ID: 919860179

View in Genome Browser
Species Human (GRCh38)
Location 1:201734747-201734769
Sequence GGGCCTGATGGACCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919860179_919860187 18 Left 919860179 1:201734747-201734769 CCAGGTGAGGGTCCATCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 919860187 1:201734788-201734810 CTCTCCCCTACCCCTTCCTATGG 0: 1
1: 1
2: 6
3: 39
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919860179 Original CRISPR GGGCCTGATGGACCCTCACC TGG (reversed) Intronic
900653772 1:3745030-3745052 GGGCATGATGGGCCCGGACCAGG - Intergenic
901185472 1:7369975-7369997 GGGCCTGAAGTACCTTGACCCGG - Intronic
901671321 1:10857921-10857943 GGCCATGAAGGACCCACACCCGG + Intergenic
902324739 1:15692461-15692483 GGACCTGAAGGTCCCTAACCCGG + Intronic
903295688 1:22341947-22341969 GGGCCTGATGGGCCTCCCCCGGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904806008 1:33133052-33133074 GGGCCTGATGGGGCCTCCGCAGG - Intergenic
905207679 1:36352158-36352180 GGGACCGCTGGGCCCTCACCAGG + Intronic
905867776 1:41385622-41385644 GAGGCTGATGGCCCCTCCCCTGG + Intergenic
906705626 1:47893099-47893121 TGGCCAGATGGCCCCTCAGCTGG + Intronic
912318671 1:108690164-108690186 GGGCCTGCTGGATGGTCACCAGG + Intergenic
919860179 1:201734747-201734769 GGGCCTGATGGACCCTCACCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922660334 1:227424503-227424525 TTGTCTGATGGACCCTGACCAGG - Intergenic
1063501364 10:6557714-6557736 GGGGCTGGTGGAACATCACCTGG - Intronic
1067521307 10:47008788-47008810 GGGCATGCTGGGGCCTCACCAGG + Intergenic
1073484721 10:103809485-103809507 GGGCCAGATGGACCTTCTCTGGG + Intronic
1076150413 10:128157766-128157788 AGGCCTCATGGACCATCACAAGG - Intergenic
1076918876 10:133441150-133441172 GACCCTGATGTACCCTGACCTGG - Intergenic
1077406202 11:2383547-2383569 GGGCCTGAGACACCCTCCCCAGG - Intronic
1079237728 11:18701721-18701743 GGGCCACATAGACCCCCACCAGG - Exonic
1083258757 11:61511809-61511831 GGCCCTGATGGAACCCCAACAGG - Intergenic
1083878508 11:65537135-65537157 GGGGCTGAGGGAGCCTCCCCAGG + Intronic
1084267293 11:68011657-68011679 GGGCCTGGGGGACCCCCATCAGG - Intronic
1084642763 11:70435640-70435662 GGGCCTGATGGAAGTTAACCCGG + Exonic
1085703993 11:78769735-78769757 GGGCCTGATGTACCCAGGCCTGG - Intronic
1089442859 11:118531102-118531124 GGGCCCGAGGGGCCCTTACCCGG - Exonic
1089858395 11:121567287-121567309 GGGCCTCTTTGACCCTTACCAGG - Intronic
1090744656 11:129696218-129696240 GGGCCTGCTGGAGCCTGGCCTGG - Intergenic
1092184136 12:6466283-6466305 GGGCCAGGGGGACCCCCACCTGG + Exonic
1092270976 12:7023153-7023175 TGACCTAATGGACCCTCTCCTGG + Intronic
1092543079 12:9432347-9432369 GGCCCTGCAGGGCCCTCACCTGG + Intergenic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1094509940 12:31090091-31090113 GGCCCTGCAGGGCCCTCACCTGG - Exonic
1097035651 12:56121869-56121891 GGGGCTAATGGACACTCCCCTGG + Exonic
1101814623 12:108136470-108136492 GGCCCTGCAGGACCCTGACCTGG + Intronic
1102349862 12:112184378-112184400 GGGCCTGTTGGAGCCCCACGCGG - Exonic
1103924346 12:124415276-124415298 AGGCCTGCTGTGCCCTCACCTGG + Intronic
1103944354 12:124517891-124517913 GGGGCAGCTGGACCCTCCCCTGG - Intronic
1105302929 13:19151749-19151771 GGGCCTGTATGACCCTCACCGGG + Intergenic
1113149130 13:107242371-107242393 GCGCCTGCTGGGCACTCACCTGG - Intronic
1113614164 13:111669436-111669458 GGGCCTTCTGGAGCCTCGCCAGG - Intronic
1113619631 13:111754350-111754372 GGGCCTTCTGGAGCCTCGCCAGG - Intergenic
1121583885 14:95049738-95049760 GGGGCAGATGGACCCTCTGCTGG - Intergenic
1122272226 14:100573420-100573442 GGGCCTCGTGCACCCTCATCAGG + Intronic
1122970641 14:105150791-105150813 GTGCCTGCGGGACGCTCACCTGG - Intronic
1123196627 14:106623273-106623295 GGACCTGCTGGACACTCACGTGG - Intergenic
1124647922 15:31453047-31453069 GGGCTTGAGGGACCCAGACCAGG - Intergenic
1125517605 15:40331295-40331317 GGGACTGAAGGAAGCTCACCTGG + Intergenic
1125769077 15:42153223-42153245 GGGCCTGATGGGCCCTGTCACGG + Intronic
1126666452 15:51079572-51079594 GGGCCTGAGACACTCTCACCTGG + Intronic
1129456243 15:75677428-75677450 GAGAGTGATGGACCCTCAGCTGG + Intronic
1132602472 16:779831-779853 GTGGCTGAAGGACCCACACCCGG + Intronic
1132648875 16:1011557-1011579 AGGCGGGAAGGACCCTCACCTGG + Intergenic
1132891724 16:2208082-2208104 GGGCCTGCCTGCCCCTCACCCGG + Intronic
1134672847 16:16068401-16068423 GGGCCTCATGGAGCCCGACCGGG - Intronic
1136655229 16:31705585-31705607 GGGCCTGAGGAACCCAGACCAGG + Intergenic
1136691475 16:32034398-32034420 GGCCCTGCTGGACACTCACATGG + Intergenic
1136772776 16:32856621-32856643 GGGCCTGCTGGATACTCACATGG + Intergenic
1136792064 16:32977963-32977985 GGCCCTGCTGGACACTCACATGG + Intergenic
1136877753 16:33875945-33875967 GGCCCTGCTGGACACTCACATGG - Intergenic
1136897838 16:34004898-34004920 GGGCCTGCTGGATACTCACATGG - Intergenic
1139592703 16:67942382-67942404 GGGCTTGATGGAGCCACCCCAGG + Exonic
1140251164 16:73295669-73295691 GCGCCTGATGGAGGGTCACCAGG + Intergenic
1140468976 16:75204368-75204390 GGGCCTAGGGGACCCTGACCTGG + Intronic
1140473613 16:75227922-75227944 GGGCCTGGGAGACCCTAACCTGG - Intergenic
1203075201 16_KI270728v1_random:1118731-1118753 GGGCCTGCTGGATACTCACATGG + Intergenic
1203094273 16_KI270728v1_random:1239427-1239449 GGCCCTGCTGGACACTCACATGG + Intergenic
1142902220 17:3019187-3019209 GGGCCTGATTGACTCGTACCAGG + Intronic
1144717884 17:17446992-17447014 GGGCCTTCTGTGCCCTCACCTGG + Intergenic
1145397560 17:22507223-22507245 GGGCCTGTGGGAACCTCACAAGG - Intergenic
1152295932 17:79466884-79466906 GGGCCTCCTGGACCCAGACCTGG + Intronic
1152640954 17:81448987-81449009 GGGTCTCAGGGACCCTCACCTGG + Intronic
1152690599 17:81716133-81716155 CGGCCTGCTGGAGCCTCAGCTGG - Intronic
1156329657 18:36107746-36107768 TGGCCTCATTGACCCTCACATGG + Intergenic
1158045064 18:53145856-53145878 GGGACTGATGTACCTGCACCTGG + Intronic
1160733784 19:652716-652738 GGGCCTGACGGCCCCACACTCGG + Intronic
1160895868 19:1401548-1401570 GGGCCTGTTGGACCCGCCCCCGG - Exonic
1162173003 19:8805998-8806020 GGGCCTGATGACCCCTTACTAGG + Intergenic
1162401708 19:10450695-10450717 GGGGCTGAGGGACCCCCACTGGG - Intronic
1162926531 19:13933076-13933098 GGGCCTGACGGAGCTTAACCTGG - Exonic
1163690236 19:18734790-18734812 AGCCCTGACGGACCCTCCCCAGG - Intronic
1165116358 19:33531319-33531341 GGGCTTGATGGGCCCTCACTGGG - Intergenic
1165340160 19:35205602-35205624 GGGCCAGATGGACCCTACCTGGG - Intergenic
1166370250 19:42296253-42296275 GGGCTTGAAGGAACCTCCCCTGG + Intergenic
1166372539 19:42310182-42310204 GGGCAGGAGGGACGCTCACCTGG - Exonic
1167934834 19:52897501-52897523 GGGACTCACGGACTCTCACCCGG + Exonic
1168121787 19:54255858-54255880 GAGCCTGAGTCACCCTCACCTGG - Intronic
927666193 2:25034591-25034613 GGGCCAGATGCAACCTCTCCAGG - Intergenic
927692050 2:25215412-25215434 GGGCCTGGAGGAGCCTCCCCTGG - Intergenic
928028814 2:27761614-27761636 TGGCCTCATGGACCCTCCACAGG + Intergenic
929201669 2:39243658-39243680 CGCCCCGAGGGACCCTCACCGGG + Intergenic
938127445 2:128684753-128684775 AGGCCTGGGGGACCCCCACCAGG + Intergenic
939867422 2:147488577-147488599 AGACCTGATGGACCCTGAGCAGG - Intergenic
942253450 2:174067525-174067547 TGGCCTGATAGACCCTTAACGGG - Intergenic
946166829 2:217869568-217869590 TGGCCTGATGGAGTCTCCCCAGG + Intronic
1169077112 20:2768131-2768153 TGCCCTGATGCACCCTCATCTGG + Intergenic
1171316711 20:24201893-24201915 GGGCTTGCTTGACCCTGACCAGG - Intergenic
1172880470 20:38196456-38196478 GGGGCTGAGAGACCCTCATCAGG - Intergenic
1173891365 20:46513529-46513551 CGGGCTGCAGGACCCTCACCCGG + Exonic
1174867472 20:54151353-54151375 GGGACTGATGGAGAATCACCAGG + Intergenic
1175983850 20:62754623-62754645 GGGACTCATGCACCCTCAGCTGG - Intronic
1176139459 20:63538652-63538674 GGGCCTGAGGGACACTGCCCAGG - Intergenic
1179569196 21:42268064-42268086 GGGGCTGATGGGCCTTCACTGGG + Intronic
1180049246 21:45323884-45323906 GGGTCTCATTGTCCCTCACCTGG + Intergenic
1182430246 22:30294927-30294949 GGGCCTGGTGGTACCTCAGCAGG + Exonic
1182880069 22:33725430-33725452 GTTCCTGATGAACCCTCAACTGG - Intronic
1183543456 22:38443188-38443210 AGGCCTGAGGGTCCCTCTCCAGG + Intronic
1183623765 22:38989571-38989593 GGTCCTGATGGACCAGCACATGG + Exonic
1184918895 22:47591773-47591795 GGGCCTGATGGCTCCTAATCGGG - Intergenic
949829791 3:8201609-8201631 GGGCCTTATGGACCCACTTCAGG + Intergenic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
950673444 3:14540496-14540518 GGGCATGTTGGACCCTGTCCTGG - Intronic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
951780480 3:26357467-26357489 GGGCCTGAAGGATCCTCATCAGG + Intergenic
954379188 3:50210679-50210701 GTGCCTGATGAATTCTCACCAGG + Intronic
954558971 3:51539500-51539522 GGCCCTGATGCACCCTGACGAGG + Intergenic
954879563 3:53824136-53824158 GGGCCTGCTGCACCCTGTCCCGG - Intronic
963146638 3:142001298-142001320 GGGCCTACTGGAGCCACACCTGG + Intronic
969310163 4:6348287-6348309 GGAACTGATGCACCCTCACTGGG - Intronic
969609304 4:8218087-8218109 GGGCCTGAAGGCCACACACCTGG + Intronic
972630367 4:40836748-40836770 TGGCCTCCTGGACCCTTACCTGG + Intronic
975088003 4:70366644-70366666 GGGCCTCTTTGACTCTCACCAGG - Exonic
975089896 4:70389663-70389685 GGGCCTCTTTGACTCTCACCAGG - Exonic
975162464 4:71139435-71139457 TGGCCTGATAGAACCTCACCAGG - Intergenic
977758425 4:100701486-100701508 GGGCCTGCTTGTCCCACACCAGG - Intronic
978389488 4:108210093-108210115 AGGCTTGAAGGACCCTAACCTGG + Intergenic
980985908 4:139693867-139693889 GGGACTGATGGTCACTCTCCTGG + Intronic
994981193 5:106876348-106876370 GTGCCTGAAGGTCCCTTACCTGG + Intergenic
998105037 5:139462957-139462979 GAACCTGATGGACCCTCAGAAGG - Intergenic
998611351 5:143692896-143692918 GGGACAGATGCACCCTCTCCAGG - Intergenic
999298029 5:150472743-150472765 GGGCTTCAGGGACCCACACCAGG + Intergenic
999841965 5:155437769-155437791 GGGGCTGCTGGAACCACACCTGG - Intergenic
1002786894 6:408362-408384 GGGGCAGAGGGACCCACACCAGG - Exonic
1003108336 6:3232031-3232053 GTGGCTGCGGGACCCTCACCCGG + Intronic
1004266679 6:14154119-14154141 GGGCCTGATGGACAATAAGCAGG - Intergenic
1006092235 6:31634906-31634928 GAGCCAGGTGGACCCTCACAAGG - Exonic
1007616015 6:43180141-43180163 TGGCCTGAGGGCCCCTCCCCCGG - Exonic
1008601505 6:53100525-53100547 GGGCCCCAAGCACCCTCACCTGG - Exonic
1015904863 6:138107034-138107056 GCGCGTGATGGGCCCTCACAGGG - Intronic
1019653340 7:2172673-2172695 GTGCCTGATGGGCCCTCGCACGG + Intronic
1020111537 7:5450795-5450817 GCGCCTGTGGGACCCTCTCCTGG - Intronic
1024152809 7:46590012-46590034 GGGCCTGATGGTCCAGCCCCTGG + Intergenic
1025205835 7:56992954-56992976 GGGGCTGCTGGAGCCTCCCCTGG + Intergenic
1025666105 7:63583984-63584006 GGGGCTGCTGGAGCCTCCCCTGG - Intergenic
1027235875 7:76297591-76297613 GGGCCTGATAGAGCCACACCTGG + Intergenic
1029712834 7:102308903-102308925 GGGCCACTTGGACACTCACCCGG - Exonic
1031328765 7:120436633-120436655 GGGCCAGATGGCCCCCCACCTGG - Intronic
1032084509 7:128877008-128877030 TGGCCTGATGAACCCTTATCAGG + Exonic
1033599491 7:142878391-142878413 GGTCCTGTTTGACCCTCACCAGG + Intronic
1035239935 7:157523048-157523070 AGGCCTGATGGACACACACGGGG + Intergenic
1036214942 8:6871485-6871507 CGGCCTGCTGGTCCCTCGCCAGG - Intronic
1036823176 8:11955783-11955805 GGCCCTGATGGCCCCTCCGCCGG - Intergenic
1039043142 8:33426836-33426858 GGCCCTGAAGGACCCTCCCAGGG + Intronic
1040829702 8:51663261-51663283 GGGCCTGCTGGTCCATCACTGGG - Intronic
1042032069 8:64487191-64487213 GAGCCTGATGGAACCTCTCCTGG + Intergenic
1042484957 8:69338530-69338552 GAGGCTGAGGGACCCACACCGGG - Intergenic
1042492216 8:69412566-69412588 GTGGCTGATGTAGCCTCACCTGG + Intergenic
1047734592 8:127754286-127754308 CAGCCTCATGAACCCTCACCAGG + Intergenic
1048920516 8:139225780-139225802 GAGCCTGCTGGACCTTCCCCCGG + Intergenic
1048987260 8:139741192-139741214 GGGCGTGATGCCCCCTCCCCTGG + Intronic
1049256955 8:141619271-141619293 GGGCCTGAAGAACCATCACTAGG - Intergenic
1049273315 8:141707583-141707605 GGGCCTGATCACCCCTCACACGG - Intergenic
1049671653 8:143872758-143872780 GGGCCTGGTGGACCCCGCCCAGG - Exonic
1051718456 9:20009753-20009775 GGGCCAGATGCTCCCTCCCCAGG - Intergenic
1052892902 9:33720234-33720256 GGGCCTGCTGGAGCCTGGCCTGG - Intergenic
1056238361 9:84618542-84618564 GGGCCTGGTGGACCCTCCATAGG - Intergenic
1057177238 9:93009430-93009452 GGGCCTCAACCACCCTCACCTGG - Intronic
1057353102 9:94316664-94316686 GGGCCTGTTGTGCCCTCAGCTGG + Intergenic
1057654643 9:96940927-96940949 GGGCCTGTTGTGCCCTCAGCTGG - Intronic
1059648110 9:116287310-116287332 AGGGCTAATGGACCCTCACTAGG - Intronic
1061849570 9:133406498-133406520 GGGCTTGAGGGACCCAGACCAGG - Exonic
1189421454 X:40861612-40861634 GGGCCTGAGGCACCCTCTACGGG - Intergenic
1192179402 X:68907007-68907029 GGCCCAGATAGACCCTCATCTGG + Intergenic
1200178833 X:154137807-154137829 GGCCCAGATGGACTCTCAGCTGG - Intergenic