ID: 919858290

View in Genome Browser
Species Human (GRCh38)
Location 1:201720397-201720419
Sequence CACAGCTCCCAGATTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919858276_919858290 29 Left 919858276 1:201720345-201720367 CCTAGACCCTAGGGAGCTTCCAG 0: 1
1: 0
2: 0
3: 22
4: 237
Right 919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG 0: 1
1: 1
2: 0
3: 15
4: 167
919858278_919858290 23 Left 919858278 1:201720351-201720373 CCCTAGGGAGCTTCCAGACAGGG 0: 1
1: 0
2: 2
3: 45
4: 434
Right 919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG 0: 1
1: 1
2: 0
3: 15
4: 167
919858283_919858290 10 Left 919858283 1:201720364-201720386 CCAGACAGGGGAAGTGATAGGAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG 0: 1
1: 1
2: 0
3: 15
4: 167
919858280_919858290 22 Left 919858280 1:201720352-201720374 CCTAGGGAGCTTCCAGACAGGGG 0: 1
1: 1
2: 3
3: 27
4: 247
Right 919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG 0: 1
1: 1
2: 0
3: 15
4: 167
919858275_919858290 30 Left 919858275 1:201720344-201720366 CCCTAGACCCTAGGGAGCTTCCA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG 0: 1
1: 1
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919858290 Original CRISPR CACAGCTCCCAGATTGATGG AGG Intronic
902698854 1:18158057-18158079 GAAAGATCCCAGTTTGATGGGGG - Intronic
903376251 1:22868078-22868100 CAGAGCTCCCAAATGGATGTAGG - Intronic
903448924 1:23439515-23439537 GAGAGCTCCCAGTCTGATGGGGG + Intronic
904053527 1:27655599-27655621 CAAAGCTCACAGTTTGATGGGGG - Intergenic
904116219 1:28163914-28163936 CACAGTTCCCTGATGGATCGAGG + Intronic
904493694 1:30875318-30875340 CACAGGGCCCAGGTTGCTGGAGG - Intronic
904931637 1:34092436-34092458 CACAGCTCCCAGCGTGAGCGAGG + Intronic
907400560 1:54222447-54222469 CACAGCTTCCAGATAGCTGCAGG - Intronic
907703484 1:56812795-56812817 AACACTTCCCAGGTTGATGGGGG + Intronic
909342771 1:74550262-74550284 CACAGGTCACACAGTGATGGGGG - Intergenic
910494896 1:87815808-87815830 CAGAGCTCACAGTTTGATGAGGG - Intergenic
913198407 1:116476412-116476434 CACAGCTCCCAGGATCATGGCGG - Intergenic
915734359 1:158075352-158075374 CTCAGCTCCCACAGTGAAGGAGG + Intronic
919092346 1:192991057-192991079 CACAACTCCCATCTTGAAGGGGG + Intergenic
919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG + Intronic
920288460 1:204899000-204899022 GACAGCTCCAAGTGTGATGGGGG + Intronic
923144448 1:231188105-231188127 CACGGGTCCCAGTGTGATGGAGG - Intronic
923777619 1:236994325-236994347 CTCAGCTCCCAGAATGCTGGTGG - Intergenic
924149315 1:241111720-241111742 CACAACTCCAGGACTGATGGTGG + Intronic
924616129 1:245613473-245613495 CACACCTCCCAGCTAGTTGGGGG + Intronic
1063680727 10:8185050-8185072 CACAGCCCCCAGCTTGCAGGAGG - Intergenic
1064102498 10:12475860-12475882 CATGGCTCCCTGAGTGATGGCGG + Intronic
1069511664 10:69047327-69047349 CACATGTCCCTGATAGATGGTGG + Intergenic
1070965318 10:80526820-80526842 CAAAGCTGCCAGGCTGATGGGGG + Exonic
1075789718 10:125075298-125075320 CCCACCTCCCAGAATGATGGGGG - Intronic
1076118848 10:127920390-127920412 ACCAGTTCCCAGATTGCTGGTGG + Intronic
1077472961 11:2772868-2772890 CACCGCACCCAGATGGCTGGAGG + Intronic
1077825258 11:5800968-5800990 CATAGCTGCCATATTGATTGGGG + Intronic
1080881422 11:36324999-36325021 CAGAGCTCCCAAGATGATGGTGG + Intronic
1081748261 11:45488155-45488177 CACATCCCCCAGGCTGATGGTGG - Intergenic
1082636725 11:55604130-55604152 CACAGCCCCTAGATTAATTGTGG - Exonic
1083945743 11:65921614-65921636 CCCAGCTCCCAGTTTCATGTGGG - Intergenic
1087569540 11:99907067-99907089 AACAGCTCCTAGATTCATTGAGG + Intronic
1092103646 12:5905268-5905290 CACTGCCCCCAGGGTGATGGGGG - Intronic
1095132189 12:38556559-38556581 CAGTGATCCCTGATTGATGGAGG - Intergenic
1096660874 12:53123278-53123300 TGCAGATCCCAGACTGATGGTGG + Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1102988469 12:117297677-117297699 CACTGCACCCAGCTGGATGGTGG + Intronic
1103020926 12:117533699-117533721 CACAGCTCTGACAGTGATGGGGG + Intronic
1105300514 13:19130165-19130187 CCTAGCTACTAGATTGATGGGGG - Intergenic
1105639690 13:22249686-22249708 CACAGCTCCAGGCTTGAGGGTGG - Intergenic
1107300539 13:38961429-38961451 CACTGCTCACAGATTGAAAGAGG + Intergenic
1108126884 13:47254413-47254435 CACAGCTCCAAGAATGGTGCTGG - Intergenic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1113177884 13:107587109-107587131 CACAGCTCCCAGATAAATGAGGG + Intronic
1115505124 14:34086485-34086507 CAGAGCTCCTATATTGCTGGGGG + Intronic
1117115048 14:52502630-52502652 TACAGCTCCCAGAGTGAGCGAGG + Intronic
1118372064 14:65145664-65145686 CCCAGCTCCCATTATGATGGGGG + Intergenic
1119862319 14:77945141-77945163 CACAGTTCCCAGATGGATCCAGG - Intergenic
1121493147 14:94374241-94374263 CACAGCAACCAGACTGAAGGAGG + Intergenic
1122143536 14:99675992-99676014 CACAGCTTGCAGACTGAGGGCGG + Exonic
1122611122 14:102984226-102984248 CACTGCTCCCAGTGTGATGCAGG + Intronic
1122763526 14:104048663-104048685 CACACATCCCTGACTGATGGAGG - Intronic
1124187847 15:27545428-27545450 CACAGATCCCAGGTTCACGGTGG - Intergenic
1124645890 15:31437314-31437336 TACAGCTCCCCCATTGATGATGG + Intergenic
1125357372 15:38830698-38830720 CACAACCCCCAGATTGACGAGGG - Intergenic
1128235536 15:66064898-66064920 CAGTGCTCCCAGCCTGATGGAGG - Intronic
1128667332 15:69548076-69548098 CACAGCTCCCCCATTCCTGGTGG - Intergenic
1129444956 15:75610490-75610512 CACAGCTGACAGGATGATGGGGG + Intronic
1129884707 15:79030174-79030196 CACAGCTCCCAGCTGGGTGGAGG - Intronic
1131459294 15:92607031-92607053 CACACCTCCCAGACGGGTGGTGG - Intergenic
1131677015 15:94680898-94680920 CTCAGCTCCCAGGCTGATTGAGG + Intergenic
1131829649 15:96345879-96345901 CGCAGCCGCCAGCTTGATGGCGG + Intergenic
1202952178 15_KI270727v1_random:50430-50452 CAAAGCTCCCTGATTGATTGTGG - Intergenic
1132802975 16:1763243-1763265 CACAGCCCCCTGACTGTTGGTGG - Intronic
1135964771 16:27026739-27026761 CACAGCTCCCAACTTCATGAAGG + Intergenic
1137664448 16:50241470-50241492 CTCAGCTCCCAGGATGTTGGTGG - Intergenic
1140023016 16:71257118-71257140 CACAGAAGCCAGATTGATGGAGG + Intergenic
1143618994 17:8070502-8070524 TCCAGCACCGAGATTGATGGCGG + Intergenic
1144300140 17:13915811-13915833 GAAAGCTCACATATTGATGGGGG + Intergenic
1145062842 17:19743539-19743561 CTCAGCTGCCAGGGTGATGGGGG + Intronic
1145104951 17:20107320-20107342 CACCACTCCCAGCCTGATGGTGG - Intronic
1148912078 17:50948243-50948265 CACAGCTCCCAGACTAAAGATGG - Intergenic
1149085926 17:52716005-52716027 CACAGTTCCCACATTGCTGTAGG + Intergenic
1150127957 17:62650776-62650798 CACAGGTCCCAGTTTGCCGGGGG + Intronic
1151238138 17:72736517-72736539 CACAGGACCAAGACTGATGGAGG - Intronic
1151446097 17:74165063-74165085 CACTTCTCCCAAATTGCTGGAGG - Intergenic
1151582701 17:74989067-74989089 CACACCCCCCAGCTTGCTGGAGG - Intronic
1155398226 18:25408991-25409013 AACAGCTCTGAGATAGATGGTGG - Intergenic
1157153312 18:45240944-45240966 CACCGCGCCCAGCTTCATGGAGG + Intronic
1157234079 18:45947004-45947026 CACAGCTCCCTGCATGATGCAGG + Intronic
1160435112 18:78845647-78845669 CACAGATCCCAGATATTTGGAGG + Intergenic
1160629271 18:80234020-80234042 CACACCTCCCAGGCTGAAGGTGG + Intronic
1160757494 19:765271-765293 CAGAGATCCCAGGCTGATGGAGG + Intergenic
1161116826 19:2501874-2501896 CACAGAGCGCAGACTGATGGAGG - Intergenic
1161331722 19:3691785-3691807 CTCAGATCCCAGGTTGACGGAGG - Intronic
1162930096 19:13953259-13953281 CAGAGCTCCCAAACTGATGGGGG - Intronic
1165052503 19:33150958-33150980 CAGAGCTGCCAGTCTGATGGAGG - Intronic
1166518882 19:43465983-43466005 CAGAGCTCACAGTCTGATGGGGG + Intergenic
925197886 2:1941953-1941975 CACATCTCCCTGATGTATGGAGG + Intronic
925487582 2:4353085-4353107 CACAGCTAGCCGACTGATGGAGG - Intergenic
928015703 2:27654959-27654981 GACAGCTGCCAGATAGATGGGGG - Intronic
929444713 2:41992752-41992774 CACAGCTCTCAGCCTGGTGGTGG - Intergenic
932127103 2:69154569-69154591 CACAGTCCCCAGATTAATAGAGG + Intronic
932824591 2:74927774-74927796 GACAGCTGCCAGGTAGATGGCGG - Intergenic
935205501 2:100893322-100893344 CACATCTCCCCAATTGATGGGGG - Intronic
935270637 2:101431662-101431684 CAAAGCTCCCAGAGTCAGGGTGG - Intronic
935409770 2:102748976-102748998 CACAGATCCAAGATTACTGGAGG + Intronic
937013010 2:118578323-118578345 CACTGCACCCAGCTTGAAGGTGG + Intergenic
937704051 2:124897417-124897439 CACAGCTCCATGTTTGATAGTGG - Intronic
937975647 2:127580839-127580861 CACAGCTTCCATTTTGGTGGGGG + Intronic
939239440 2:139538912-139538934 TACAGCTCCCAGTGTGAGGGAGG - Intergenic
939695161 2:145314374-145314396 CACAGCTTCCAGTTTTAGGGTGG - Intergenic
941373857 2:164703161-164703183 CACTGCGCCCAAACTGATGGAGG - Exonic
943543925 2:189251101-189251123 AACAGCACTCAAATTGATGGGGG + Intergenic
945659218 2:212664897-212664919 CAAAGCTCCAAGAATGATGCTGG + Intergenic
946403156 2:219479372-219479394 CACAAGTCTCAGATAGATGGGGG - Intronic
948077213 2:235174305-235174327 CCCAGCTCCCAGAAGGATAGGGG - Intergenic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1173053930 20:39592888-39592910 CAAAGGTCCCAGACTGGTGGAGG + Intergenic
1174294373 20:49534467-49534489 GGCTGCTCCCAGAGTGATGGGGG + Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1176424163 21:6537725-6537747 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1178703021 21:34850188-34850210 CACAGCTTTCAGATGGATTGCGG - Intronic
1179699656 21:43146040-43146062 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1181034744 22:20164479-20164501 CACAGCGACCATAGTGATGGAGG - Intergenic
1183930895 22:41235519-41235541 CACCGCTCCCAAATTCCTGGTGG - Intronic
1185215208 22:49595220-49595242 CACAGCTGCCAGCTTGAGGATGG - Intronic
949802377 3:7917696-7917718 CACAGCTCTCTTAATGATGGGGG + Intergenic
950641503 3:14351442-14351464 CAGAGCTCACAGTTTGGTGGAGG - Intergenic
952109724 3:30108812-30108834 CACAGGTCCAGGTTTGATGGTGG - Intergenic
952165461 3:30743942-30743964 CCCAGCATCCAGACTGATGGAGG - Intronic
952932850 3:38373551-38373573 CACTGGTCCCTGATGGATGGAGG + Intronic
953611429 3:44450604-44450626 CACAGCTCCCAGCTTTGAGGTGG + Intronic
954136987 3:48586443-48586465 CACAGCTCACAGATACATGTTGG - Exonic
955781302 3:62487385-62487407 CACAGCTGCCAGAAGGATTGTGG + Intronic
961093938 3:124138810-124138832 GAGAGCTCCCAGCTTGTTGGAGG + Intronic
961921504 3:130431207-130431229 CACAGCTGACTGATTGATAGTGG + Intronic
963332402 3:143929630-143929652 CACAGCACCCAGGTAGAAGGCGG - Intergenic
967930883 3:194689188-194689210 CACAGCACCCAGAGTTGTGGAGG - Intergenic
969477576 4:7430175-7430197 CACTGTTCCCACATTGAAGGTGG + Intronic
970326805 4:14934202-14934224 CCCAGCCCCCACATTGTTGGAGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
976278439 4:83302435-83302457 TACTGCTCTCAGATTCATGGTGG - Intronic
977301900 4:95277332-95277354 CATAGCTGCCAGTTTGGTGGTGG - Intronic
978302714 4:107289763-107289785 GACAGATAGCAGATTGATGGTGG - Intergenic
979277328 4:118828517-118828539 CACAACTCCCAGAAGGTTGGGGG + Intronic
979291153 4:118980449-118980471 CACAGCTCCCAGGAGGATGCAGG - Intronic
982081363 4:151793436-151793458 CACAGCTCCCAGAATGATGGTGG + Intergenic
984729041 4:183048926-183048948 CACAGTTCTCAGATTTATGCAGG + Intergenic
988191894 5:27948210-27948232 CACAGCTCCTAGATTGGTAAAGG + Intergenic
988957338 5:36332619-36332641 CAGAGCTCCCAAGATGATGGCGG + Intergenic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
996200765 5:120669321-120669343 CATAGTTCCCTGCTTGATGGTGG + Intronic
997442639 5:133919372-133919394 CACAGCCCCCAGATTTGGGGTGG - Intergenic
998874266 5:146583590-146583612 CACAGCTCACAGATAGCGGGAGG - Intronic
999164169 5:149533725-149533747 CACTGCTCCAACATTGATAGTGG + Intronic
1001222656 5:169915396-169915418 CACTGCTCCCATTTTGCTGGTGG + Intronic
1005758138 6:28943876-28943898 CTCAGCTCCCAGATGGATCCTGG + Exonic
1006455812 6:34131126-34131148 CACCGCACCCAGTTTTATGGTGG - Intronic
1007372503 6:41435573-41435595 CAAAACTCCCACATTGATGGGGG - Intergenic
1007934982 6:45725050-45725072 AACATTTCCCACATTGATGGTGG - Intergenic
1008255817 6:49298131-49298153 CATAGCTCCAGGATTGATGGTGG + Intergenic
1011782910 6:90810140-90810162 CAAAGATCCCACATTGTTGGAGG - Intergenic
1013153183 6:107466402-107466424 CAGATGTCCCAGATTGATGAAGG + Intergenic
1013988973 6:116230883-116230905 AACAGCTCCCCGAATGAAGGAGG + Intronic
1015719621 6:136227819-136227841 CAGCACTCCCAGAGTGATGGGGG + Intergenic
1017921789 6:158879331-158879353 CTCTGCTCCCAGAATGCTGGGGG - Intronic
1022774626 7:33513134-33513156 CACATTTCCCAGAATGAAGGGGG - Intronic
1023240053 7:38134142-38134164 CACTACTTCCAGATAGATGGTGG - Intergenic
1026979586 7:74518447-74518469 GAAAGCTCCCAGTCTGATGGTGG + Intronic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1032054732 7:128675205-128675227 CACTTCTCCCAGGATGATGGAGG - Intronic
1042606437 8:70551256-70551278 CCCATCACCCAGATTGTTGGAGG + Intergenic
1042689762 8:71484819-71484841 CTCAGCTGCCAGATGGAAGGAGG - Intronic
1045666981 8:104498398-104498420 CACAGGCCCCAGATTTATTGTGG - Intronic
1046239354 8:111470878-111470900 CACAGATGACATATTGATGGAGG + Intergenic
1046711611 8:117517440-117517462 CACAGCACCCAGCCTGATGCAGG + Intergenic
1047523406 8:125613002-125613024 CTCAGCTCCCAAAATGATGATGG - Intergenic
1048552983 8:135450834-135450856 CAAAGCTCCCAGATTATTAGGGG + Intergenic
1049897390 9:120642-120664 CACAAAACCCACATTGATGGGGG + Intergenic
1052832974 9:33230516-33230538 AACAGCTCCCAGACTCATGTTGG - Intronic
1053424858 9:38004072-38004094 CACAACTCCCAGGTTCCTGGAGG + Intronic
1054443478 9:65287086-65287108 CACAAAACCCACATTGATGGGGG + Intergenic
1054486799 9:65734417-65734439 CACAAAACCCACATTGATGGGGG - Intergenic
1054687867 9:68300390-68300412 CACAAAACCCACATTGATGGGGG - Intergenic
1055432478 9:76258045-76258067 CACAGCTCCCAGGTACAGGGAGG + Intronic
1055825468 9:80318947-80318969 CACAGCACCAAGGGTGATGGTGG - Intergenic
1056841844 9:90004162-90004184 CCCAGCTCCCGGACTGCTGGGGG + Intergenic
1057437537 9:95056164-95056186 CACAGATCCCAGAGTGATAATGG + Intronic
1060556026 9:124507566-124507588 CTCAGCCCCCAGATAGATAGGGG - Intergenic
1061765794 9:132880458-132880480 CACAGCTCCCACCATGATGAGGG + Intronic
1191781947 X:64878733-64878755 TACAGCTCCCAGAATGAGTGAGG + Intergenic
1198643148 X:138778343-138778365 TACAGCTCCCAGCATGAGGGAGG + Intronic