCTCTGGAGTTCTGG - Intronic
1165262856 19:34635882-34635904 CTGTGCTGCCTCTGGTGCTAGGG + Intronic
1165433826 19:35786409-35786431 CTGTGCAGCCTCTGGAGGCCTGG - Intronic
1165722459 19:38089240-38089262 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1165755784 19:38291941-38291963 CTGCGCACCGTCTGGAGCTCCGG + Exonic
1165805253 19:38576722-38576744 CACTGCAGCCTCTGCCGCCCGGG - Intronic
1165903121 19:39177984-39178006 CTCTGCTGCCTCTGTCGCCCAGG - Intronic
1165940156 19:39410804-39410826 CTCTGCTGCCTTTGCATCTCAGG - Intergenic
1166729746 19:45052413-45052435 CTCTGCTTCCTCTGGGCCTCTGG - Intronic
1166735887 19:45084476-45084498 CACTGCAGCCTCTGGCTCACGGG + Intronic
1166904116 19:46092554-46092576 CACTGCAGCCTCAGCCGCTCAGG - Intergenic
1166998720 19:46732461-46732483 CTCTCCTGCCTCTGGACCTCGGG + Intronic
1167083666 19:47294503-47294525 CTCTGCAGCCTCTGTCTCCCAGG + Intronic
1167358990 19:49019948-49019970 GTCTGCAGGCTCTGGGGCTCTGG + Intergenic
1167366674 19:49058185-49058207 GTCTGCAGGCTCTGGGGCTCTGG + Exonic
1167435659 19:49477047-49477069 CACTGCAGCCTCTGGCTCCCGGG - Intronic
1167494281 19:49808809-49808831 CCCTGCAGCTTCTGGAGCGCTGG - Exonic
1167551944 19:50167479-50167501 CTTTGCAGCCTGGGGACCTCTGG - Intergenic
1167696628 19:51019085-51019107 CTCCGCCGCCTCTGGCGCCCGGG - Exonic
1167796625 19:51713637-51713659 CTCTGCTGCCCCTGGCGCTCTGG - Exonic
1167926447 19:52825019-52825041 CCCTGCAGCCTCTGCATTTCAGG - Intronic
1168030331 19:53674604-53674626 CACTGCAGCCTCTCAACCTCCGG + Intergenic
1168060007 19:53885984-53886006 CACTGCAACCTCTGCCGCTCAGG - Intronic
1168080717 19:54008275-54008297 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1168306904 19:55440758-55440780 CTCTGCCACCTTTAGAGCTCTGG - Exonic
1168320367 19:55505810-55505832 CACTGCAGCCTCTGCTGCCCAGG + Intronic
1168399220 19:56074459-56074481 CACTGCAGCCTCTGCGTCTCAGG - Intergenic
1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG + Exonic
925238978 2:2305647-2305669 CTGTACAGCCTGTGGAGCTGTGG - Intronic
926287931 2:11505401-11505423 CTCTCCAGCCACTGGTCCTCTGG + Intergenic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
927665591 2:25030094-25030116 CACTGCAACCTCCGCAGCTCAGG - Intergenic
927707543 2:25306125-25306147 CTCTGCAGAGCCTGGTGCTCAGG - Intronic
927860363 2:26556868-26556890 CTATGCTGCCCGTGGAGCTCAGG + Intronic
927907557 2:26871516-26871538 CACTGCAGCCTCTGCCTCTCAGG + Intronic
927951990 2:27177209-27177231 CACTGCAACCTCTGCATCTCAGG + Intergenic
928378977 2:30802105-30802127 CTCTGCAGCCTCCACAGGTCAGG - Intronic
928614165 2:33019808-33019830 CTCAGGAGGCTCTTGAGCTCAGG - Intronic
929350722 2:40950135-40950157 CTCTGCAACCTCCGGATCTAGGG - Intergenic
929883324 2:45856304-45856326 CACTGCAGCCTCTGCCTCTCAGG + Intronic
930575380 2:53140530-53140552 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
931399655 2:61919389-61919411 CACTGCAGCCTCTGCCGCCCGGG + Intronic
932228600 2:70063447-70063469 CTCAGCAGCCTTAGGAGTTCAGG - Intergenic
932404990 2:71506840-71506862 CTCCAGAGGCTCTGGAGCTCAGG - Intronic
932453078 2:71828169-71828191 CTCTGCAGCCCCTGGCCCTTGGG + Intergenic
932522336 2:72427363-72427385 CTCTGCACCCTCAGGGGCCCAGG + Intronic
933786414 2:85846118-85846140 CTCTGCAGCCTCCGCATCCCAGG - Intronic
933821637 2:86117850-86117872 CACTGCAGCCTCTGCCGCCCGGG + Intronic
933848549 2:86347460-86347482 GTCTGCAGCCACTGAAGCCCTGG - Intergenic
934574147 2:95389895-95389917 CTGTGCAGCCTCGGGAGCCTGGG - Intergenic
934580333 2:95432770-95432792 CTGTGCACTCTCTGGGGCTCAGG - Intergenic
934599114 2:95643947-95643969 CTGTGCACTCTCTGGGGCTCAGG + Intergenic
934738270 2:96701232-96701254 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
934763380 2:96868300-96868322 CCTTGCAGCCACTGGGGCTCCGG + Intronic
935297619 2:101664395-101664417 CACTGCAACCTCTGGATCCCAGG - Intergenic
936373032 2:111918984-111919006 CCCTCCAGCCTTTGGGGCTCTGG - Intronic
936970180 2:118169485-118169507 CACTGCAGGCTGTGGAGCTCAGG + Intergenic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
937223299 2:120354099-120354121 CCCTGCAGCCTCTTGCGCTGTGG + Intergenic
937462220 2:122099491-122099513 GTTTGCAGCCTGTGGAGTTCTGG + Intergenic
938066127 2:128282917-128282939 ATCTGGGGCCTCTGGACCTCAGG + Intronic
938237132 2:129714940-129714962 CACTGCAGCCTCTGGTCCCCAGG - Intergenic
938293108 2:130160798-130160820 CTCTGCAGGGTCTGGCGCTTAGG - Intronic
938463446 2:131512167-131512189 CTCTGCAGGGTCTGGCGCTTAGG + Intergenic
938853783 2:135289329-135289351 CACTGCAGCCTCTGCCGCCCAGG + Intronic
938892190 2:135716874-135716896 CACTGCAGCCTCTGCCGCCCAGG - Intronic
938916738 2:135948792-135948814 CTCTGCAGCCTCTGCCTCCCAGG - Intronic
939334419 2:140807414-140807436 CACTGCAACCTCTGCAGCCCGGG + Intronic
939694555 2:145308580-145308602 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
939729401 2:145763320-145763342 CTCTGTACCCTGTGGAACTCCGG + Intergenic
941382216 2:164807360-164807382 CACTGCAGCCTCTGCCTCTCGGG - Intronic
941434884 2:165457484-165457506 CACTGCAGCCTCTGCCGCTGGGG - Intergenic
941913320 2:170788545-170788567 CACTGCAGCCTCTGCCTCTCGGG + Intronic
941965414 2:171295787-171295809 CACTGCAACCTCTGCATCTCAGG + Intergenic
942273164 2:174297360-174297382 CACTGCAGCCTCTGCATCCCGGG - Intergenic
943600421 2:189912463-189912485 CCCTGCAGCCTCTGCCTCTCAGG - Intronic
943668285 2:190633387-190633409 CACTGCAGCCTCTGCGTCTCGGG + Intergenic
944210769 2:197204616-197204638 CACTGAAACGTCTGGAGCTCTGG - Intronic
944403102 2:199351235-199351257 CACTGCAGCCTCTGCCTCTCGGG + Intronic
945048860 2:205805083-205805105 CACTGCAGACTCTGGGGCTGTGG - Intergenic
946350931 2:219151890-219151912 CACTGCAGCCTCTGCTTCTCAGG - Intronic
946659070 2:221979965-221979987 CTCTGCAGTGTCAGGAACTCAGG + Intergenic
946848485 2:223882188-223882210 CACTGCAACCTCTGGCGCCCGGG + Intronic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
947726019 2:232401292-232401314 CACTGCAACCTCTGCAGCCCAGG + Intergenic
947823030 2:233085308-233085330 CGCTGCAGCCTCTGCCTCTCAGG - Intronic
948182125 2:235990334-235990356 CCCTGCAGCCTCTGTGGGTCAGG + Intronic
948516837 2:238509494-238509516 CTCCACTGCCTCTGGAGGTCAGG - Intergenic
948544540 2:238717415-238717437 CCATGGAGCCTCTGGAGCCCGGG + Intergenic
948632366 2:239310319-239310341 ATCTGCTGTCTGTGGAGCTCTGG - Intronic
948658563 2:239492196-239492218 CTGTGCTCCCTCCGGAGCTCAGG + Intergenic
948668506 2:239551586-239551608 CTCTTCAGCCTCTGCATCTAAGG - Intergenic
948676725 2:239601281-239601303 CTTTGCAGACTCTGGGGCACTGG - Intergenic
948793192 2:240389549-240389571 CTCAGCTCCCTCTGGACCTCAGG - Intergenic
1169324026 20:4660785-4660807 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1170458974 20:16558826-16558848 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1171472692 20:25384667-25384689 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1171873499 20:30549446-30549468 CACTGCAGCCTCTGCATCCCAGG + Intergenic
1172631659 20:36382603-36382625 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1173282367 20:41640459-41640481 CTCTGCAACCTCTGCCTCTCAGG - Intergenic
1173511216 20:43630171-43630193 CTCTTCCTCCTCTGCAGCTCAGG + Intronic
1173614963 20:44396518-44396540 ATCTGCTGCCTCTTGAGCTGGGG + Intronic
1173632717 20:44528809-44528831 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1173641669 20:44607450-44607472 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1173682075 20:44890584-44890606 CACTGCAACCTCTGAAGCCCGGG + Intronic
1173855012 20:46244659-46244681 CTCTGCAGTCTCTGGGAATCTGG + Intronic
1174014406 20:47476116-47476138 CACTGCAGCCTCTGCCTCTCTGG - Intergenic
1174122845 20:48279794-48279816 GTCTCCAGCCCATGGAGCTCTGG + Intergenic
1174571342 20:51503917-51503939 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1174633041 20:51974885-51974907 CACTGCAACCTCTGGCCCTCAGG - Intergenic
1175563197 20:59950542-59950564 CACTGCAGCCTCTGCATCCCGGG - Intergenic
1175636667 20:60590123-60590145 ATTTGCAGGCCCTGGAGCTCAGG - Intergenic
1175866106 20:62177795-62177817 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1175959699 20:62629544-62629566 CTCTGCAACCTCTGCCTCTCGGG - Intergenic
1176011524 20:62899132-62899154 GTCTGCCGCCTCTGGAGACCGGG - Intronic
1176147973 20:63573934-63573956 CTCTGCACCCACTGGAGCGCAGG - Intronic
1176661980 21:9645631-9645653 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1178266927 21:31152106-31152128 CACTGCAACCTCTGCATCTCAGG + Intronic
1178672937 21:34607925-34607947 CTCTGCTGCCGCTGGAACTCAGG - Intronic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1179102091 21:38363036-38363058 CACTGCAGCCTCTGCATCTTGGG + Intergenic
1179189983 21:39115431-39115453 CCCTGCAGCTTGGGGAGCTCTGG + Intergenic
1179674719 21:42974034-42974056 CTCCCCAGGCTCTGGAGCCCGGG - Intergenic
1180354822 22:11829741-11829763 CTGGGCAGCCTCTGGATCGCGGG - Intergenic
1180383429 22:12162590-12162612 CTGGGCAGCCTCTGGATCGCGGG + Intergenic
1180943105 22:19672993-19673015 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1181283551 22:21736239-21736261 CGCCTCAGCCTCTGGAGCTGCGG - Intergenic
1181470630 22:23137165-23137187 CCCTGCAGCCTCTGCCTCTCTGG + Intronic
1181619975 22:24084312-24084334 CACTGCAACCTCTGCCGCTCAGG + Intronic
1181810468 22:25400868-25400890 CTCTGCATTCTCTTCAGCTCTGG - Intronic
1182114351 22:27746814-27746836 CTCTGCAGTCACTGGGTCTCCGG - Intergenic
1182468536 22:30532842-30532864 CTCTGCAGCATATGGAGTTCCGG - Exonic
1182981204 22:34673199-34673221 TTCTGAAGCCTCTAGAGTTCTGG + Intergenic
1183257818 22:36774126-36774148 CACTGCCTCCTCTGGTGCTCTGG + Intronic
1183277280 22:36906840-36906862 CTGTGCAGGCTCTGGAAGTCTGG + Intergenic
1183418210 22:37694941-37694963 CACTGCAACCTCTGGCCCTCGGG - Intronic
1183500689 22:38176967-38176989 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1183629045 22:39022202-39022224 CTGTGCAGCCTCTGCATCACGGG - Intronic
1183714761 22:39527198-39527220 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1183763349 22:39846274-39846296 CACTGCAGCCTCTACCGCTCAGG + Intronic
1183949687 22:41345912-41345934 CGCTGCGGCCTGTGGGGCTCTGG - Intronic
1184413673 22:44339952-44339974 CACAGCAGCCTCTGGAGTCCAGG - Intergenic
1184597841 22:45525006-45525028 CACTGCAGCCTCTGCGTCTCGGG - Intronic
1184779071 22:46637192-46637214 CTCTGCAGCCTGAGGAGATCAGG + Intronic
1184924085 22:47625275-47625297 GTCTGCACCCTCGGGAGCTCTGG - Intergenic
1185227973 22:49664012-49664034 CTGGGCACCCTCTGGAGCTGGGG - Intergenic
949523445 3:4878761-4878783 CATTGCAGCCTCTGGATCTGGGG - Intronic
949966057 3:9357167-9357189 CACTGCAGCCTCTGGCTCCCAGG - Intronic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950001181 3:9657624-9657646 CACTGCAACCTCTGCCGCTCAGG + Intronic
950223443 3:11214121-11214143 GTTTGCAGCCTCTGGAGTTCAGG - Intronic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
951235552 3:20231921-20231943 CACTGCAGCCTCTGCATCCCAGG - Intergenic
952762339 3:36925664-36925686 CACTGCAGCCTCTGCCTCTCGGG + Intronic
952835017 3:37595178-37595200 CACTGCAGCCTCAGCAGCCCAGG + Intronic
953752147 3:45617107-45617129 CACTGCAGCCTCTGCCTCTCAGG + Intronic
953873331 3:46646677-46646699 CTCCGCAGGCTCTGGGGCACAGG + Intergenic
953900515 3:46838958-46838980 CACTGCAGCCTCTGCCTCTCTGG + Intergenic
954158027 3:48698543-48698565 CACTGCAACCTCTGCCGCTCAGG + Intronic
954245408 3:49327458-49327480 CACTGCAGCCTCTGGCTCCCAGG - Intronic
954382165 3:50225352-50225374 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
955611857 3:60765930-60765952 TTCTTCAGCCTTTGGAACTCAGG + Intronic
955985356 3:64568170-64568192 GGCTCCAGCCTCTGGAGCTTTGG - Intronic
956320536 3:67991609-67991631 CTCTCCAGCCTTTGGACTTCAGG + Intergenic
956424689 3:69121701-69121723 CTCTGTAGCCTCTGTCTCTCTGG - Intronic
956786402 3:72646268-72646290 CTCTCCTGCCTTTGGAGCTCAGG + Intergenic
957632880 3:82740723-82740745 CTCTGGGGCCCCTGGAGCCCAGG - Intergenic
957730152 3:84124762-84124784 CTCTGCACTCTCTGGGGCCCAGG + Intergenic
957858283 3:85907833-85907855 CACTGCAACCTCTGCATCTCAGG - Intronic
958798794 3:98733094-98733116 CTTTGCAGCCTCTGAGGCTCAGG + Intronic
959526737 3:107385786-107385808 CACTTCTGCCTCTGGATCTCAGG - Intergenic
959761923 3:109976383-109976405 CTCTGCAACCTCTGCATCCCAGG - Intergenic
960034612 3:113089761-113089783 CTCTGCAGCCTTTGGTGCTGTGG + Intergenic
960368931 3:116810383-116810405 CACTGCAGCCTCTGCCTCTCAGG + Intronic
960587110 3:119330251-119330273 CTCTGCAGCTTGGGCAGCTCTGG - Intronic
961776752 3:129292566-129292588 CACTGCAGCCTCTGCCTCTCGGG + Intronic
962005321 3:131343711-131343733 GCTTGCACCCTCTGGAGCTCTGG + Intronic
964023519 3:152043162-152043184 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
964386786 3:156156055-156156077 CTCTGGCCCCTCTGGAGTTCAGG + Intronic
965056056 3:163717832-163717854 CACTGCAACCTCTGCAGCCCGGG - Intergenic
965097697 3:164255134-164255156 CTCTGTACCTTCTGGAGCTGGGG - Intergenic
965247949 3:166299700-166299722 CACTGCAGCCTCTGACTCTCGGG - Intergenic
966376015 3:179296595-179296617 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
966482254 3:180423862-180423884 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
966790940 3:183668827-183668849 CACTGCAGCCTCTGCCTCTCAGG - Intronic
966822423 3:183935615-183935637 TGCCTCAGCCTCTGGAGCTCTGG + Intronic
966823792 3:183946370-183946392 CTCCGCAGTCTATGGAGCACAGG - Intronic
967170471 3:186819391-186819413 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
968405495 4:336745-336767 CGCTGCAGCCGCTGGAGCCGGGG - Intergenic
968486355 4:864877-864899 CTCAGGAGCCACTGCAGCTCTGG + Intronic
968543266 4:1179038-1179060 CTTTGCAGCCTCTGCAGTCCAGG + Intronic
968731136 4:2269914-2269936 CTCTGCACCCTCTGGAACCCTGG - Exonic
968731311 4:2270585-2270607 CTCTGGATGCTCTGGAGGTCTGG + Exonic
968983250 4:3862358-3862380 CTCAGCAGCCACCGGAGCCCTGG - Intergenic
969056433 4:4405652-4405674 CTGTGCAGACTCTGGAGCTGGGG - Intronic
969114847 4:4865089-4865111 TCCTCCAGCCTCTGCAGCTCGGG + Intergenic
969910050 4:10435973-10435995 CACTGCAACCTCTGCACCTCGGG - Intergenic
970005918 4:11410555-11410577 CACTGCAGCCTCTCAAGCTGTGG - Intronic
970959552 4:21856689-21856711 CTCTGCACTCTCAGGAGCCCTGG + Intronic
971644754 4:29184238-29184260 CACTGCAGCCTCTGGCCCCCTGG - Intergenic
973036181 4:45410422-45410444 CTCTGCAACCTCTGGCTCCCGGG + Intergenic
973136191 4:46709362-46709384 CTCTGCAAACTGTGGACCTCTGG - Intergenic
973286198 4:48419474-48419496 CACTGCAGCCTCTGCATCTCTGG + Intronic
973969674 4:56199604-56199626 CACTGCAGCCTCTGACTCTCAGG - Intronic
974053852 4:56966100-56966122 CACTGCAACCTCTGCCGCTCTGG + Intronic
974816631 4:67013083-67013105 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
975101728 4:70521693-70521715 CTCTGCAACCTCTGGCTCCCGGG + Intronic
975189908 4:71448242-71448264 CACTGCAACCTCTGCATCTCAGG - Intronic
975563073 4:75725118-75725140 CTCTGTAGGCCCTGAAGCTCGGG + Intronic
975913560 4:79297470-79297492 CTTTGCACCCTCAGGAGCCCAGG + Intronic
976085553 4:81403835-81403857 CTCTGCAGCCTATGGTCTTCTGG - Intergenic
976599335 4:86923685-86923707 CACTACAACCTCTGCAGCTCTGG - Intronic
976902148 4:90191595-90191617 CCCTGCAGCATCTTGAGTTCTGG + Intronic
977208661 4:94192944-94192966 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
979433706 4:120663465-120663487 CTCTGCATGCTTTGGAACTCTGG + Intergenic
979964295 4:127059264-127059286 CACTGCAGCCTCTGCCGCCCAGG - Intergenic
980998357 4:139803178-139803200 CACTGCAGCCTCTGCCTCTCAGG - Intronic
981112710 4:140954288-140954310 CACTGCAGCCTCTGCTTCTCGGG + Intronic
981415793 4:144492047-144492069 CACTGCAACCTCTGCACCTCAGG + Intergenic
981455857 4:144952474-144952496 CACTGCAGGCTCTGGAGCCTTGG + Intergenic
981757250 4:148154082-148154104 CACTGCAGCCTCTGCCGCCCAGG + Intronic
981773389 4:148336322-148336344 ATCTGTGACCTCTGGAGCTCGGG - Intronic
982012323 4:151118014-151118036 CACTGCAGCCTCTGCCTCTCAGG - Intronic
982158152 4:152540961-152540983 CTCTGCACCCTCTGGGGGACGGG - Intergenic
983621449 4:169765577-169765599 CACTGCAGCCTCTGCTTCTCAGG - Intergenic
983895342 4:173075641-173075663 CTCCTCATCCTTTGGAGCTCAGG - Intergenic
984590906 4:181616705-181616727 TTCTCCAGCCTCTGGACTTCAGG - Intergenic
984949515 4:184996477-184996499 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
985727603 5:1524138-1524160 TCCTGCAGCCACTGGAGCACAGG + Intergenic
985823539 5:2177327-2177349 CTGGGCTGCCTCTGGAGCTGGGG - Intergenic
985968239 5:3353808-3353830 CACTGCAGCCTCTGCAGCTCAGG - Intergenic
986677357 5:10197793-10197815 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
986694849 5:10342585-10342607 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
986841947 5:11707521-11707543 CTTTCCAGCCTCTGTAGTTCAGG + Intronic
987881033 5:23746430-23746452 CTCTGCAACCTCTGCCTCTCAGG - Intergenic
987952025 5:24687706-24687728 CTCTGCACTCTCTGGAGCCTGGG - Intergenic
988270593 5:29010506-29010528 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
988794345 5:34638462-34638484 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
990229246 5:53693354-53693376 CTCTGCAGCCTCTGCCTCCCAGG + Intergenic
990245957 5:53863800-53863822 CTCTGCAACCTCTGCATCCCAGG + Intergenic
990472604 5:56130095-56130117 CTTGGCAGCCTCTGGAGTCCAGG - Intronic
990578016 5:57142318-57142340 CACTGCAACCTCTGTTGCTCAGG + Intergenic
990962246 5:61406786-61406808 CTCTGCAGCCTCTGCCTCCCGGG + Intronic
992308444 5:75467563-75467585 CACTGCAGCCTCTGCCTCTCTGG - Intronic
992677230 5:79117355-79117377 CTCTCCAGCCACAGCAGCTCTGG + Intronic
992787054 5:80180532-80180554 CTCAGCAGCCCCTCAAGCTCTGG - Intronic
992989984 5:82274332-82274354 CTCAGCAGCTTCTGGATCTGAGG + Exonic
993910173 5:93672383-93672405 CACTGCAACCTCTGAAGCCCTGG + Intronic
994452959 5:99967124-99967146 CTCTGCAGGCTCTGTTGCTCTGG - Intergenic
995052256 5:107719760-107719782 ATCTGCAGCCACTGCAGCCCTGG - Intergenic
995562392 5:113396558-113396580 CACTGCAGCCTCTGCATCTTAGG - Intronic
996106200 5:119506665-119506687 CTCTGCAGCATCTGTTGTTCAGG + Intronic
997358081 5:133277235-133277257 CACTGCAGCCTCTGCCTCTCAGG - Intronic
997455063 5:134010520-134010542 CACTGCAACCTCTGCATCTCGGG - Intergenic
997561451 5:134849177-134849199 CACTGCAACCTCTGGAACCCCGG - Intronic
997980096 5:138463719-138463741 CCCAACAGCCTCTGGAGGTCGGG - Intergenic
998078295 5:139254307-139254329 CACTGCAGCCTCTGCTGCCCAGG + Intronic
998640078 5:144000008-144000030 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1000002015 5:157148113-157148135 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1000074289 5:157770560-157770582 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1000875064 5:166627124-166627146 CTCTGCAGCCTCTGCCTCCCGGG + Intergenic
1000901644 5:166918437-166918459 CACTGCAACCTCTGCATCTCAGG - Intergenic
1001250896 5:170146192-170146214 CTCTCCCACCTCTGGATCTCTGG + Intergenic
1001382022 5:171311532-171311554 CTCTGCAGAATCTGCAGCCCTGG + Exonic
1001572970 5:172742716-172742738 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1002078235 5:176722467-176722489 CTCTGCAGCCTCACCAGCTCTGG + Intergenic
1002201838 5:177533172-177533194 CTGAGCAGACTCTGGTGCTCTGG + Intronic
1002295102 5:178226149-178226171 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1002350536 5:178580250-178580272 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1002438864 5:179253568-179253590 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1002486352 5:179539928-179539950 CACTGCAGCCTCTGCCCCTCGGG - Intergenic
1004403156 6:15307295-15307317 CACTGCAGCCTCTGCACCCCCGG + Intronic
1004700400 6:18073962-18073984 CTCTGCAGCCTCTACCACTCAGG - Intergenic
1005594405 6:27365569-27365591 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
1005672338 6:28119404-28119426 CTCTGCAGCCTCTTCCTCTCAGG - Intergenic
1005707628 6:28470857-28470879 CACTGCAGCCTCTGCCTCTCTGG - Intergenic
1005913297 6:30329350-30329372 CTCTGCAGCCTCTACAGCTGCGG + Exonic
1006226822 6:32545604-32545626 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1006260509 6:32865118-32865140 CTCTGCTGGCTCTGGGGCACTGG + Intergenic
1007294551 6:40812079-40812101 CTCTGTGGTCTCTGGAGCTCTGG - Intergenic
1007520329 6:42446927-42446949 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1008342971 6:50389780-50389802 CTGTGCAGCCTGTGGAACTGTGG + Intergenic
1008940592 6:57041388-57041410 CTCTAGACCCACTGGAGCTCAGG + Intergenic
1009818197 6:68763995-68764017 CACTGCAACCTCTGGCTCTCAGG - Intronic
1010422071 6:75687712-75687734 TTCTGCAGCCTCTGCTGGTCTGG - Intronic
1010470294 6:76218814-76218836 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1011304476 6:85911140-85911162 ATCTTCTGCCTCTGGAGTTCTGG - Intergenic
1011323135 6:86119205-86119227 CTTTCCAGCCTCTGCAGTTCAGG - Intergenic
1011748343 6:90430263-90430285 CTCTGCACCTTCTTGAGCCCTGG - Intergenic
1011762096 6:90578346-90578368 CACTGCAGCCTCTGCCTCTCTGG + Intronic
1011852679 6:91649956-91649978 CACTGCAGTCTCTGGCTCTCAGG + Intergenic
1012343923 6:98163870-98163892 CACTGCAGCCTCTGCAACCCAGG + Intergenic
1012887446 6:104861324-104861346 CACTGCAGCCTCTGTCTCTCGGG - Intergenic
1013027730 6:106294765-106294787 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1014023973 6:116623172-116623194 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1014125412 6:117771468-117771490 CTCTGAAACCTCTGAGGCTCTGG - Intergenic
1014811959 6:125896714-125896736 CACTGCAGCCTCAGCATCTCGGG - Intronic
1015143593 6:129961253-129961275 CACTGCAGCCTCCGGCTCTCAGG + Intergenic
1015678802 6:135781258-135781280 CATTGCAGCCTCTGGTGCCCTGG + Intergenic
1015771836 6:136776317-136776339 CACTGCAGCCTCTGCCTCTCTGG + Intronic
1015883686 6:137894559-137894581 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1016334448 6:142989405-142989427 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1016797145 6:148130380-148130402 CTCAGCCGCTGCTGGAGCTCTGG + Intergenic
1017509535 6:155101784-155101806 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1017682442 6:156877783-156877805 CACTGCAACCTCTGCTGCTCGGG + Intronic
1017766410 6:157610565-157610587 CTCAACAGCCCCTGGAGGTCAGG + Intronic
1017804225 6:157929371-157929393 CTCTGCAGCCTCTGAGCCTGTGG - Intronic
1017924052 6:158895647-158895669 CTCTGCAGCCCCTGGGCCTAGGG + Intronic
1018225263 6:161622266-161622288 CTGTGTAGCCTCTGAAGATCTGG + Intronic
1018423769 6:163662479-163662501 CACTGCAGCCTCTGGGGACCGGG + Intergenic
1018751177 6:166807750-166807772 CCCTGCAGCCACCTGAGCTCAGG - Intronic
1018814740 6:167322168-167322190 CTCTTCAGCTTCCGGAGCTGCGG + Intergenic
1018867244 6:167755814-167755836 CGCAGCAGCCCCTGCAGCTCTGG - Intergenic
1019307553 7:343122-343144 CTCTCAGGCCTCTGGAGCTCAGG + Intergenic
1019347518 7:538212-538234 CTCTGCAGCCCCTGGACCAGGGG - Intergenic
1019420626 7:949123-949145 CTGTGCAGTCACTGGGGCTCAGG - Intronic
1019626163 7:2016639-2016661 CTCAGAAGACCCTGGAGCTCAGG + Intronic
1019768654 7:2869902-2869924 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
1020003978 7:4771934-4771956 CCCTTCAGCCTCTGGAGCAGGGG - Intronic
1020061713 7:5157361-5157383 CCCTGCAGCCTCTGGCTCCCGGG - Intergenic
1020166446 7:5811309-5811331 CCCTGCAGCCTCTGGCTCCCAGG + Intergenic
1020887197 7:13833013-13833035 CACTGCAACCTCCGGATCTCGGG + Intergenic
1021118425 7:16770279-16770301 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1021179920 7:17494494-17494516 CTCATCTGCCTCTGGAGCTTGGG - Intergenic
1021784772 7:24140925-24140947 CACTGCAGCCTCTGCATCCCGGG + Intergenic
1021976238 7:26013450-26013472 CTCTGAAGCCTTTGGATGTCTGG + Intergenic
1022010783 7:26306485-26306507 CACTGCAGCTTCCTGAGCTCAGG + Intronic
1022209176 7:28191947-28191969 CTCCCCAGCCTCTGCAGCTGGGG - Intergenic
1022618672 7:31959284-31959306 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1023871001 7:44263046-44263068 CTCTCCAGCTTCTGGTGATCTGG + Exonic
1023980661 7:45068226-45068248 CTCTGGTGCCCTTGGAGCTCAGG + Intronic
1024899590 7:54303413-54303435 CACTGCAGCCTCTGCCGCCCAGG - Intergenic
1025927860 7:65973679-65973701 CACTGCAACCTCTGCCGCTCAGG - Intronic
1026541585 7:71284270-71284292 CTCTGCAGCCTCTGCCTCTTGGG + Intronic
1026793711 7:73352045-73352067 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1027197301 7:76039491-76039513 TTCTGCAGCCTCCACAGCTCTGG - Intronic
1027399807 7:77796011-77796033 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1027557850 7:79687832-79687854 CACTGCAGCCTCTGAATCTCTGG - Intergenic
1028349161 7:89823490-89823512 CACTGCAACCTCTGCTGCTCGGG + Intergenic
1028581302 7:92412105-92412127 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1028676480 7:93469205-93469227 CTCTGGACCCTCTGTAGGTCAGG - Intronic
1028844570 7:95465291-95465313 CTCTGGAGCCTCTGGCTCCCAGG + Intergenic
1029018315 7:97337793-97337815 CACTGCAGCCTCAGGTTCTCGGG - Intergenic
1029879597 7:103793840-103793862 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1030956340 7:115856997-115857019 CACTGCAACCTCTGGTTCTCAGG - Intergenic
1031863194 7:127006887-127006909 CTTTGCCTCCTATGGAGCTCTGG + Intronic
1032114668 7:129106803-129106825 CACTGCAACCTCTGCAGCCCAGG + Intergenic
1032233429 7:130098102-130098124 TTATGCATGCTCTGGAGCTCAGG - Intronic
1033093538 7:138409683-138409705 CACTGCAACCTCTGCATCTCAGG + Intergenic
1034211229 7:149364998-149365020 GTGTGCAGCATCTGCAGCTCTGG - Intergenic
1034510402 7:151529614-151529636 CTCTGCAACCTCTGCTTCTCAGG - Intergenic
1034607548 7:152331232-152331254 CACTGCAGCCTCTGGCTCCCAGG - Intronic
1035099099 7:156382005-156382027 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1035179481 7:157078587-157078609 ATCCCCCGCCTCTGGAGCTCGGG - Intergenic
1035277423 7:157756368-157756390 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1035324125 7:158053907-158053929 CTCTGGAGTCTCTGCATCTCTGG - Intronic
1036061644 8:5328367-5328389 CGCTGCAGCCTCTGCCTCTCAGG - Intergenic
1036440581 8:8778171-8778193 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1036601497 8:10264946-10264968 ATGTGCAGCCACTGGAGCTGGGG + Intronic
1036837362 8:12084724-12084746 CACTGCAGCCTCTGCTTCTCGGG - Intergenic
1036859155 8:12330968-12330990 CACTGCAGCCTCTGCTTCTCGGG - Intergenic
1037163625 8:15800495-15800517 CACTGCAGCCTCAGCAGCCCAGG - Intergenic
1037390124 8:18384765-18384787 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1037448063 8:18987735-18987757 CACTGCTGCCTCTTGGGCTCAGG - Intronic
1037651988 8:20847250-20847272 CACTGCAGCCTCTGCCTCTCGGG - Intergenic
1037830695 8:22187064-22187086 CACTGCAACCTCTGCATCTCGGG + Intronic
1037902569 8:22696055-22696077 CTCCACAGCCTCTGGGGCCCTGG - Intergenic
1038142220 8:24858591-24858613 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1038344006 8:26715380-26715402 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1038547669 8:28438238-28438260 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1038764284 8:30413152-30413174 CACTGCAGCCTCTGCCACTCAGG + Intronic
1039126364 8:34206191-34206213 CACTGCAGCCTCAGAATCTCGGG - Intergenic
1039256590 8:35725623-35725645 CTGTGCAGATTCTGGAGCTGGGG - Intronic
1039355821 8:36814538-36814560 AACTGCATCCCCTGGAGCTCAGG + Intronic
1039869706 8:41535260-41535282 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1039950474 8:42167820-42167842 CTTTGGAGCCTCTTGAGCTCTGG - Intronic
1040596188 8:48839912-48839934 CACTGCAGCCTCTGCCGCCCGGG + Intergenic
1040610179 8:48976378-48976400 GTGTACAGGCTCTGGAGCTCTGG - Intergenic
1040855005 8:51940113-51940135 CTCTGCAGCCTCCGGCTCCCGGG + Intergenic
1040910627 8:52514865-52514887 CACTGCAGCCTCTGCCGCCCAGG - Intergenic
1041212804 8:55569655-55569677 TTCTCCAGCCTCTGGTGCCCAGG - Intergenic
1041860399 8:62506548-62506570 CTCTGCAACCTCTGCCTCTCGGG + Intronic
1042401842 8:68358779-68358801 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1043168589 8:76935478-76935500 CTCTTCAGCCTCAGCAGCTTAGG - Intergenic
1043191665 8:77230715-77230737 CACTGCAGCCTCTGCATCCCAGG + Intergenic
1043205110 8:77427719-77427741 CTCTGCAACCTCTTTAGCACTGG + Intergenic
1043464411 8:80490329-80490351 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1043598876 8:81915829-81915851 CCTAGCAGCCTCTGGAACTCTGG + Intergenic
1043745487 8:83869233-83869255 CTCTGCATTCTCTGGAGCCTGGG + Intergenic
1044578998 8:93803948-93803970 CACTGCAACCTCTGGCTCTCAGG + Intronic
1044775051 8:95678628-95678650 CTCTGCACTCTCAGGAGCCCAGG - Intergenic
1044904722 8:96989151-96989173 CTCTGCAGTCTCTAGAACTGAGG + Intronic
1045342605 8:101267991-101268013 CCCTGCAGCCTTTGGAGTCCAGG + Intergenic
1045534852 8:103018285-103018307 CACTGCAGCCTCTGGCTCCCAGG + Intergenic
1045620132 8:103967566-103967588 CACTGCAACCTCTGCATCTCAGG + Intronic
1045905557 8:107340612-107340634 CACTGCAGCCTCTTGGGCTCCGG + Intronic
1047529728 8:125664081-125664103 CACTGCAGCCTCCGCATCTCGGG - Intergenic
1049114927 8:140678120-140678142 CACTGCAACCTCTGCAGCCCAGG + Intronic
1049205137 8:141360123-141360145 CTCTGCGGTCTCTGGAGCTGGGG + Intronic
1049443178 8:142618387-142618409 TCCTGCAGCCTGTGGAGCCCTGG - Intergenic
1049495711 8:142931245-142931267 CTCTCCAGCCTTTGGAGTCCAGG - Intergenic
1049624953 8:143615756-143615778 CTCTGGAGCCTCTGGCTCCCAGG - Intronic
1049976418 9:864278-864300 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1050013521 9:1209325-1209347 CTCTGCAGCCCCTTGAGATCAGG + Intergenic
1050166134 9:2766455-2766477 CTCTGCAGCCTCCGTCTCTCAGG - Intronic
1050416992 9:5428443-5428465 CCTTGCAGTCTTTGGAGCTCTGG - Intronic
1050458476 9:5856522-5856544 CTCTGCTGGCTCTGGTACTCTGG + Intergenic
1051635584 9:19178338-19178360 CTCTGCAGCCTCTGCCTCCCGGG + Intergenic
1052142520 9:25004395-25004417 CAGTGCAGCCTCGGGTGCTCTGG - Intergenic
1052747154 9:32451986-32452008 CACTGCAGCCTCTGCATCCCGGG - Exonic
1053040551 9:34867078-34867100 ATCTTCAGCCTCTGGGGGTCTGG + Intergenic
1053247211 9:36544418-36544440 CACTGCAGCCTCTGCCGCCCAGG + Intergenic
1053533732 9:38905778-38905800 CTCTGTAGCCTCTCGGGCACAGG - Intergenic
1054205958 9:62130207-62130229 CTCTGTAGCCTCTCGGGCACAGG - Intergenic
1054632402 9:67458163-67458185 CTCTGTAGCCTCTCGGGCACAGG + Intergenic
1055996904 9:82169743-82169765 CTCTGCACCATCAGGAGGTCAGG - Intergenic
1056406911 9:86283323-86283345 CTGTGCAGTGTCTGGTGCTCAGG - Intergenic
1056438102 9:86592743-86592765 ATCTGCAGACACTGGAGCCCTGG - Intergenic
1056651898 9:88472308-88472330 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1056787546 9:89603948-89603970 GGCTGCAGCCCCTGGAGCTTAGG - Intergenic
1056985852 9:91363217-91363239 CGCTGCAACCTCTGCATCTCAGG + Intergenic
1057318378 9:93987967-93987989 CACTGCAGCCTCTGCTTCTCAGG - Intergenic
1057367613 9:94438002-94438024 CACTGCAGCCTCTGCCTCTCGGG + Intronic
1057483281 9:95462450-95462472 CTCAGCTGCTTCTGGAGCCCAGG + Intronic
1057655715 9:96950059-96950081 CACTGCAGCCTCTGCCTCTCGGG - Intronic
1058038616 9:100280301-100280323 CTCTTCACCCTGTGGAGCACAGG + Intronic
1058254883 9:102749313-102749335 CACTGCAGCCTCTGCCTCTCAGG - Intergenic
1058688448 9:107499322-107499344 CACTGCAGCCTCTGCCCCTCGGG + Intergenic
1058967579 9:110051264-110051286 CTCAGTAGCCTCAGGACCTCTGG + Intronic
1059435851 9:114275784-114275806 CCTTGCAGCGCCTGGAGCTCTGG + Intronic
1060199967 9:121646534-121646556 CCTTTCAGTCTCTGGAGCTCTGG - Intronic
1060317629 9:122527296-122527318 CTCTGCAGCATCTGGAGCTGAGG + Intronic
1060350436 9:122853674-122853696 CACTGCAGCCTCTGGCTCTCAGG - Intronic
1060402665 9:123357391-123357413 CCCTACAGCCTGTGGAGCTCTGG - Intronic
1060427689 9:123520076-123520098 AACTGCAGCCTCATGAGCTCAGG - Intronic
1060619215 9:125048052-125048074 CACTGCAACCTCTGCTGCTCAGG + Intronic
1060906538 9:127312123-127312145 CTATACAGGCCCTGGAGCTCAGG - Intronic
1061178860 9:129012514-129012536 GGCTGCAGGCACTGGAGCTCAGG + Intronic
1061621005 9:131811368-131811390 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1061677065 9:132223441-132223463 CTCTGCAGCCTGTGGTGTCCAGG + Intronic
1061780671 9:132994409-132994431 CTTTGCTGGCTCTGGTGCTCTGG - Intergenic
1061934454 9:133849639-133849661 CTCTGCAGCACCTGGATCTCAGG - Intronic
1062024374 9:134333493-134333515 GTCTGGAGCCTCTGGCGCTGAGG + Intronic
1062112793 9:134791190-134791212 TTCTGCAGCCTCTGGGTGTCTGG + Intronic
1062384930 9:136305443-136305465 CTCTGCAGCCTCTGCTTCCCAGG + Intronic
1062420081 9:136476499-136476521 CTCAGGAGCTTCAGGAGCTCTGG - Exonic
1062484099 9:136765638-136765660 CTCTGCAGCCTCTGCCTCCCGGG + Intronic
1062653777 9:137591439-137591461 CACTGCAGCCTCTGCCTCTCGGG + Intergenic
1062665628 9:137669924-137669946 CTCTGCAACCTCTGCCGCCCGGG + Intronic
1062674981 9:137737096-137737118 CACCTCAGCCTCTGGGGCTCTGG - Intronic
1202800936 9_KI270719v1_random:174907-174929 CTCTGCAGCCACTGGGGATGGGG - Intergenic
1203773998 EBV:62784-62806 CGCTGATGCCTCTGGAGCTGGGG - Intergenic
1203639541 Un_KI270750v1:147474-147496 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1185623126 X:1465489-1465511 CTCTCCTGCCTCTGGAGGCCGGG + Exonic
1185634153 X:1538973-1538995 CTCTGCAACCTCTGCCTCTCTGG - Intergenic
1186041759 X:5486757-5486779 CTGAGCAGCACCTGGAGCTCAGG + Intergenic
1186568785 X:10692539-10692561 CTCTGCAGCCTCTGCCTCCCGGG - Intronic
1187165717 X:16802324-16802346 CACTGCAGCCTCTGCCGCCCAGG + Intronic
1187387828 X:18864456-18864478 CACTGCAGCCTCTACCGCTCAGG + Intergenic
1189200799 X:39194131-39194153 CTCTGGGACCTCTGGAGCTGGGG + Intergenic
1189489455 X:41458533-41458555 CACTGCAGCCTCTGCCACTCGGG + Intronic
1190169299 X:48099237-48099259 CACTGCAGCCTCTGCTTCTCGGG + Intergenic
1190182824 X:48207859-48207881 CACTGCAGCCTCTGGCTCTCGGG - Intronic
1190752284 X:53372891-53372913 CTCTGCAACCTCTGCCTCTCGGG + Intergenic
1191937062 X:66437556-66437578 CTCTTCAGCCTGGAGAGCTCAGG - Intergenic
1192147418 X:68690904-68690926 CTCTGCAGCCATTGAAGGTCAGG + Intronic
1192485424 X:71520607-71520629 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1192485499 X:71521440-71521462 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1192485574 X:71522273-71522295 CACTGCAGCCTCTGCCTCTCAGG - Intronic
1192750883 X:73989939-73989961 CACTGCAGCCTCTGCCCCTCGGG - Intergenic
1194289306 X:92049847-92049869 CACTGCAGCCTCTGCCTCTCAGG + Intronic
1194289534 X:92053644-92053666 CACTGCAGCCTCTGCCGCCCGGG + Intronic
1194741325 X:97578038-97578060 CACTGCAGCCTTTTGAGCTGGGG + Intronic
1195564368 X:106323873-106323895 CTCTGGACCCTCTGGGGCCCAGG - Intergenic
1195900931 X:109796478-109796500 CACTGCAACCTCTGCTGCTCAGG - Intergenic
1197112106 X:122788777-122788799 CACTGCAGCCTCTGCCTCTCAGG + Intergenic
1197720424 X:129741092-129741114 TTCTCCAGGCTCTGGACCTCTGG - Intronic
1197766215 X:130060770-130060792 CTCTGAAGCCGCTGGACCTGGGG - Intergenic
1198401628 X:136274159-136274181 CTCTCCAGCCTTGGGAGCTCTGG + Intergenic
1199148634 X:144402106-144402128 CACTGCAGCCTCTGTCTCTCAGG + Intergenic
1199698242 X:150358912-150358934 CTGGGCAGCCTCTGGAATTCTGG - Intergenic
1199752550 X:150834414-150834436 CACTGCAACCTCTGCATCTCTGG - Intronic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200069410 X:153520299-153520321 CTCAGAAGCCCCTGGGGCTCTGG - Intronic
1200607049 Y:5278224-5278246 CACTGCAGCCTCTGCCGCCCAGG + Intronic
1202143129 Y:21749948-21749970 CACTGCAACCTCTGGCTCTCAGG - Intergenic
1202143698 Y:21755867-21755889 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1202329305 Y:23730064-23730086 CACTGCAACCTCTGCATCTCAGG + Intergenic
1202541466 Y:25939990-25940012 CACTGCAACCTCTGCATCTCAGG - Intergenic