ID: 919859640

View in Genome Browser
Species Human (GRCh38)
Location 1:201730941-201730963
Sequence TGGGGGTCCAAAGATGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919859631_919859640 14 Left 919859631 1:201730904-201730926 CCAGGCAGAGGGACTTACCTACG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 186
919859630_919859640 22 Left 919859630 1:201730896-201730918 CCAGCAGGCCAGGCAGAGGGACT 0: 1
1: 0
2: 5
3: 48
4: 515
Right 919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 186
919859635_919859640 -3 Left 919859635 1:201730921-201730943 CCTACGGAAGTGTTCAGGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919859640 Original CRISPR TGGGGGTCCAAAGATGCTGA AGG Intronic
900837971 1:5020834-5020856 TGAGGGTCCCCAGCTGCTGAAGG + Intergenic
901185841 1:7372703-7372725 TGGGGCTCCAAGGCTGCTGTGGG - Intronic
902191546 1:14766636-14766658 TGGGAAGACAAAGATGCTGAGGG + Intronic
902242116 1:15096133-15096155 TGGGTGACCAAAGATGGTGAGGG - Intronic
905365868 1:37451247-37451269 TGGGGGTCTGAAGCTGCGGAGGG + Intergenic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
912384094 1:109262782-109262804 TGGGGGAGCAAAGATGGTGGCGG - Intronic
912796165 1:112694832-112694854 TGGAGGCCCAAAGATGATGTAGG - Exonic
915457788 1:156052175-156052197 TGAAGGTCCAAAGCTGTTGAAGG - Intronic
916058658 1:161084710-161084732 TGGGGGGCCAGAGCTGCTGAGGG - Intronic
917229959 1:172825139-172825161 TGCTGGTCCAAAGATGCTTCTGG - Intergenic
918317333 1:183332920-183332942 TGGGGTTCCCAATAGGCTGATGG - Intronic
919319924 1:196022933-196022955 TTGGGATCCAAAGAAACTGAGGG - Intergenic
919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG + Intronic
920844842 1:209585038-209585060 TGGGGTTGCAAAGCTGGTGATGG + Intronic
923519941 1:234727608-234727630 TGGGAGTCCAAGGACACTGAAGG - Intergenic
923593567 1:235342105-235342127 TGGGATTCCATAGATGCTGTGGG - Exonic
923783412 1:237044812-237044834 TGGTGGTTCAGAAATGCTGATGG + Intronic
923906750 1:238393718-238393740 TTGGGGCCCACAGATGCTCAAGG + Intergenic
1066790596 10:39058444-39058466 TGGGATTCCATAGATGCTTATGG + Intergenic
1067467796 10:46514184-46514206 TGTGGGTCTTAAGATGCTTAAGG + Intergenic
1067619390 10:47870421-47870443 TGTGGGTCTTAAGATGCTTAAGG - Intergenic
1069703650 10:70443358-70443380 TTGGGTTCCAACGATGATGATGG - Intronic
1069998971 10:72362070-72362092 TGGGGGTCCAGAGGTGCAGTGGG - Intergenic
1071998558 10:91171417-91171439 TGGGGAGCCAAAGGTGATGAGGG + Intronic
1072031505 10:91526430-91526452 TGGCTGTCAGAAGATGCTGATGG + Intergenic
1073037736 10:100575982-100576004 TGGGGGGGCAAAGATGAGGAGGG - Intergenic
1073288205 10:102400866-102400888 GGAGGGGCCAAAGATGGTGAAGG + Intronic
1073422821 10:103438295-103438317 TGGGTGTCCAAGGTTGCAGATGG + Intronic
1076040708 10:127245747-127245769 AGGGGGTCTCAAAATGCTGAGGG - Intronic
1077740484 11:4840211-4840233 GGTGGGTCCAGAGATGCTGTCGG - Intronic
1078706068 11:13745424-13745446 TGAGGGTCAAAAGATGAGGAAGG - Intergenic
1080925550 11:36752435-36752457 TGGGAGTCTGGAGATGCTGAGGG + Intergenic
1081847208 11:46249269-46249291 TTGAGGTCCTGAGATGCTGAGGG - Intergenic
1082184707 11:49165015-49165037 AGTGTGTGCAAAGATGCTGAGGG - Intronic
1082591988 11:55022814-55022836 TGGGAGTGCAATGATGCTTATGG - Intergenic
1082767430 11:57180598-57180620 AGGGGGGCGAAAGATGCTGGGGG + Intergenic
1082799783 11:57406154-57406176 TGGGGCTATAAAGATGCAGAAGG - Intronic
1083613539 11:64015550-64015572 GGGGGGTCCAGAGAGGCAGATGG + Intronic
1083796814 11:65021697-65021719 TGGGAGGACAAAGGTGCTGATGG - Intronic
1084762609 11:71283478-71283500 TGGGGATTCAAAAATGATGAAGG - Intergenic
1084843955 11:71884911-71884933 TGGGGGTCCTAAGAGTCAGAGGG - Intronic
1085284323 11:75350288-75350310 TGGGGGATCAAAGATGCGCAAGG - Intronic
1085711980 11:78837478-78837500 TGGTGCTTCAAAGATTCTGATGG - Intronic
1086681634 11:89680343-89680365 AGTGTGTGCAAAGATGCTGAGGG + Intergenic
1086916061 11:92531416-92531438 TGGGGTTCCAAGGATGTGGAGGG + Intronic
1087058104 11:93953038-93953060 GGGGGGTCCAGAGATGATAAGGG - Intergenic
1089201712 11:116728526-116728548 TGGGGATGCAAAGCTGCAGATGG - Intergenic
1090651556 11:128810864-128810886 TGCGGCTCCAAAGAAGCTGGAGG - Exonic
1090790578 11:130090202-130090224 TGCGCGTCAAAAGATGCTGGTGG + Intronic
1091165909 11:133475984-133476006 TGGGAGTGCAAAGAGGATGAAGG + Intronic
1092180855 12:6445627-6445649 TGGGGGTGCAAGGAGGATGACGG + Intronic
1092537412 12:9402998-9403020 TGGGGGTCCTAACATCCTGAGGG - Intergenic
1092537568 12:9403477-9403499 TGGGGGTCCCAAGAGCCTGGGGG - Intergenic
1092538423 12:9405860-9405882 TGGGGGTCCCAAGAGCCTGGGGG - Intergenic
1092556928 12:9569385-9569407 TGGGGGTCCCAAGAGCCAGAGGG + Intergenic
1092557279 12:9570376-9570398 TGGGGGTCCCAAGAGCCTGGGGG + Intergenic
1092557307 12:9570456-9570478 TGGGGGTCCGAAGAGCCTGGAGG + Intergenic
1094009547 12:25792803-25792825 TGGTGGTCTAAAGATCGTGATGG + Intergenic
1094514083 12:31117896-31117918 TGGGGGTCCTAAGATCCTGGGGG - Intergenic
1094514159 12:31118132-31118154 TGGGGGTCCGAAGAGCCTGGGGG - Intergenic
1094514991 12:31120850-31120872 TGGGGGTCCGAAGAGCCTGGGGG - Intergenic
1094515048 12:31121011-31121033 TGGGGGTCCGAAGAGCCTGGGGG - Intergenic
1097067622 12:56332770-56332792 TGAGGGTTGAAAGATGTTGAAGG - Intronic
1098611994 12:72470160-72470182 AGGGGCTCCAAAGAGGCTGCTGG - Intronic
1100093424 12:91001113-91001135 TGAGGGTCAAAAGAGGGTGAGGG + Intronic
1103913267 12:124363420-124363442 TGGGGGTTCAAGGGTGCTGCGGG + Intronic
1104900415 12:132187099-132187121 TGGGGCTCCACGGATGCAGAAGG - Intergenic
1105577502 13:21667826-21667848 TGGGGGTCCAGGGAAACTGAAGG + Intergenic
1106882326 13:34144983-34145005 TTGGGGTGCAAAGAGGGTGAAGG - Intergenic
1108054054 13:46468288-46468310 TGGGGGTCCCAAGATCCAGGGGG - Intergenic
1109033408 13:57223450-57223472 TGGGGATCCAAAAAGGGTGAGGG + Intergenic
1109537557 13:63739286-63739308 TGGGGGTCCTAAGAGTCTGGGGG + Intergenic
1109545100 13:63834250-63834272 TGGGGGTCCTAAGAGCCGGAGGG - Intergenic
1109546403 13:63841076-63841098 TGGGGGTCCCAAGATTCGGGGGG - Intergenic
1110892086 13:80706314-80706336 TGGGGGTCCCAAGAGCCTGGGGG - Intergenic
1113606440 13:111610888-111610910 TGGGGAACCAAGGCTGCTGAAGG + Intronic
1117497759 14:56322703-56322725 TGAGGAGCCCAAGATGCTGAAGG - Intergenic
1118709502 14:68508108-68508130 AGGGGACCCAAAGATGCTGATGG + Intronic
1120213470 14:81657389-81657411 TGGAGTTCCAAAGAAACTGAAGG + Intergenic
1125135879 15:36342087-36342109 TGAGTGTCAACAGATGCTGAGGG + Intergenic
1126130793 15:45339414-45339436 TGGCGGGCCAAGGATACTGAAGG - Intergenic
1126211032 15:46100417-46100439 TGGAGGACCAGAGAAGCTGATGG + Intergenic
1126369006 15:47926215-47926237 TTGGGGTCCAAAATTGCTCATGG - Intergenic
1129993841 15:79987769-79987791 TGTGAGTACAAAGGTGCTGAGGG - Intergenic
1131117285 15:89803182-89803204 TTGGGGTCTTGAGATGCTGAAGG - Intronic
1131520507 15:93110697-93110719 TGGGGTTCCAGAGATGCTTTAGG - Intergenic
1132891993 16:2209135-2209157 CGAGGGCCCAAAGCTGCTGAGGG + Exonic
1135882197 16:26268663-26268685 TGGGTGTCCTAAGATCCAGATGG - Intergenic
1136067496 16:27768764-27768786 AGGGGCTCCCAAAATGCTGAAGG + Intronic
1142601352 17:1054527-1054549 TGGGGGCACAAAGAACCTGAGGG + Intronic
1142758301 17:2028619-2028641 TGGGGATCCAGAGAAGCTGGGGG + Intergenic
1143652235 17:8270496-8270518 CTGGGGTCCACAGATGGTGAGGG + Intergenic
1147253549 17:39167636-39167658 TGGGGCACCAAGGGTGCTGAGGG + Intergenic
1147264696 17:39227570-39227592 TGGGGGGCCTGAGGTGCTGAAGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149647666 17:58252084-58252106 TCTGGATGCAAAGATGCTGATGG - Intronic
1151352033 17:73537495-73537517 TCGGGCTCCAGAGCTGCTGATGG + Intronic
1158346358 18:56520665-56520687 AGGTGGACCAATGATGCTGAGGG + Intergenic
1158387445 18:57011973-57011995 TGGGGGTACAGACAAGCTGATGG + Intronic
1160250501 18:77199718-77199740 TGGGGGCCCCAAGCTTCTGAGGG + Intergenic
1160656733 19:276272-276294 GGGGGGACCAAAGTTTCTGAAGG + Intergenic
1161405344 19:4088381-4088403 TGGGGCTCCAATGAAGCTGCAGG + Intergenic
1166627435 19:44371762-44371784 TGAGGGACCAAAGATGGTCAAGG - Intronic
1167348828 19:48962807-48962829 TGGGGGGCCAGAGATCCAGAGGG - Intergenic
926118402 2:10227616-10227638 TGGGGGAGGGAAGATGCTGAAGG + Intergenic
926249608 2:11146842-11146864 GGTGGGTACAAAGATGCTGGAGG + Intergenic
929604992 2:43227684-43227706 TGGGGCTGCACAGACGCTGATGG + Intergenic
930702827 2:54476398-54476420 TGGTGCTTCAAAGAAGCTGATGG - Intronic
931715917 2:65028492-65028514 AGGGTGCCCACAGATGCTGAGGG - Intergenic
932860536 2:75286782-75286804 TGGGAGGGCAAAGAAGCTGAGGG + Intergenic
933173708 2:79154496-79154518 TGGGGGTCCAAAGGTGTTCCTGG + Intergenic
934863827 2:97788248-97788270 TGGGCCTCCAATGTTGCTGAAGG + Intronic
935695080 2:105764251-105764273 TGCGGATGCAAAGGTGCTGAAGG - Intronic
937271000 2:120652687-120652709 TGGGGGTACGATGATGCTGGGGG - Intergenic
938127000 2:128681658-128681680 TGGAGGTGCAGGGATGCTGAGGG + Intergenic
938546069 2:132332799-132332821 TGAGGGACCAAAGATGGTCAAGG + Intergenic
938967532 2:136401776-136401798 TGGTCTTCCAAAGATGCTGGAGG - Intergenic
939364431 2:141214103-141214125 ATGGAGCCCAAAGATGCTGAAGG + Intronic
948688689 2:239688348-239688370 TGAGGGTCCTGAGATGGTGAGGG - Intergenic
1171874932 20:30565532-30565554 TGAGGGACCAAAGATGGTCAAGG + Intergenic
1173124981 20:40328293-40328315 TTGGGGTGCAAAGTTGCTTAGGG - Intergenic
1176025117 20:62981821-62981843 TGAGGGTCAAAAGATTCTGGAGG - Intergenic
1176119755 20:63448949-63448971 TGGGGGTGCAGGGATGCTCATGG + Intronic
1177852241 21:26362439-26362461 TGGGGGTACAAAGATGAATAAGG + Intergenic
1178674357 21:34618235-34618257 TGGGGATCCACAGATGTGGAGGG - Intergenic
1178720234 21:35002297-35002319 TGGGGGTGCAAAGCTGGTGAAGG - Intronic
1180158535 21:45989158-45989180 TGGGGGCCCTAAGAAGCTGGAGG + Intronic
1181033759 22:20160277-20160299 TGGTGGGCCAGAGAAGCTGAAGG - Intergenic
1181881044 22:25980179-25980201 TGTGTGTCCAGAGATGCTCATGG + Intronic
1182921539 22:34084584-34084606 TGAGGGTCCCAAGATGCTCCTGG + Intergenic
1184646340 22:45897387-45897409 TGGGGGTGCTCAGAGGCTGATGG + Intergenic
1184659156 22:45957940-45957962 TCAGGGTCCAGAGAGGCTGAGGG - Intronic
949515069 3:4800246-4800268 TGGAGGTCAAAAAATGCTGATGG + Intronic
950657228 3:14444101-14444123 TGGAGGACCAGAGAGGCTGAGGG - Intronic
952277047 3:31887056-31887078 TGGGGGTGGGGAGATGCTGAGGG - Intronic
953474611 3:43194887-43194909 TGGGGGTGCCCAGAAGCTGAAGG + Intergenic
956602095 3:71033272-71033294 GGGGGGTCCAAAGATGGTTTTGG + Intronic
958466560 3:94467141-94467163 TAGGGGTCCAAATATTTTGATGG - Intergenic
958755787 3:98247939-98247961 TAGGGGTCCAAATATGGGGAGGG - Intergenic
960952730 3:123010137-123010159 TGGGGTTCCAAACTTCCTGAAGG - Intronic
961173632 3:124816571-124816593 TGTGGGTCCCAAGATGGTTATGG - Intronic
965663206 3:171064180-171064202 TTGGTCTCCAGAGATGCTGAAGG + Intronic
967755470 3:193163490-193163512 TGGGGATGCAAAGATGGGGAAGG + Intergenic
967870794 3:194227342-194227364 TGGGGCTCTAAAGGTGATGAGGG - Intergenic
969657403 4:8506237-8506259 TGGGTGTCACAAGCTGCTGAGGG + Intergenic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
969788226 4:9474597-9474619 TGGGGGTCCCAAGATCCAGGGGG - Intergenic
969790481 4:9491061-9491083 TGGGGGTCCTAAGAGCCAGAGGG - Intergenic
969826018 4:9758920-9758942 TGGGGGTCCTAAGAGGCAGGGGG - Intergenic
970029538 4:11659042-11659064 TGGGGGTCACAAGGTGCTCAGGG + Intergenic
975997113 4:80328514-80328536 TGGGGGTGGAGTGATGCTGAAGG + Intronic
984257672 4:177407702-177407724 TGGGGGTGAACAGGTGCTGATGG + Intergenic
985471249 5:48252-48274 TGTGGGTCCACAGGTGCTGCTGG + Intergenic
985599050 5:815847-815869 TGGGAGTCCAAGGAGGCAGAAGG - Intronic
986736890 5:10674654-10674676 CTGGGGTCCAGAGACGCTGATGG + Intergenic
986838137 5:11665044-11665066 TGAGCATCAAAAGATGCTGATGG + Intronic
987312811 5:16697171-16697193 TGGGGCTCCAAAGCTGAGGATGG + Intronic
989428740 5:41327123-41327145 AGGGGTTCCAAAGAAGGTGAAGG + Intronic
992188641 5:74268330-74268352 AGTAGGTCCAAAGCTGCTGATGG + Intergenic
992412208 5:76516996-76517018 TGGAGTTCCAAAGCAGCTGAAGG + Intronic
994374854 5:99007787-99007809 TGGGGGTGGGAAGATGCTGTAGG + Intergenic
995878988 5:116822444-116822466 TGGGGGTCACAAGGTGCTCAGGG - Intergenic
996754044 5:126917444-126917466 TGGGGGACCATTGAGGCTGAAGG + Intronic
1000026959 5:157367501-157367523 TTGGAGTCCAAAGATCCTTAAGG + Intronic
1001758829 5:174191218-174191240 TGAGGGTCCAAGGAGGTTGAGGG + Intronic
1003290057 6:4772776-4772798 TGGGGGTACAAAACTGTTGAAGG + Intronic
1003905510 6:10695527-10695549 TGGAGATGCAAAGATGCTGGAGG + Intronic
1007314768 6:40978614-40978636 TGGGGGGGCCAAGATGCTGCTGG + Intergenic
1008621934 6:53279275-53279297 TGGGGGTACATAGGTGCAGAGGG - Intronic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1018203681 6:161417111-161417133 TGTGGGTCCAGAGTTTCTGATGG + Intronic
1019119657 6:169792818-169792840 TGGGGTTCCCAAGGGGCTGACGG + Intergenic
1021395298 7:20140062-20140084 GAGAGGTCCCAAGATGCTGAAGG + Exonic
1023598759 7:41860494-41860516 AGGTGGTCAAATGATGCTGAAGG - Intergenic
1023640590 7:42253201-42253223 TGAGCCTCCCAAGATGCTGATGG - Intergenic
1032820603 7:135520955-135520977 TGGAGGTCAACACATGCTGAAGG + Intergenic
1034303165 7:150033618-150033640 TGGGGGTCCTAAGAGCCAGAGGG + Intergenic
1034303647 7:150035389-150035411 TGGGGGTCCTAAGATCCAGGGGG + Intergenic
1036601450 8:10264648-10264670 TGGGGGTCCCAAGGTGAGGAAGG + Intronic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1040114940 8:43606086-43606108 TGGGGGCCCATTGAGGCTGATGG + Intergenic
1040115157 8:43609084-43609106 TGGGAGTCCAAAGAGGCCTATGG + Intergenic
1044915683 8:97110735-97110757 TGGGGGTGCAGAGATGATGAAGG - Intronic
1046557367 8:115791132-115791154 AGTGGGTCCAAAGATGCTATGGG - Intronic
1053495035 9:38543552-38543574 TGGGGGCCAGAAGATTCTGAAGG + Intronic
1053736239 9:41104720-41104742 TGGGGGTCCGAAGAGCCAGAAGG - Intergenic
1054692134 9:68326680-68326702 TGGGGGTCCCAAGAGCCAGAAGG + Intergenic
1056534264 9:87514235-87514257 TGGGTGTCCAGAGCTGGTGAGGG + Intronic
1056864780 9:90219842-90219864 TGGGGGTCCTAAGAGCCAGAGGG - Intergenic
1056918247 9:90763044-90763066 TGGGGGTCCTAAGAGCCAGAGGG + Intergenic
1057730243 9:97602212-97602234 TGGGATCCCAAAGCTGCTGAGGG - Exonic
1057948245 9:99348550-99348572 TGTTGGACCAAAGATGCTAAAGG - Intergenic
1060423074 9:123483328-123483350 TGGTGGTCCAGAGATGCTGGGGG + Intronic
1062036349 9:134384304-134384326 TTGGGGTTCAAAGATGATGAGGG - Intronic
1187382640 X:18818969-18818991 TGAGGGTCCAAGCATGATGATGG - Intronic
1191578649 X:62735642-62735664 TGGGGGTCCATGGAGGCTTATGG - Intergenic
1193890781 X:87043911-87043933 TGTGGGCACAAAGTTGCTGATGG - Intergenic
1198911496 X:141620039-141620061 TGGGGATGCAGAGAGGCTGAAGG - Intronic