ID: 919856491

View in Genome Browser
Species Human (GRCh38)
Location 1:201709686-201709708
Sequence CTGCAGGGTGTAGCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919856479_919856491 20 Left 919856479 1:201709643-201709665 CCCATGATGGCCACCAGGGGCCA 0: 1
1: 0
2: 0
3: 20
4: 174
Right 919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 252
919856480_919856491 19 Left 919856480 1:201709644-201709666 CCATGATGGCCACCAGGGGCCAC 0: 1
1: 0
2: 3
3: 27
4: 247
Right 919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 252
919856484_919856491 10 Left 919856484 1:201709653-201709675 CCACCAGGGGCCACTGCTGGGGC 0: 1
1: 0
2: 5
3: 42
4: 392
Right 919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 252
919856485_919856491 7 Left 919856485 1:201709656-201709678 CCAGGGGCCACTGCTGGGGCACA 0: 1
1: 0
2: 3
3: 41
4: 346
Right 919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 252
919856488_919856491 0 Left 919856488 1:201709663-201709685 CCACTGCTGGGGCACAGAGGGAG 0: 1
1: 1
2: 3
3: 53
4: 679
Right 919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919856491 Original CRISPR CTGCAGGGTGTAGCCTCTGC AGG Intronic
900126046 1:1069372-1069394 CTGCGGGGCGTGGCCTGTGCGGG + Intergenic
900216898 1:1486452-1486474 CTGGAGTGTGGAGCCCCTGCCGG - Intronic
900596023 1:3480548-3480570 CCGCAGGATGGAGCGTCTGCGGG + Exonic
901596471 1:10389409-10389431 GTGCTGGGTGCTGCCTCTGCTGG - Intergenic
902636087 1:17735916-17735938 CTGCAAGGGGTAGCCTATGAGGG + Intergenic
904035841 1:27558125-27558147 GTTCAGGGAGTTGCCTCTGCAGG + Intronic
905208218 1:36355187-36355209 CAGCAGGGTGTGGCCTCACCTGG + Exonic
905293265 1:36937885-36937907 CTGCATGGAGTGGTCTCTGCTGG + Intronic
909837549 1:80276286-80276308 CTTGAGGGTGTGGCCTTTGCTGG - Intergenic
911375590 1:97046968-97046990 ATGCAGTATGTAGCCACTGCTGG + Intergenic
913531803 1:119738846-119738868 CTGCTGGGTGTATCTGCTGCAGG + Intronic
914558364 1:148791751-148791773 CTGCAGGGCGTAGGCCCTGGTGG + Intergenic
914614471 1:149338479-149338501 CTGCAGGGCGTAGGCCCTGGTGG - Intergenic
915994185 1:160547472-160547494 CTGCAGGGTCTAGAGACTGCTGG - Intronic
916868750 1:168888783-168888805 CTGGAGGGTGTTCCTTCTGCAGG - Intergenic
918439040 1:184547187-184547209 CTGCATGGTCTGGCCTCTTCTGG - Intronic
919048111 1:192480028-192480050 CTTAAGGGTGAAGCCTTTGCTGG - Intergenic
919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG + Intronic
920191181 1:204194902-204194924 CTCCAGGATGAAGCCCCTGCAGG - Intronic
922021829 1:221713161-221713183 TTGCATGGGGTTGCCTCTGCAGG - Intronic
922569680 1:226626638-226626660 CAGAAGGGGGCAGCCTCTGCAGG + Intergenic
924483381 1:244456330-244456352 CTTCAGGGTGGAGCCCCTGGAGG - Intronic
1063124496 10:3126858-3126880 TTGCAGGGGGTGGCGTCTGCTGG + Intronic
1065966443 10:30774778-30774800 CTGCAGAGTCCAGACTCTGCTGG + Intergenic
1068496767 10:57792548-57792570 CTGCAGGGTGGAGCCCTTGGAGG - Intergenic
1071490079 10:86130342-86130364 CTTGAGGGTGGAGCCTTTGCTGG - Intronic
1073640115 10:105243893-105243915 CTGCAGCTGGGAGCCTCTGCAGG + Intronic
1076186889 10:128457299-128457321 CTGGAGGGTGTGGAATCTGCAGG + Intergenic
1077135499 11:996179-996201 CTGCAGGGCGGAGCCGCTGCCGG - Intronic
1077162595 11:1120591-1120613 CTGCAGGATGTGGGCTCTGCAGG - Intergenic
1077486194 11:2839372-2839394 CCGCACGGAGCAGCCTCTGCAGG + Intronic
1080331720 11:31147072-31147094 CTGCAGGGTGTAGCTTAGGGAGG - Intronic
1082228645 11:49738785-49738807 CTTCAGGGTGGAGCCTTTGGTGG + Intergenic
1083689896 11:64401152-64401174 CTGCCGGGGGTGCCCTCTGCGGG - Intergenic
1084531604 11:69730951-69730973 CTGCAGAGTGAAGCCTGTGGAGG + Intergenic
1084557462 11:69883527-69883549 ATGCTGGGTGTGGTCTCTGCGGG + Intergenic
1084766535 11:71312667-71312689 CTTGAGGGTGGAGCCTTTGCCGG + Intergenic
1085041364 11:73328294-73328316 CTGCAGGCTGGGGGCTCTGCCGG + Intronic
1086621427 11:88890368-88890390 CTTCAGGGTGGAGCCTTTGGTGG - Intronic
1086916337 11:92533843-92533865 CTGCATGGTGTAGCTGCTGTTGG + Intronic
1087013900 11:93538203-93538225 CTGACGGGTGCAGTCTCTGCGGG - Intronic
1087561671 11:99797721-99797743 CTGCAGGTTGTTTACTCTGCTGG + Intronic
1090335409 11:125959680-125959702 CTGCAGGCCGTTGCCTATGCTGG + Exonic
1090482287 11:127079284-127079306 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482299 11:127079360-127079382 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482311 11:127079436-127079458 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482323 11:127079512-127079534 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482335 11:127079588-127079610 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482347 11:127079664-127079686 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482357 11:127079740-127079762 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090482369 11:127079816-127079838 CTGCAGGCTGAAGCCTCCACTGG + Intergenic
1090965883 11:131597411-131597433 TTGCTGAGTGCAGCCTCTGCAGG - Intronic
1091269760 11:134299783-134299805 CTGAGGGGTGTGGCCTTTGCAGG + Intronic
1091590035 12:1837364-1837386 CTGCAGGGTGAAGCCTCCACGGG + Intronic
1091723862 12:2832545-2832567 ATGCAGGATGTACCCTCTCCAGG + Intronic
1092783649 12:12009141-12009163 CTGCAGGGTGAAGAATCTGCAGG + Intergenic
1093122244 12:15284908-15284930 CTTGAGGATGTATCCTCTGCAGG - Intronic
1093751828 12:22808355-22808377 CTTGAGGGTGGAGCCTTTGCCGG + Intergenic
1094839100 12:34335546-34335568 CAGCAGGGTCTAGCCGCTCCGGG - Intergenic
1100025529 12:90122850-90122872 CTGCACGAGGGAGCCTCTGCTGG + Intergenic
1100797478 12:98197661-98197683 CTGGAGGGTATAGTCACTGCAGG - Intergenic
1100908583 12:99332000-99332022 CAGCTGGGTATAACCTCTGCAGG + Intronic
1103931707 12:124454059-124454081 CTGCATGGTGCACCCTCTGCAGG - Intronic
1104015107 12:124956863-124956885 CTCCAGGGTGAAGCAACTGCAGG - Exonic
1104361304 12:128135690-128135712 CTTCAGGTGGTTGCCTCTGCTGG + Intergenic
1104715313 12:131012456-131012478 CTGCAGGAAGTCGCTTCTGCGGG + Intronic
1104944881 12:132411076-132411098 CTGCAGGGTGGACCCCCTGGGGG + Intergenic
1105256180 13:18745173-18745195 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1108555122 13:51584388-51584410 CCGCAGGGGGTAGCCGCTGGTGG - Intergenic
1111878187 13:93921859-93921881 CTTGAGGGTGGAGCCTTTGCTGG + Intronic
1113456927 13:110455997-110456019 CTGCTGGGGGCAGGCTCTGCAGG - Intronic
1113463404 13:110497168-110497190 CTCCTGGGTGGAGCTTCTGCTGG - Intronic
1113521476 13:110944931-110944953 CTCCAGCTTGTAGACTCTGCAGG + Intergenic
1113617843 13:111693791-111693813 CTGCAGGCTGCAGCCTCGGCCGG + Intergenic
1113623376 13:111779052-111779074 CTGCAGGCTGCAGCCTCGGCCGG + Intergenic
1115480242 14:33853430-33853452 CTGCAGGCCGTAGCCCCTGTGGG - Intergenic
1116835661 14:49767603-49767625 CTGCCGGGCGCCGCCTCTGCGGG - Exonic
1117779238 14:59215522-59215544 CTGCAGGCGGCAGCCGCTGCAGG + Intronic
1118817386 14:69323104-69323126 CTGCAGGCTGTAGTGTCCGCTGG + Intronic
1119221109 14:72908141-72908163 CTGCAGGGGGTTTCCTTTGCAGG + Intergenic
1120163584 14:81170545-81170567 CTGCAAGCCTTAGCCTCTGCCGG + Intergenic
1120316328 14:82898233-82898255 CTCCAGGATGTAGCTTCTGAAGG - Intergenic
1121318117 14:92974172-92974194 CTGGAGGGTGGGGCCCCTGCAGG + Intronic
1121373543 14:93383598-93383620 CAGCAAGGTGTACTCTCTGCTGG + Intronic
1122822443 14:104354349-104354371 CATCTGGGTGTAGGCTCTGCCGG + Intergenic
1122854512 14:104553704-104553726 CTACAGGGTTGCGCCTCTGCCGG - Intronic
1123069884 14:105637485-105637507 CTGCAGGGGGCAGCAGCTGCAGG + Intergenic
1123105478 14:105839335-105839357 CTGCAGGGGGCAGTCCCTGCAGG + Intergenic
1123144699 14:106117163-106117185 CTGCAGGGTCTGGGCTCGGCTGG + Intergenic
1126559231 15:50025344-50025366 CTGCAGGGTCTGGCCTCTGATGG + Intronic
1127482939 15:59393698-59393720 CTGCAGAATGTAGGCTCGGCTGG - Intronic
1127976113 15:63998470-63998492 CTGCAGGCTGGGGACTCTGCAGG + Intronic
1129447173 15:75626442-75626464 TGCCAGGGTGTAGCCTCTGCAGG + Intronic
1129489097 15:75905405-75905427 CTGCAGGGTGTACCATCTCTGGG + Intronic
1131610578 15:93957164-93957186 CTTCATCGGGTAGCCTCTGCAGG - Intergenic
1132462326 16:61697-61719 CTGCGGGGTGGAGCGTCAGCGGG + Intronic
1132870233 16:2112548-2112570 CTGCAGAGTGGAGCCTCGGCTGG - Intronic
1132913648 16:2329655-2329677 CTGCTGTGTGGAGCCTCTTCTGG - Exonic
1134522306 16:14924387-14924409 CTGCAGAGTGGAGCCTCGGCTGG + Intronic
1134709976 16:16323038-16323060 CTGCAGAGTGGAGCCTCGGCTGG + Intergenic
1134717189 16:16363038-16363060 CTGCAGAGTGGAGCCTCAGCTGG + Intergenic
1134949627 16:18345607-18345629 CTGCAGAGTGGAGCCTCGGCTGG - Intergenic
1134957562 16:18389121-18389143 CTGCAGAGTGGAGCCTCAGCTGG - Intergenic
1136716315 16:32286529-32286551 CTGCAGGCTTTAGACTCAGCCGG + Intergenic
1138577291 16:57916093-57916115 ATGCAAGGTTTAGCGTCTGCGGG - Intronic
1141279032 16:82614009-82614031 CTGCAGGGCGTGGCCTCTGAGGG + Intergenic
1141587938 16:85047585-85047607 CTGCAGGCTGACCCCTCTGCTGG + Intronic
1142256530 16:89016561-89016583 CTGCTGGGTGTTGACTGTGCTGG - Intergenic
1203144871 16_KI270728v1_random:1793095-1793117 CTGCAGGCTTTAGACTCAGCCGG + Intergenic
1142919133 17:3169300-3169322 CTGCACCATGTAGCCACTGCTGG - Intergenic
1143039363 17:4022109-4022131 CTGCAGGTTCCAGCCTCTGCTGG + Intronic
1144742298 17:17590878-17590900 CTGCAGAGGGCAGCCTCAGCAGG + Intronic
1145296108 17:21593625-21593647 CTGCACGGTGCAGCCCCTCCTGG - Intergenic
1145367684 17:22278436-22278458 CTGCATGGTGCAGCCCCTCCTGG + Intergenic
1146485376 17:33238446-33238468 CAGCAGCGTGTTGCCTTTGCTGG - Intronic
1148203578 17:45765797-45765819 ATGCAGGGTGTGGCTTCTGGGGG + Intergenic
1148991988 17:51674014-51674036 CTGGAGGGTGAAGCCTGAGCAGG - Intronic
1152409893 17:80117960-80117982 CTGCATGGTGGAGGTTCTGCCGG + Intergenic
1154434854 18:14335505-14335527 CTGGAGGCTGTGCCCTCTGCAGG - Intergenic
1157153396 18:45241553-45241575 CTGGAGATGGTAGCCTCTGCTGG - Intronic
1157300366 18:46474657-46474679 CTGCAGAGTGTGGCATCTGTGGG - Intergenic
1157701606 18:49764400-49764422 CTGCAGTGTGTAGACAGTGCAGG - Intergenic
1157859282 18:51126064-51126086 CTTCAGGGTGGGGCCTTTGCTGG + Intergenic
1159891552 18:73958060-73958082 ATGCAGAGTCTAGCCTCTTCAGG - Intergenic
1160253732 18:77228365-77228387 ATGCATGGTGTAGCCTCCACAGG - Intergenic
1160334548 18:78027075-78027097 CTGCAGGGTGAGGCATCTGCAGG - Intergenic
1161010226 19:1956226-1956248 CTGCTGGGTCTACCCACTGCTGG - Intronic
1161713802 19:5864407-5864429 CTACAGAGTGGAGCCACTGCCGG + Intergenic
1161716244 19:5877648-5877670 CTGTAGAGTGGAGCCACTGCCGG + Intronic
1161768127 19:6217844-6217866 CTGCAGGGCCCAGCCTGTGCAGG + Intronic
1161930705 19:7337589-7337611 CTGCATGCTGCAGCCTCTGGGGG + Intergenic
1162477258 19:10908069-10908091 CTCCAGGGTGTGGCCCCGGCAGG - Exonic
1164307066 19:24013068-24013090 ATACAGGGTGTAGCCTCTCAAGG - Intergenic
1164445750 19:28316241-28316263 CTGCAGGGTGCAGACTCTCAGGG + Intergenic
1164869848 19:31633528-31633550 CTCAAGGGTCTAGCCTCTGATGG + Intergenic
926503802 2:13685758-13685780 CTTCAGGGTGGAGCCTTTGGAGG - Intergenic
929819460 2:45261661-45261683 CTGCAGGGGCTGGCCTGTGCTGG + Intergenic
931436843 2:62254966-62254988 CTACTGGGTATGGCCTCTGCTGG + Intergenic
934491175 2:94762802-94762824 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
934603502 2:95677060-95677082 ATCCAGGGTTTAGCCTCTCCAGG - Intergenic
935216749 2:100980951-100980973 CAGCAGGGTGCAGCCTCTTGGGG + Intronic
935696946 2:105778306-105778328 CTGAAGGCTCCAGCCTCTGCTGG - Intronic
936088560 2:109486678-109486700 CTGCTGGGTGCAAACTCTGCAGG - Intronic
936536890 2:113319287-113319309 ATCCAGGGTTTAGCCTCTCCAGG - Intergenic
939500217 2:142975046-142975068 CTTGAGGGTGAGGCCTCTGCTGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
943119060 2:183711071-183711093 CTGCAACGTGCTGCCTCTGCTGG + Intergenic
946176212 2:217923129-217923151 CTGCAGGGGGCAGACTCTGGGGG + Intronic
947081107 2:226398108-226398130 ATGCAGGGTATAGCCCCGGCTGG - Intergenic
949034727 2:241811218-241811240 CTGCAGAGGGGAGCCTGTGCTGG + Exonic
949067960 2:242004888-242004910 CTGCAGGGTGGACCCTCGGCTGG - Intergenic
1169116517 20:3069712-3069734 CTGCTGGGAGTGCCCTCTGCAGG - Intergenic
1170927507 20:20738811-20738833 CTTCAGGGTGGAGCCTTTGTAGG - Intergenic
1170948246 20:20911346-20911368 CTGGAGGGTGGAGCCTTTGCCGG - Intergenic
1171198461 20:23222376-23222398 CTTCTGGGTGTAGCCTCTCAAGG + Intergenic
1171819765 20:29824027-29824049 CTGCACGATGTAGCCACTACTGG + Intergenic
1171880917 20:30616924-30616946 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1171882925 20:30631438-30631460 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1171898055 20:30829153-30829175 CTGCACGATGTAGCCACTACTGG - Intergenic
1174063035 20:47845818-47845840 GTGCAGGGTGGAGGCTCTGAAGG + Intergenic
1174072688 20:47909856-47909878 GTGCAGGGTGGAGGCTCTGAAGG - Intergenic
1174151381 20:48488814-48488836 GTGCAGGGTGGAGGCTCTGAAGG + Intergenic
1175700415 20:61132831-61132853 CTTGAGGGTGTTGCCTCTGGTGG + Intergenic
1175716885 20:61260934-61260956 CTGCATGGTGCATCATCTGCAGG + Intronic
1176087683 20:63305483-63305505 CTGCAAGGTGTAGCCCTTGGAGG - Exonic
1176842182 21:13850197-13850219 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1177258654 21:18700047-18700069 CTGCAGGGTGCAGCCCCTTTGGG - Intergenic
1179558055 21:42193254-42193276 CAGCAGGGTGAAGCCCCCGCGGG + Intergenic
1179643103 21:42760072-42760094 CTGCAGGGTGAAACCCCTGGTGG + Intronic
1180323767 22:11348718-11348740 CTGCACGATGTAGCCACTACTGG + Intergenic
1180987109 22:19911592-19911614 CTGCAGGCTGTGGCCTCTTTGGG + Intronic
1181460517 22:23083385-23083407 CTGCAGGGTGACCCCTTTGCAGG + Intronic
1182281279 22:29219024-29219046 CTGCAAGGTTTACCCCCTGCAGG + Intronic
1183072039 22:35403016-35403038 CAGCAGTGAGTAGCCTCTGCAGG + Intronic
1183163781 22:36132406-36132428 CTGCAGAGCCTAGGCTCTGCAGG + Intergenic
1183912586 22:41091227-41091249 AGGCAGGGTGTACCCACTGCCGG - Intergenic
1184694815 22:46133395-46133417 CTGCAGGCTGCATCATCTGCGGG - Intergenic
949984940 3:9533142-9533164 CTGCTTGCTGTAGCATCTGCTGG + Intronic
951264910 3:20553250-20553272 CTGCAGTGTGGAGGCACTGCTGG - Intergenic
951943088 3:28103718-28103740 TTGCAGGATGAATCCTCTGCAGG - Intergenic
953505573 3:43482800-43482822 TTGCAGGGTGGAGCCTAGGCTGG + Intronic
955395456 3:58554077-58554099 CTGCAGGGTACAGCCCCTGCGGG + Intergenic
956657635 3:71567817-71567839 CTTCAGGTTGTAGGCCCTGCAGG + Intronic
956717102 3:72088260-72088282 CTTGAGTGGGTAGCCTCTGCAGG - Intergenic
959376484 3:105594081-105594103 CTTGAGGGTGGAGCCTTTGCCGG + Intergenic
961502946 3:127350484-127350506 CTGCAGGCCCCAGCCTCTGCGGG + Intergenic
966833722 3:184032935-184032957 CTGCAGGGTCCACCCTGTGCTGG - Exonic
966892097 3:184414942-184414964 CTGCAGCCTTGAGCCTCTGCAGG + Intronic
966935309 3:184704247-184704269 CTTCAGGGTGGAGCCTGTGGAGG + Intergenic
967807522 3:193728870-193728892 CTGCAGGAAGCAGCCTTTGCAGG - Intergenic
968545252 4:1194849-1194871 CTGTGGGGTGAGGCCTCTGCTGG - Intronic
968729953 4:2264925-2264947 CCGCAGGGTGTGGCATCTCCAGG + Intergenic
969342549 4:6551294-6551316 CTGCAGGCTGTGGTCTGTGCTGG - Intronic
969589115 4:8111237-8111259 CTGCAGGGCATAGCCTTTCCAGG - Intronic
972161021 4:36227658-36227680 CTCCAGCGTGGAGCCTGTGCAGG + Intronic
973366605 4:49213842-49213864 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
974839531 4:67285070-67285092 CTTCAGGGTGCAGCCTTTGGAGG + Intergenic
979464599 4:121022004-121022026 TTGCAGGGTATAGCCCCTCCTGG + Intergenic
980571226 4:134622819-134622841 CTGAACGGGGTAGCCACTGCTGG + Intergenic
981159757 4:141483936-141483958 CTGCAGAGGGTTGCCACTGCTGG - Intergenic
982210147 4:153028246-153028268 TTGCAGGGTGAAGCCCCTGTGGG + Intergenic
983045974 4:162986395-162986417 CTCCAGGGTGTTGCCTCAGGAGG - Intergenic
983096060 4:163563366-163563388 CTGAATGGTTTATCCTCTGCGGG + Intronic
984024100 4:174522446-174522468 GTGCATGGTGCAGCCACTGCTGG + Exonic
984991611 4:185386701-185386723 CTGGAGGGTGTAGTCTCTTAAGG - Intronic
985575487 5:671706-671728 CCGCAGAGTGGAGCCCCTGCGGG - Intronic
985678194 5:1243064-1243086 CTGCTGGGTGCAGCGTCTGCTGG - Intronic
986977308 5:13409502-13409524 CTGCAGGGGGAAGTCTCTCCTGG - Intergenic
998071886 5:139204221-139204243 CTGCAGGTTGGAACCTCAGCTGG + Intronic
999108220 5:149092842-149092864 CTGCATTGTGGAGCCTCTCCAGG - Intergenic
999112115 5:149130566-149130588 CAGCAGAGGGTAGCATCTGCAGG + Intergenic
1000949466 5:167462853-167462875 CTGGAGGGTGGAGCGTTTGCTGG + Intronic
1001544667 5:172563584-172563606 CTGCTGGGGGTGGCCTATGCTGG - Intergenic
1001706412 5:173744269-173744291 CTGCTGGGTGTAAGCACTGCAGG - Intergenic
1001859600 5:175042229-175042251 GTGCGGGGTGTAGACGCTGCAGG - Intergenic
1002124982 5:177036154-177036176 CAGCGGGGTGGAGCCTCTGGGGG + Intronic
1003531352 6:6940151-6940173 CTGGTGGGTGTGGGCTCTGCGGG + Intergenic
1004992845 6:21158412-21158434 CTTCAGCTTTTAGCCTCTGCAGG + Intronic
1005748428 6:28861623-28861645 CTCCAGGCTGAAGCCTCTGCCGG - Intergenic
1008248409 6:49207406-49207428 TTGCAGGGTGTACCCCCTCCAGG + Intergenic
1008327196 6:50196969-50196991 CTGCAGGGGTGAGCCTCTCCAGG - Intergenic
1010624307 6:78118082-78118104 TTGCAGTGTGCAGCCTCTGATGG + Intergenic
1013556616 6:111262788-111262810 ATCCAGGGTGTAGCCTGGGCAGG - Intronic
1016684542 6:146866476-146866498 CTCCAGGGAGCAGCCTCTGGAGG - Intergenic
1016926991 6:149360999-149361021 CTGCAGGGTTCAGCCACGGCAGG + Intronic
1017131849 6:151114571-151114593 CCGCAGGGTGGGGCCTCTGTGGG - Intergenic
1017659895 6:156663670-156663692 GGGCAGGGTGTTGCCTCAGCTGG + Intergenic
1017815943 6:158016840-158016862 CTCCAGGATGTAGCCTCTAGTGG + Intronic
1018423588 6:163661283-163661305 CTGCAGCCTGCAGTCTCTGCTGG - Intergenic
1019286048 7:223651-223673 CTGCAGGCTGACCCCTCTGCAGG - Intronic
1020002743 7:4765041-4765063 CTGCACTGTCTAGCTTCTGCGGG + Exonic
1021434849 7:20602403-20602425 ATCTAGGGTGTTGCCTCTGCAGG - Intergenic
1022396639 7:29992955-29992977 CTGCAGAGAGTAACCTCTGTAGG - Intergenic
1024629818 7:51237972-51237994 CTGGAGGGTGTAGCCCTGGCAGG - Intronic
1028273628 7:88823868-88823890 CTGCATTCTGTAGCCTCTTCAGG - Intronic
1031405741 7:121384584-121384606 CTGCAAGGTGTGGCCTGAGCAGG - Intronic
1032525036 7:132573614-132573636 CTGCAGGGAGTAGCAGCAGCAGG + Intronic
1035304298 7:157921223-157921245 ATGCAGTGTGTAGCCTTTCCAGG - Intronic
1035443125 7:158920508-158920530 CTGAAGTGTGTGGCCTCTGTTGG + Intronic
1035443135 7:158920604-158920626 CTGCAGTGTGTGGCCTCCGTTGG + Intronic
1037998049 8:23367826-23367848 CTGCAGGGTGCAGCCTGAGTGGG + Intronic
1044412639 8:91901730-91901752 CTGGAGAGGGTAGCCTCTCCAGG + Intergenic
1046522988 8:115349506-115349528 CTGCAGGCTCTGACCTCTGCTGG + Intergenic
1048462353 8:134631805-134631827 GTGTAGGGTGTAGCCACTGGGGG + Intronic
1048484891 8:134838185-134838207 ATGCAGGGTCCACCCTCTGCAGG + Intergenic
1048887283 8:138918536-138918558 CTGCAGGGAGTGGCATGTGCTGG - Intergenic
1049040872 8:140110943-140110965 CTGCAGGGGGGAGCTACTGCAGG - Intronic
1049184059 8:141239792-141239814 CTGGAGGGCATGGCCTCTGCAGG + Intronic
1049253943 8:141604109-141604131 CTGGAAGGAGCAGCCTCTGCTGG + Intergenic
1049476854 8:142800942-142800964 CTGCAGGGTGTGGATGCTGCAGG + Intergenic
1049849693 8:144824180-144824202 CTGGAGGGAGCAGCCTCTCCAGG - Intergenic
1053495387 9:38545145-38545167 CTGGAGGCTGTGCCCTCTGCAGG + Intronic
1053666800 9:40322879-40322901 CTGGAGGCTGTGCCCTCTGCAGG - Intronic
1053916396 9:42947986-42948008 CTGGAGGCTGTGTCCTCTGCAGG - Intergenic
1054335171 9:63800322-63800344 CTGCACGATGTAGCCACTACTGG + Intergenic
1054377951 9:64462907-64462929 CTGGAGGCTGTGCCCTCTGCAGG - Intergenic
1054517810 9:66053404-66053426 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1055985838 9:82056155-82056177 CTGGAGGTTGTGCCCTCTGCAGG - Intergenic
1056585502 9:87924963-87924985 CTGGAGGCTGTGCCCTCTGCAGG + Intergenic
1056611379 9:88127980-88128002 CTGGAGGCTGTGCCCTCTGCAGG - Intergenic
1056708651 9:88972308-88972330 CTGCAGGGTGTATCATATCCTGG - Intergenic
1061624825 9:131835508-131835530 CTGCAGGGTGTGGAGCCTGCGGG + Intergenic
1061890548 9:133616953-133616975 CTGCAGGGTGGATCCTCAGAGGG - Intergenic
1062186281 9:135220360-135220382 CTGCAGATTTCAGCCTCTGCGGG + Intergenic
1062622920 9:137430720-137430742 CTGCAGGGAGCAGACCCTGCTGG + Intronic
1186841986 X:13493598-13493620 CTGCAGGTTCTTGACTCTGCTGG + Intergenic
1188159343 X:26781811-26781833 CTTCAGGGTGTAGCCCTTGAAGG + Intergenic
1188686929 X:33081087-33081109 CTTCAGGGTGGAGCCTTTGGAGG + Intronic
1189725280 X:43962768-43962790 CTCCAATGTGGAGCCTCTGCCGG + Intronic
1190138152 X:47816073-47816095 CTCCAGGGTGTTGCCTCAGGAGG - Intergenic
1192451916 X:71250048-71250070 CTGCAGCGAGTAGCGTCGGCGGG + Exonic
1193408852 X:81139644-81139666 CTGCACTGTGCAGCTTCTGCTGG - Intronic
1193424682 X:81327865-81327887 CTACAGGGTGGAGCCACCGCAGG + Intergenic
1193791161 X:85816366-85816388 CTTCAGGGTGTAGCCCTTGGAGG - Intergenic
1197796553 X:130304970-130304992 CTGCAGGGGGTAGTGCCTGCAGG + Intergenic
1197805375 X:130393655-130393677 CTGCAGAGTGTGCCCTCTGCTGG - Intergenic
1199421617 X:147650742-147650764 GTGCAAGGGGTAGCCTCTGAAGG - Intergenic
1199708008 X:150447737-150447759 TTCCAGGGTGTAGCCTTAGCTGG + Intronic