ID: 919861682

View in Genome Browser
Species Human (GRCh38)
Location 1:201742872-201742894
Sequence GCCCCTGCCCTGAGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919861677_919861682 9 Left 919861677 1:201742840-201742862 CCACACTTGCTGGATTAACCTCT 0: 1
1: 0
2: 1
3: 11
4: 117
Right 919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG 0: 1
1: 1
2: 2
3: 44
4: 363
919861675_919861682 20 Left 919861675 1:201742829-201742851 CCGCAGGCAAACCACACTTGCTG 0: 1
1: 0
2: 1
3: 17
4: 198
Right 919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG 0: 1
1: 1
2: 2
3: 44
4: 363
919861678_919861682 -9 Left 919861678 1:201742858-201742880 CCTCTTCCTGCAAAGCCCCTGCC 0: 1
1: 0
2: 5
3: 72
4: 566
Right 919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG 0: 1
1: 1
2: 2
3: 44
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919861682 Original CRISPR GCCCCTGCCCTGAGCTTGGG AGG Intronic
900115432 1:1025969-1025991 GCCCCTGCCTTGGCCTGGGGGGG + Intronic
900118687 1:1039549-1039571 GACCCTTCCCTGATCCTGGGTGG + Intronic
900175768 1:1290761-1290783 GGCCCTGCCCTTGTCTTGGGTGG - Intronic
900651552 1:3732477-3732499 GGCCCTGCCCTGAGGCTGGGAGG + Intronic
900977591 1:6026931-6026953 GCCCCTGCCTTGAACATGGATGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902220917 1:14964437-14964459 GCCGCTACCTTGAGCTTGGATGG - Intronic
902291468 1:15438321-15438343 GCCCTTTCCCTGACCTTGGGTGG - Intergenic
902806711 1:18865599-18865621 CCCCCTGCCCTGCGGTTGGATGG + Intronic
903031044 1:20464597-20464619 GCCCCTGGACTGGGCTTTGGAGG - Intergenic
903115455 1:21176029-21176051 GCCCCTGCATCGGGCTTGGGCGG - Intronic
903233601 1:21936310-21936332 TCCCCTACTCTGAGCTTAGGTGG - Intronic
903341429 1:22657149-22657171 TCCCCTCCCCAGAGGTTGGGGGG + Intronic
904336216 1:29800140-29800162 TTCCCTGCCCTGAGCTGAGGTGG - Intergenic
905174718 1:36128139-36128161 GCCCCTGCCCAGTGCTTTGCAGG + Intergenic
905223799 1:36466572-36466594 GCCCTGGCCCTGGGCTTGTGGGG + Exonic
905868692 1:41390892-41390914 GGCCCTGCAGTGAGCATGGGGGG - Intergenic
905893811 1:41532710-41532732 GCACCACCCCCGAGCTTGGGGGG + Intronic
906057916 1:42930570-42930592 GCCCCTGCCCACAGCTTCAGTGG - Intronic
906581171 1:46936259-46936281 GCCCCAGGCCAGAGCCTGGGTGG + Intronic
906602554 1:47142617-47142639 GCCCCAGGCCAGAGCCTGGGTGG - Intronic
907188761 1:52632157-52632179 GCCGCTGCCCTGACCTGGGTGGG - Intergenic
907314435 1:53559484-53559506 GCCCCTGCCCTGATCCTGCCAGG + Intronic
907457490 1:54584895-54584917 GCCCCTGCTCTGGGCCTGTGGGG - Intronic
909445353 1:75742982-75743004 GAGGCTGCTCTGAGCTTGGGAGG + Intronic
911068957 1:93817007-93817029 GCCTCTGTCCTGAGCTTGGGAGG + Intronic
915446776 1:155978596-155978618 ACCCCCTTCCTGAGCTTGGGCGG - Intronic
915585245 1:156840765-156840787 TCCCTTGCCCTGAGTTGGGGTGG + Exonic
917981121 1:180270055-180270077 CGGCCTGCCCTGATCTTGGGAGG - Intronic
918128605 1:181605675-181605697 GCCACTGCCCAGAGTCTGGGAGG + Intronic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG + Intronic
919926906 1:202196203-202196225 TCCCCTGCCCTGGGCTGGGGAGG + Intronic
920007366 1:202843264-202843286 GCCCCTGGCGTGAGCAGGGGAGG + Intergenic
920204546 1:204282105-204282127 GCCCCTGCTCTGGGCCTGGGTGG + Intronic
920496764 1:206460460-206460482 GACACTGCCCTGAGTTGGGGAGG + Intronic
922676846 1:227558704-227558726 GCCCCTTCCCCCAGCTTGGACGG - Intergenic
922722126 1:227904563-227904585 GCCCCAGCCCTGGACTGGGGAGG + Intergenic
922746861 1:228049071-228049093 GCCCCTGCCTCCAGCTTGGAAGG - Intronic
922795054 1:228335693-228335715 GCCCCTGCTCAGGGCTTCGGAGG + Intronic
923261818 1:232274953-232274975 GCCCCAGCCATGAACTTGGAAGG - Intergenic
924508617 1:244710142-244710164 GGCCCTGCCCTGATCTGGGAAGG + Intergenic
924666644 1:246080251-246080273 GCCACTGCTCTGAGCTCCGGTGG - Intronic
1062937604 10:1399937-1399959 GCATCTGGCCTGTGCTTGGGAGG + Intronic
1063371346 10:5524877-5524899 GCCCCTGCCCTGCGGTTGCCCGG - Exonic
1063498968 10:6536191-6536213 CCACCTGCACTGAGCCTGGGTGG + Intronic
1064006779 10:11705147-11705169 GCTCCTGCCCTGAGCCCGGCGGG - Intergenic
1067030714 10:42877582-42877604 GCCCCTGGACTGAGCTGGGCAGG - Intergenic
1067177290 10:43959012-43959034 CCCCCTGCCCAGCTCTTGGGAGG + Intergenic
1068431876 10:56943507-56943529 GCCTCTTCTCTGGGCTTGGGAGG - Intergenic
1070309451 10:75262753-75262775 GCCCCTGCCCAGGGCCTGCGAGG - Intergenic
1070626331 10:78053863-78053885 GCCTGAGCCCTAAGCTTGGGAGG + Intronic
1071078601 10:81783690-81783712 TCCCCTCCCCTGAGATTGGGAGG + Intergenic
1071434579 10:85635384-85635406 TCCTCTGCCCTGGGCCTGGGTGG - Intronic
1073371630 10:102995052-102995074 GCCCCTTTCCTGAGCTGGGATGG - Intronic
1076413179 10:130265965-130265987 GCCCCTGCTCTGTGCCTGGTTGG + Intergenic
1076713079 10:132349784-132349806 GCCCCTGCCCCATGGTTGGGTGG + Intronic
1076795308 10:132795296-132795318 GCACGTGCCCTGAGGCTGGGTGG + Intergenic
1077102429 11:828103-828125 GCCCCTGGCCTGGGCCTGTGTGG - Intronic
1077635989 11:3841355-3841377 GCCCCTGCCCTGAGCCCCGGGGG + Intergenic
1077889952 11:6411586-6411608 TCCCCTGCCCTGAGCTTTCTGGG + Intronic
1078780548 11:14434909-14434931 GGGCCTGCCATGAGGTTGGGGGG + Intergenic
1081591509 11:44426385-44426407 GGCCCTGCCCTGACCGAGGGTGG - Intergenic
1081807349 11:45897750-45897772 GCACCTGCCTTGACCCTGGGAGG + Intronic
1081911884 11:46705103-46705125 GCCCATGCCCTGTGTGTGGGCGG + Exonic
1082952400 11:58831124-58831146 GCCCAGGTCCTGAGCCTGGGAGG - Intergenic
1083614246 11:64018539-64018561 GGCCCTGCCCTGGGCTGGGCGGG - Intronic
1084066784 11:66708860-66708882 GGGCCTGCCCTGAGGGTGGGTGG + Intronic
1084597189 11:70123868-70123890 GTCCCTGCCCAAAGCCTGGGGGG + Intronic
1084890327 11:72233574-72233596 GACTCTGCCCTAACCTTGGGAGG + Intronic
1084947081 11:72643922-72643944 GCCCGAGCCCTGAGCCTGGCGGG + Intronic
1084978603 11:72816573-72816595 GCCTCTGCCCTGTGCCTGAGGGG - Intronic
1085020700 11:73205047-73205069 TGCCCTGGCCTGGGCTTGGGGGG + Intergenic
1085532154 11:77198229-77198251 GCCCCTGCCCTGCACTAAGGCGG - Intronic
1086722673 11:90140176-90140198 GCTCTTGCCGTGAGCTTGTGAGG - Intronic
1087233008 11:95687035-95687057 GTTCCTGACCTGAGCTTTGGAGG + Intergenic
1089463814 11:118670123-118670145 TCCCCTACCCAGAGATTGGGAGG + Intronic
1090712204 11:129397241-129397263 GCCATTGCACTCAGCTTGGGTGG + Intronic
1090719735 11:129460296-129460318 GCACGTGCACTGACCTTGGGAGG + Intergenic
1091139339 11:133222031-133222053 ATTACTGCCCTGAGCTTGGGAGG - Intronic
1091587644 12:1825300-1825322 GAAACTGGCCTGAGCTTGGGTGG + Intronic
1091589920 12:1836892-1836914 GCCCCAGCCCTGGCCCTGGGTGG - Intronic
1091909112 12:4214548-4214570 ACACCTGCAATGAGCTTGGGAGG - Intergenic
1092162871 12:6325631-6325653 GCCTCTGCCCTGAAGCTGGGAGG - Intronic
1096522047 12:52189877-52189899 GCCCCTGCCATGGGGATGGGAGG - Intronic
1096525445 12:52207463-52207485 GACCCTCCCCTGAGCCTGGCTGG - Intergenic
1096555371 12:52400501-52400523 CCCACAGCCCTGACCTTGGGTGG - Intronic
1096611138 12:52802607-52802629 GCCCCTGCCGTGCTCTTGGGTGG + Intergenic
1097224569 12:57469739-57469761 GGACCTGCCCTGAGGTTGAGAGG + Intronic
1097507262 12:60490474-60490496 GCCACTGCACTCAGCATGGGTGG - Intergenic
1100704567 12:97186295-97186317 GGCCCTGCCCTATGCATGGGAGG - Intergenic
1101883932 12:108645283-108645305 GCGCCTACTCTGAGCTTGGCTGG + Exonic
1102347709 12:112170151-112170173 GCCCCTTCCCTGAGCTCCTGAGG + Intronic
1103016433 12:117498307-117498329 GGCCCTGCCCTGAATTTGGGGGG - Intronic
1103096577 12:118136899-118136921 GCCCCAGCCGTGGGCGTGGGAGG - Intronic
1104635452 12:130435602-130435624 GCCCAAGCCCTGAGCTTGGGAGG - Intronic
1104736779 12:131139932-131139954 CCCTCTGCCCTGTCCTTGGGGGG + Exonic
1105303070 13:19152305-19152327 GCCCCACCCTTGGGCTTGGGAGG - Intergenic
1106345964 13:28877982-28878004 GCCCATGCCCTGAACTCAGGAGG - Intronic
1108510103 13:51148354-51148376 GCCCCTGCCCTCAGCAGGGGAGG + Intergenic
1113457032 13:110456724-110456746 GCCCATGCCCTGTGTCTGGGGGG + Intronic
1113480540 13:110616508-110616530 GGCCCTGCCCTGGCCTTGGCTGG + Intronic
1113513225 13:110872218-110872240 TCCCCTGCACGGAGCTGGGGTGG + Intergenic
1116938905 14:50770795-50770817 GCCACTGCCCTGGGCCAGGGTGG + Intronic
1116951311 14:50881223-50881245 GCCCCTGCCCCAAGCTTCAGGGG - Intronic
1119471460 14:74902746-74902768 GAGGCTGCTCTGAGCTTGGGAGG - Exonic
1120890167 14:89484601-89484623 ACCCCTGGCCTGGGCTTAGGAGG + Intronic
1121407165 14:93726102-93726124 TCCCCTGCCCTGGGCTTGGAGGG + Intronic
1122388477 14:101364696-101364718 GCTCCTGCCCTGGGCTCCGGGGG + Intergenic
1122691260 14:103533107-103533129 GGGCCTGCCCTGCACTTGGGTGG - Intronic
1122968923 14:105144561-105144583 GCACCTGCCCTGGACCTGGGGGG - Intronic
1123059190 14:105586779-105586801 CCCCCTGCCCTGAGCCTCGGGGG - Intergenic
1123083521 14:105707010-105707032 CCCCCTGCCCTCAGCCTCGGGGG - Intergenic
1123108183 14:105852635-105852657 GGCCCTGCCCTGTGCTGTGGGGG + Intergenic
1123684711 15:22788457-22788479 GCCACTGCACTCAGCCTGGGCGG + Intronic
1123989548 15:25673246-25673268 GCCCCTGCCCAGCGCATAGGGGG - Intergenic
1125768655 15:42151052-42151074 GGCCCTGCCCAGAGCCTGTGGGG + Intronic
1126185817 15:45829659-45829681 GCCCCAGTCCTGTGCCTGGGAGG + Intergenic
1126786134 15:52179432-52179454 CCCCCTGCCCTCCGCATGGGAGG + Intronic
1128518357 15:68358397-68358419 GCACCTGCCATGGGTTTGGGTGG + Intronic
1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG + Intergenic
1128880874 15:71241745-71241767 CCCACTGCCCTGAGGTGGGGTGG - Intronic
1129319107 15:74763958-74763980 GGCCCTGCCCAGAGTTTTGGGGG + Intergenic
1129360700 15:75022100-75022122 TCCCCTGCCCTGAGCTGAGGTGG - Intergenic
1129413097 15:75360556-75360578 CCCCCTGACCTGGGCATGGGTGG + Exonic
1131057463 15:89384071-89384093 GCCCCTCACATGAGCCTGGGAGG + Intergenic
1132578796 16:675883-675905 GCCGCTGAGCTGAGCTTGTGCGG + Intronic
1132650889 16:1021036-1021058 GCCCCTGGCGTGAGCTGGGACGG - Intergenic
1132752646 16:1465876-1465898 GCCCCTGCCCTGAGCTGGGGCGG - Intronic
1133143675 16:3767528-3767550 ACCCCTGCCCTGTGCCTGTGGGG - Intronic
1133188689 16:4117264-4117286 GCCCCGGCGCTGGGCCTGGGAGG - Intergenic
1133384329 16:5356494-5356516 TGCCCTGCCCTGTGCTTTGGGGG + Intergenic
1133453449 16:5922484-5922506 TCCTCTGCCCTGAGCTGGGCAGG - Intergenic
1133525930 16:6605678-6605700 GGCCCTGCCCAGAGCCTGGCGGG - Intronic
1134099362 16:11440812-11440834 CCCCAGGCCCTGAGCTTGGATGG - Exonic
1134893807 16:17865732-17865754 GGCACTGGCCTGAGCTTGGAAGG + Intergenic
1135324789 16:21519577-21519599 GTCCCTGCCCTGCCCTTCGGTGG - Intergenic
1135381705 16:22001176-22001198 GCCACTGCCCAGAAATTGGGCGG + Intergenic
1135741934 16:24983340-24983362 GCCACTGCACTCAGCATGGGAGG - Intronic
1136007472 16:27340901-27340923 GGCCCTGCACTGAGCCTGGCGGG + Intronic
1136336275 16:29612852-29612874 GTCCCTGCCCTGCCCTTCGGTGG - Intergenic
1136565795 16:31069393-31069415 GCCACTGCCCTGAGGTGGGAAGG - Intronic
1137057899 16:35754126-35754148 GGGCCTGCCTGGAGCTTGGGCGG + Intergenic
1137607153 16:49794500-49794522 GCCCCAGCACAGAGCTTGTGTGG - Intronic
1138335433 16:56249310-56249332 GCACCTGCCATGAACTTCGGAGG - Intronic
1138436014 16:57000459-57000481 GCCTCAGGCCTGAGCCTGGGTGG - Intronic
1139422283 16:66856124-66856146 GCCCCTGGCCTGATCTAGGTAGG + Intronic
1139475939 16:67202598-67202620 GGCCCTGAGCTGAGCTTGGGCGG + Intronic
1139547760 16:67657658-67657680 GCCCAGGCCATGAGCTGGGGAGG + Exonic
1139573469 16:67827406-67827428 GCCCCTGCCCTAGCCTTGGCTGG + Intronic
1140476829 16:75243154-75243176 GCTCCTGCCCTGCTCTGGGGAGG + Intronic
1140919140 16:79520696-79520718 GTCCCAACCCTGTGCTTGGGTGG + Intergenic
1141437002 16:84005552-84005574 GCTCCTGCTCTGAGCATGGTAGG - Intergenic
1141644567 16:85360351-85360373 GCCCCTGCCCTGCGGCCGGGTGG + Intergenic
1141912090 16:87067086-87067108 GCGCCTGCCTTGAGCATGGAGGG - Intergenic
1141950002 16:87334051-87334073 GCCTCTGCCCTGGGCTGGGCAGG + Exonic
1142036996 16:87868634-87868656 GTCCCTGCCCTGCCCTTCGGTGG - Intronic
1142185258 16:88691847-88691869 CCCCATGCCCAGAGGTTGGGGGG - Intergenic
1142307810 16:89295343-89295365 TCCGCTGACCTGAGCCTGGGCGG + Intronic
1142766262 17:2065897-2065919 GGCCCTGCCCTCCTCTTGGGAGG + Intronic
1143209488 17:5173776-5173798 TCCCCTTCCCTCAGCATGGGCGG - Exonic
1143563937 17:7710202-7710224 GCCCATGGCCTGAGCTGGGGTGG - Exonic
1144613939 17:16751599-16751621 GCCGCTGCCCTAAGGGTGGGAGG - Intronic
1144618971 17:16803232-16803254 TCCCCTTCCCTCAGCATGGGCGG - Intronic
1144857976 17:18280895-18280917 GCCCCTGGCGTCAGCTTGGTTGG - Intronic
1144875135 17:18393619-18393641 GTCCCTGCCCTGTGCTCGGAGGG - Intergenic
1144893734 17:18512462-18512484 TCCCCTTCCCTCAGCATGGGCGG + Intergenic
1144898771 17:18564072-18564094 GCCGCTGCCCTAAGGGTGGGAGG + Intergenic
1145133603 17:20381651-20381673 GCCGCTGCCCTAAGGGTGGGAGG - Intergenic
1145138490 17:20431811-20431833 TCCCCTTCCCTCAGCATGGGCGG - Intergenic
1146571128 17:33954234-33954256 GCCCCAGCCCTGAGATGGGGAGG + Intronic
1147140050 17:38455658-38455680 GCCTCAGCTCTGAGCCTGGGTGG + Intronic
1147948032 17:44091571-44091593 GGCCCTACCCAGAGCTTGGGGGG - Intronic
1148223455 17:45881622-45881644 GCAGCTGCCCTGAGTTTGGAAGG - Intergenic
1148458149 17:47821860-47821882 GCGGCTGCCCGGAGCTTGGCGGG - Intergenic
1148757890 17:49984128-49984150 ATCCCTGCCCAGATCTTGGGAGG + Intergenic
1149038547 17:52159686-52159708 GCCCCTGGCCTCGGCCTGGGTGG - Intronic
1149870647 17:60178412-60178434 TCCCCTTCCCTCAGCATGGGTGG + Intergenic
1149892705 17:60404116-60404138 TCCCATCCCTTGAGCTTGGGCGG + Intronic
1152276231 17:79359180-79359202 GCTCTTGCCCTGAGCCTGTGGGG - Intronic
1152323971 17:79624881-79624903 ACCCCTTCCTTGAGCTTGGCTGG - Intergenic
1152362021 17:79837207-79837229 CCCCCTGCCTTGAGGGTGGGTGG + Intronic
1152423607 17:80207136-80207158 GCACCTGCCGTGGGCTTTGGGGG - Intronic
1152571743 17:81124081-81124103 GCCCCCTCCCTGAGCTTTTGGGG - Intronic
1156380854 18:36559807-36559829 GCCCCTTCCCAGACCTTGGGAGG - Intronic
1157601260 18:48894453-48894475 GCCCCTGCCCTGGGGCTGGGAGG + Intergenic
1160448738 18:78947439-78947461 ACCCCTGCCCTGAGGTTGCTGGG + Intergenic
1160539230 18:79611384-79611406 GCTCCTCCCCTGACCCTGGGAGG - Intergenic
1160747851 19:720163-720185 GCCCCCGGCCTGTGCTTGGGGGG - Intronic
1160882090 19:1325525-1325547 GGCCCGGCCGTGGGCTTGGGAGG + Intergenic
1161388557 19:4009471-4009493 GACCCTGCCCTCAGCCAGGGTGG - Intronic
1161396214 19:4046072-4046094 GGCCCATCCCTGAGCTAGGGAGG + Exonic
1161937485 19:7381072-7381094 GCTCCTGCCCCCAGCATGGGGGG - Intronic
1162412581 19:10515333-10515355 GCCTCAGGCCTGAGCCTGGGGGG - Intronic
1163679108 19:18670506-18670528 GGCCCAGCACTGAGCTTGTGCGG + Exonic
1165301776 19:34974356-34974378 GCCCCATCACTGAGCATGGGTGG - Intergenic
1165323515 19:35100601-35100623 GCCCCAGCCCTGAGCTTCAGAGG + Intergenic
1165779915 19:38426233-38426255 CCCCCTGGCCTGAGGGTGGGTGG - Exonic
1166134071 19:40764895-40764917 GGCCCTGCCCTGTGCATTGGAGG + Intronic
1166196237 19:41207596-41207618 ACCCCTCCCCTGAGGCTGGGCGG + Intergenic
1166894713 19:46016230-46016252 GCCCCTGCCCTGCGGTAGGGAGG + Intronic
1167236426 19:48318679-48318701 GCCTGGGCCCTGAGCTGGGGAGG - Intronic
1167277020 19:48545015-48545037 CCGCCTGCCCTGAGCTGGGCTGG - Intergenic
1167512580 19:49903569-49903591 GCCGCTGCCCTGAGTCTGAGGGG + Intronic
1168277893 19:55287141-55287163 GCCCCTGCCCTCAGCCCCGGAGG - Intronic
1168336926 19:55602280-55602302 GCTCCTGCCCTGACTTGGGGGGG - Exonic
925327473 2:3034940-3034962 GCCCCTGCCCTGTGCTGTGTGGG + Intergenic
926120169 2:10237477-10237499 GCACCTGCCCTGGGCTCTGGGGG + Intergenic
927662560 2:25005178-25005200 GCCACTGCACTCAGCCTGGGCGG + Intergenic
927940453 2:27100068-27100090 GCCCCTCCTCTGGGCCTGGGCGG - Exonic
928898915 2:36296994-36297016 GCCCGTGCCCTCATCCTGGGGGG + Intergenic
928904326 2:36355297-36355319 GCCCCGGCCCCGAGCTTCTGGGG + Intergenic
929998709 2:46846796-46846818 GCCCCAGCCCTGGGCTCAGGGGG + Intronic
932320562 2:70819476-70819498 TCCCCAGCCCTGAGCCTGGGAGG + Intronic
933219337 2:79670104-79670126 GCCCCAGTCCTGTGCCTGGGAGG + Intronic
933523864 2:83410561-83410583 GCACCTGCCCTGAGCCAGAGAGG - Intergenic
934040270 2:88122479-88122501 GCCCCTGCCCATAGCATGGAGGG + Intergenic
934568818 2:95355249-95355271 CCCACTGCCCTGAGCTGGTGTGG + Intronic
935215939 2:100975463-100975485 GCCTCTGCCATCAGCTTGGTGGG - Exonic
936279343 2:111123818-111123840 GCCCCAGGTCTGAGCTGGGGAGG - Exonic
937631421 2:124106405-124106427 TCCTCTGCCCAGAGGTTGGGAGG - Intronic
937711903 2:124987804-124987826 GCCCCCTCCCTCAGCTTGCGGGG - Intergenic
937855063 2:126666225-126666247 GCCCCTGTAGTGACCTTGGGAGG - Intronic
937866184 2:126753230-126753252 GCCCATGCACTGAGCATGGGTGG - Intergenic
937919175 2:127118264-127118286 GACCCTTCCCTGAGGTTGGGTGG - Intergenic
938014310 2:127855108-127855130 GCCACTGCGCTTAGCCTGGGAGG - Intronic
938341060 2:130536875-130536897 GCCCCTGCCCTGGGCTTTCCCGG + Intergenic
938348770 2:130583834-130583856 GCCCCTGCCCTGGGCTTTCCCGG - Intronic
938368583 2:130755287-130755309 GGCCTTTCCCTGAGCTTGGTGGG - Intergenic
938970929 2:136431777-136431799 GTCCCAGCCCTGAGCAGGGGTGG + Intergenic
940019530 2:149142302-149142324 AGCCCTGCACTGGGCTTGGGAGG + Intronic
940919072 2:159287248-159287270 GCCCCAGCCCTGCCGTTGGGTGG + Intergenic
943669692 2:190648469-190648491 GCCTCTGCCCCGAGCCTGCGGGG + Intronic
946415290 2:219537169-219537191 GTCCCTGCCCCCAGCTTGTGTGG + Intronic
947603113 2:231466650-231466672 GCCACTGCCTTGAGACTGGGAGG - Intronic
947605063 2:231480915-231480937 GCCCCTCCCCAGGGCTGGGGTGG + Intronic
947911989 2:233807694-233807716 GCCCCTGCCCTCACCCTGGCTGG + Intronic
948558467 2:238834754-238834776 GCCCCTGCCCTGTGGTGGCGTGG - Intergenic
948648787 2:239425980-239426002 GCCCCTGCACTGGGCATTGGGGG + Intergenic
1169068362 20:2707126-2707148 CCCTCTGCCCTGGGATTGGGTGG - Intronic
1171487210 20:25493791-25493813 TTCCCTGCCCTGAGCCTGGAAGG - Intronic
1172531247 20:35632688-35632710 GCCTCTGCCCACAGCTTGGCCGG - Exonic
1172696323 20:36825608-36825630 GCCCCTGGCCTGAGCTGATGTGG - Intronic
1173224273 20:41152840-41152862 GCCCCTGGCCTGGGCCTGGTGGG + Intronic
1174353184 20:49982550-49982572 GCCCCCGCCTCGGGCTTGGGAGG - Intergenic
1174818772 20:53709792-53709814 GCCTGAGCCCTGAGCTCGGGAGG - Intergenic
1174824173 20:53754507-53754529 GCTCCTGCCCTGGGCTGTGGAGG - Intergenic
1174869548 20:54170456-54170478 GACCCTGCCGTGAGCTGGTGTGG + Intronic
1175232305 20:57481599-57481621 GCCCCTGCCCTGGGCTGTGTCGG + Intergenic
1175778741 20:61669007-61669029 GCCGCAGCCCTGAGCTTCGCTGG - Intronic
1175805550 20:61826531-61826553 GCCCCTGTGCTAAGCTAGGGCGG + Intronic
1176019390 20:62954726-62954748 GCCCCTTCTCTGAGCTGGGCAGG - Intronic
1176047418 20:63100056-63100078 GCCCCTGCCGTGGGCGTTGGAGG - Intergenic
1176383918 21:6127622-6127644 GCCCCACCTCTGATCTTGGGAGG + Intergenic
1178176214 21:30102521-30102543 GCTCCAGCCCTGAGGTTGAGTGG - Intergenic
1178422155 21:32451555-32451577 ACCCCTTTCCTAAGCTTGGGTGG + Intronic
1178430275 21:32512645-32512667 GTCCCTGGCCTGACCATGGGTGG + Intronic
1178581420 21:33841640-33841662 GCCCCCGCCCTGTGCTGGAGTGG - Intronic
1179265170 21:39796629-39796651 GCCCCAGCTCTGGGCCTGGGAGG - Intronic
1179475716 21:41642368-41642390 GCGCCTGCTCTGAGCTCTGGGGG + Intergenic
1179613664 21:42568012-42568034 GCCCCTGCCCTGAGCTGCGCCGG - Intronic
1179739556 21:43410616-43410638 GCCCCACCTCTGATCTTGGGAGG - Intergenic
1179999524 21:44989069-44989091 GCCCCTGCCCTGCCCTTGGCAGG + Intergenic
1180001938 21:44999020-44999042 ACCCCGGCCATGAGCTCGGGGGG + Intergenic
1180160399 21:45996607-45996629 GCCCCAGCCATGAGCCTGGTCGG - Intronic
1180222681 21:46369358-46369380 GCCACTGCTCCCAGCTTGGGAGG + Intronic
1181049414 22:20231535-20231557 TCCCCAGCCCTGAGCGTGGCAGG + Intergenic
1181635505 22:24172533-24172555 GCCCCTGCCCTCATCCTGGCTGG - Intronic
1181690160 22:24554876-24554898 GACCCTGCCCCGCGCTAGGGAGG + Intronic
1182296218 22:29312268-29312290 GCCCCTGCCCTGGCATGGGGGGG + Exonic
1183281895 22:36936631-36936653 GCCGCTTCCCTGAGCTGGAGGGG + Exonic
1183662642 22:39230538-39230560 GCCGCAGCCCTGACCTTGGCTGG - Intronic
1184361902 22:44024122-44024144 GCCCCTTCTCTGAGCTTGAGCGG + Intronic
1184476913 22:44726950-44726972 GCCCCTGTCCTGGTCTTTGGGGG + Intronic
1184504942 22:44894924-44894946 TCCCCTCCCCTGGGCTTCGGTGG + Intronic
1185031354 22:48444875-48444897 GCACCTGCTCTGTGCTGGGGCGG + Intergenic
1185379781 22:50503108-50503130 TCCCCTGCCCTGGGCTGTGGGGG - Exonic
951111391 3:18808560-18808582 CCACCTGCCATGAGCATGGGTGG - Intergenic
952816707 3:37452804-37452826 GTCCCAGCCCAGAGCGTGGGGGG + Intronic
954441047 3:50522076-50522098 GCCCCTGCCCCCAGCTTAGGTGG - Intergenic
954642990 3:52113272-52113294 GACCCTGCCCTGGGCCTGGGTGG + Intronic
955086176 3:55705198-55705220 GCCTCTGCCCTCAGCTGGAGGGG - Intronic
959734595 3:109643805-109643827 GCTCCTGCCATGACCTTTGGTGG - Intergenic
959882021 3:111454756-111454778 GTCCCTGCCACGGGCTTGGGTGG + Intronic
960798733 3:121515565-121515587 GCCTTTGCTCTGAGTTTGGGTGG - Intronic
961722746 3:128907364-128907386 GGCCCTTCCCTTAGCCTGGGAGG + Intronic
962236612 3:133712408-133712430 GCCACTGCCCTGTGCTGGGATGG + Intergenic
962824138 3:139083654-139083676 CCCCCTGCCATGAGCATGAGAGG + Intronic
966945837 3:184776634-184776656 GCCCCAGCCCAGAGGTTGGGCGG + Intergenic
968135303 3:196216302-196216324 GCCCCTGCCCTGGGCCGGGGTGG - Intronic
968625869 4:1626476-1626498 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968978015 4:3831792-3831814 GCACCTGCCCTGCGCATGGGTGG + Intergenic
968992940 4:3926946-3926968 ACCCATTCCCTAAGCTTGGGTGG - Intergenic
969255932 4:6001874-6001896 GCCCCAGCCCTGCCCTTGGGAGG + Intergenic
969296999 4:6276114-6276136 GCTGTGGCCCTGAGCTTGGGAGG + Intronic
969496910 4:7531434-7531456 GCCCCTGCCCTGTGCCCGTGCGG - Intronic
970555339 4:17225882-17225904 GCCACTTCCCTGAGCAGGGGAGG + Intergenic
974410747 4:61538830-61538852 GCCCCTGCCCTGACTGGGGGTGG + Intronic
976222531 4:82769204-82769226 GCCACTGCCCTGAGATTGTGAGG + Intronic
982133059 4:152247613-152247635 TCCTGTGTCCTGAGCTTGGGAGG - Intergenic
984808215 4:183770763-183770785 GCTCCTGCCCTGTGCTTGGTTGG - Intergenic
984987512 4:185345748-185345770 GCCACTGCACTCAGCCTGGGTGG + Intronic
986195917 5:5536295-5536317 GCTCCTGCCCTGACCTAGGCTGG - Intergenic
987683001 5:21161655-21161677 GCTCCTGCCAAGAACTTGGGGGG + Intergenic
994201255 5:96978801-96978823 GACCCTGCCCTGGGCTTGAGAGG - Intronic
994671984 5:102773109-102773131 GACCCAGCCCTGAGCTTAGGAGG + Intronic
997362500 5:133303977-133303999 GCTCCTGCCTGGAGCCTGGGAGG + Intronic
997577943 5:134997223-134997245 GCCCCTCGCCTGGGCTTGGGTGG + Intronic
997682073 5:135763911-135763933 GCCACTGCACTCAGCCTGGGCGG - Intergenic
997884972 5:137621874-137621896 GCCTATGCCCTGAGCAAGGGGGG - Exonic
997986507 5:138505501-138505523 GCCCCTGACCTGCTTTTGGGTGG + Intergenic
999457085 5:151725940-151725962 CCCCCTGCTCTGACCTTTGGGGG - Intergenic
1002416211 5:179122131-179122153 GCACCTGCCCCCAGCTGGGGAGG - Intronic
1002488072 5:179553197-179553219 CACCCTGCCCTGAGATTCGGAGG - Intronic
1003169866 6:3712770-3712792 GCCCCTGCCCTGTGCTCATGCGG - Intergenic
1003181896 6:3799365-3799387 GCCCATGCCCTGCCCTGGGGTGG + Intergenic
1005332241 6:24761404-24761426 GCCCAGGTCCTGAGCCTGGGAGG + Intergenic
1006373877 6:33661097-33661119 GCCCCTGCCCTGCGCTACTGGGG + Intronic
1006610384 6:35291133-35291155 GCCCCTGCCCAGGGCAGGGGTGG + Intronic
1007092037 6:39190651-39190673 GCATCTGTCCTGAGCTTGGCTGG - Exonic
1007952929 6:45888137-45888159 GCCCCTTCCCTGGGGTGGGGGGG + Intergenic
1008488071 6:52056523-52056545 GGCACTGCACTGTGCTTGGGAGG - Intronic
1009762719 6:68028508-68028530 GTCCCTGCCCTTAGGTAGGGTGG + Intergenic
1010247189 6:73672486-73672508 GCCACTGCAGTGAGCCTGGGCGG + Intergenic
1012316831 6:97791312-97791334 GTCACTGCCCTAAGCTTGGTGGG + Intergenic
1014751586 6:125262900-125262922 GCCAGTGCCCAGAGCTTGGCAGG + Exonic
1016825565 6:148385604-148385626 TCCCCTCCCCAGAGGTTGGGAGG - Intronic
1017496140 6:154985072-154985094 GCCACTGCACTCAGCCTGGGTGG + Intronic
1017745959 6:157447242-157447264 GCCCCTGTTCTGGGCTTGGAGGG + Intronic
1017963107 6:159239551-159239573 GCCCCTGCCCAAAGAGTGGGAGG - Exonic
1018958448 6:168429902-168429924 GCCCCTGTGGTGACCTTGGGTGG + Intergenic
1019644520 7:2121840-2121862 GCCCCTGCCCGGTGCTGGAGAGG - Intronic
1019712787 7:2525061-2525083 GCCCAAGCCCCGAGCTAGGGTGG + Intronic
1023809504 7:43901249-43901271 GGCTCTCCCCTGAGCTGGGGTGG + Intronic
1023869039 7:44252788-44252810 CCCCCTGCTCTGAGCTTCTGGGG - Intronic
1023888253 7:44375710-44375732 CCCCCTGCCCCTGGCTTGGGAGG - Intergenic
1024551037 7:50562478-50562500 GCCCCAGCCGTGAGCATTGGAGG + Intronic
1024598411 7:50959575-50959597 GCCCCTGCTCTGTGCTTCTGGGG + Intergenic
1024628376 7:51227752-51227774 AACATTGCCCTGAGCTTGGGAGG - Intronic
1025206496 7:56996194-56996216 GCCCCTGCCCTGTGCCTTCGGGG - Intergenic
1025665442 7:63580733-63580755 GCCCCTGCCCTGTGCCTTCGGGG + Intergenic
1026741679 7:72982784-72982806 GCGCCTGGCCTGAGCCTGGAAGG - Intergenic
1026801519 7:73403180-73403202 GCACCTGGCCTGAGCCTGGAAGG - Intergenic
1027102056 7:75382293-75382315 GCGCCTGGCCTGAGCCTGGAAGG + Intergenic
1027471949 7:78584705-78584727 AGCCCTGCACTGAGCTTGGGAGG + Intronic
1027795114 7:82683000-82683022 CACACTGCCCTGAGCATGGGAGG - Intergenic
1029465124 7:100720622-100720644 GCCCCTGCTCTGACCCCGGGTGG + Intergenic
1032015928 7:128380473-128380495 CCCCTTACCCTGTGCTTGGGTGG - Intergenic
1032096158 7:128939339-128939361 TCCCCTACCCTGACCCTGGGAGG + Intronic
1032677205 7:134142010-134142032 GGCCCTGCCCTGAGGTGGGTAGG - Intronic
1034260638 7:149753216-149753238 CCCACTGGCCTGGGCTTGGGGGG + Intergenic
1034499413 7:151440191-151440213 GCCCCTGCCCTGCCCTGGAGTGG + Intronic
1034932339 7:155172405-155172427 AGCCCTGCCCTGAGCCTGGCTGG + Intergenic
1035259367 7:157651986-157652008 GCACCTTCCCTGCGCCTGGGAGG + Intronic
1035655819 8:1303865-1303887 GCCTCTGGCCAGAGCCTGGGAGG + Intergenic
1036288082 8:7462348-7462370 CCCCATGCCCTTAGCTTTGGAGG - Intronic
1036333393 8:7849180-7849202 CCCCATGCCCTTAGCTTTGGAGG + Intronic
1039494445 8:37970022-37970044 CCCCCTGCCATCTGCTTGGGCGG - Intergenic
1039789555 8:40864104-40864126 GCACCTGACCTGTGCTTGGATGG + Intronic
1040275891 8:46013484-46013506 GACCCTGCACTGGGCCTGGGAGG - Intergenic
1041138762 8:54790215-54790237 GCCCATGCTCTGATGTTGGGTGG - Intergenic
1048012071 8:130465916-130465938 TCCCCTCACCTGAGCATGGGCGG + Intergenic
1048883984 8:138893886-138893908 GCACCTAACCTGGGCTTGGGAGG + Intronic
1049195325 8:141312671-141312693 GCCCCTGCCCTCAGCTTCCCTGG + Intergenic
1049203515 8:141352876-141352898 GCCCCTTCACTGAACCTGGGAGG - Intergenic
1049366110 8:142237671-142237693 GCCCCTTCCCAGAGCTCGGACGG + Intronic
1049372540 8:142274669-142274691 GGCCCTGCCCTGTGCCTGGGAGG - Intronic
1049412634 8:142480105-142480127 GCCCTTGCCCGGGGCTTGCGGGG + Intronic
1049417952 8:142504144-142504166 CCCCAGGCCCTGAGCTTGGAGGG + Intronic
1049679759 8:143912916-143912938 GCCGCTGACCTTAGCCTGGGTGG - Intergenic
1049783235 8:144438573-144438595 GCCCCTGCCCTGTGCTGGGTTGG - Intronic
1050646868 9:7729560-7729582 GCCCCTGGCCTCAGGTTAGGAGG - Intergenic
1052955688 9:34251682-34251704 GCCTAGGCCCTGAGCTGGGGAGG + Exonic
1053389630 9:37724964-37724986 GGACCTGCGCTGAGCTTTGGAGG + Intronic
1053600084 9:39601922-39601944 GTCCCTGACCTGAAGTTGGGTGG - Intergenic
1054253441 9:62740462-62740484 GTCCCTGACCTGAAGTTGGGTGG + Intergenic
1054787272 9:69221425-69221447 GCCCCAGCCCCGAGCCTAGGGGG + Exonic
1055814217 9:80185688-80185710 GCCCATTCCCTCAGCTTGCGGGG - Intergenic
1056704352 9:88939462-88939484 GCCCTTGCCTTGGGCTTGGATGG + Intergenic
1057077102 9:92143656-92143678 TTCCCTGCCCTGGGCTGGGGAGG + Intergenic
1057424470 9:94937098-94937120 TCCCCTCCCCGGAGATTGGGGGG + Intronic
1057704487 9:97387563-97387585 GCCAGGGTCCTGAGCTTGGGAGG - Intergenic
1057951396 9:99371543-99371565 GGCCCTGTCCTGGGCTTGGCTGG + Intergenic
1058508972 9:105695117-105695139 GCGCCAGCCCAGGGCTTGGGCGG + Intronic
1060758943 9:126232824-126232846 TCCCTTGCCCTGAACTTGGGAGG - Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1060939477 9:127535353-127535375 GCCCCTGGGCTGGGCTGGGGAGG + Intronic
1061076331 9:128343640-128343662 GGCCCTGCCCTCAGGTTGGCAGG + Intronic
1061130686 9:128706228-128706250 GCCCCTGCCCTGATCTGATGGGG + Intronic
1061130714 9:128706331-128706353 GCCCCTGCCCTGATCTGATGGGG + Intronic
1061261761 9:129484049-129484071 GCTCCTGCCCTGAGCCTCTGTGG - Intergenic
1061550107 9:131329450-131329472 GCCACGCCCCTCAGCTTGGGGGG - Intergenic
1062049766 9:134441199-134441221 GCCTGTGCCCAGAGCTAGGGTGG + Intergenic
1062426177 9:136507250-136507272 GCCCCTGCCCTGGCCATGGATGG + Intronic
1062440902 9:136568817-136568839 TCCCCTCCTCTGAGCTGGGGCGG + Intergenic
1186472962 X:9835649-9835671 GCACCTGCCCTGCCCTAGGGGGG + Intronic
1190712346 X:53079924-53079946 GCCCAGGCCCTGAGCACGGGAGG + Exonic
1190954112 X:55174659-55174681 GGGCCTGTCCAGAGCTTGGGGGG - Intronic
1191104969 X:56767100-56767122 GCCACTGCCTTGTACTTGGGCGG + Intergenic
1191250057 X:58255955-58255977 GCCCCTGCACTGTGCCTGTGGGG + Intergenic
1191259062 X:58292732-58292754 GCCCCTGCACTGAGCCCGGAAGG + Intergenic
1192193906 X:69016073-69016095 GCCCCTCCCCTGAGCCTTGTGGG - Intergenic
1193925211 X:87476105-87476127 GCACCTACCCTGGGCTTGAGGGG - Intergenic
1195285124 X:103376560-103376582 CCCGCTGCCCTGAGCTCGGCGGG + Exonic
1196550471 X:117017900-117017922 GCACCAGCCCTGACCTTGGGTGG - Intergenic
1197210470 X:123824188-123824210 GCCCCTTCCCAGAGCTGGGTGGG - Intergenic
1197363193 X:125532633-125532655 GCACCTGCCCTGAGCCAGAGGGG - Intergenic
1198036249 X:132804191-132804213 GCTTCTTCTCTGAGCTTGGGAGG + Intronic
1199972405 X:152871029-152871051 GGCCCTGCCCTGCGCTTCAGTGG + Intergenic
1200144374 X:153918955-153918977 GCCCAGGCCCTGCACTTGGGAGG + Exonic