ID: 919865236

View in Genome Browser
Species Human (GRCh38)
Location 1:201776877-201776899
Sequence CTAATGATGTGCCTTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 8, 3: 43, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919865236_919865239 18 Left 919865236 1:201776877-201776899 CCCACACCAAGGCACATCATTAG 0: 1
1: 1
2: 8
3: 43
4: 239
Right 919865239 1:201776918-201776940 GAAGATGCTAAAAGTTCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 167
919865236_919865240 19 Left 919865236 1:201776877-201776899 CCCACACCAAGGCACATCATTAG 0: 1
1: 1
2: 8
3: 43
4: 239
Right 919865240 1:201776919-201776941 AAGATGCTAAAAGTTCCAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 196
919865236_919865241 20 Left 919865236 1:201776877-201776899 CCCACACCAAGGCACATCATTAG 0: 1
1: 1
2: 8
3: 43
4: 239
Right 919865241 1:201776920-201776942 AGATGCTAAAAGTTCCAGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919865236 Original CRISPR CTAATGATGTGCCTTGGTGT GGG (reversed) Intronic
901554358 1:10019739-10019761 CTAATGATGTGACTCAGGGTTGG - Intergenic
905685905 1:39908075-39908097 TCAATGATGTGCCTTGGTGTGGG + Intergenic
905820931 1:40990342-40990364 ACAATAATATGCCTTGGTGTAGG - Intronic
906301471 1:44685168-44685190 ATAATGATATGCTTTGGTGAAGG - Intronic
906928141 1:50141239-50141261 CAAATAAGCTGCCTTGGTGTGGG + Intronic
907685447 1:56607157-56607179 TTTATTATGTGCCTTGGTTTGGG - Intronic
910144824 1:84067573-84067595 CTAATCATTTGCCTTGCTCTGGG + Intergenic
912665905 1:111579264-111579286 CTAATAAGGTGACTTAGTGTGGG - Intronic
912883607 1:113445289-113445311 ATGATTATGTGCCTTGGTGTGGG - Intronic
912972400 1:114296109-114296131 ATGATTATGAGCCTTGGTGTGGG - Intergenic
913081645 1:115393949-115393971 CTAATGATGTGCCTCTATTTGGG + Intergenic
916268475 1:162916465-162916487 ATAATTATGTGTCTTGGGGTTGG + Intergenic
916536600 1:165709367-165709389 GAAATGCTGAGCCTTGGTGTAGG + Intergenic
917107377 1:171506402-171506424 ATTATGATGGGCTTTGGTGTGGG + Intronic
917698445 1:177554922-177554944 AGTATTATGTGCCTTGGTGTGGG - Intergenic
919096514 1:193043622-193043644 CTAATAATGTGACTTAGGGTGGG + Intronic
919865236 1:201776877-201776899 CTAATGATGTGCCTTGGTGTGGG - Intronic
922965280 1:229685264-229685286 CTTATAATGTGTCTAGGTGTGGG + Intergenic
1063073185 10:2687956-2687978 CTAAAGACGTGCCTTGCTTTTGG + Intergenic
1064848276 10:19681107-19681129 CTGATTATGTGTCTTGGGGTTGG + Intronic
1065213887 10:23431256-23431278 CTAATGAGGTGACTTAGGGTGGG - Intergenic
1065711275 10:28520660-28520682 ATTATGATGTGTCTTGGTGTGGG + Intergenic
1065920559 10:30388841-30388863 CCAATGATGTGCCTTGTTGTAGG - Intergenic
1069982900 10:72264692-72264714 CAAATGATGAGCCTGGGTTTGGG + Intergenic
1070202290 10:74218544-74218566 ACAATTATGTGTCTTGGTGTTGG - Intronic
1070613650 10:77952105-77952127 ATAATGATTTGTCTTGATGTTGG + Intergenic
1070850037 10:79556313-79556335 CTTAGGATGTGTCTTGGGGTGGG - Exonic
1071299274 10:84244542-84244564 CTAGTTATGCGCCTTGGAGTGGG - Intergenic
1071720135 10:88135432-88135454 CTGATGAGGTACCTTGCTGTAGG + Intergenic
1072437363 10:95426437-95426459 CCAATTATGTGACTTGGGGTGGG + Intronic
1072772863 10:98157209-98157231 ACAGTGATGTGCTTTGGTGTGGG + Intronic
1073820314 10:107254649-107254671 ACTATGATGTGTCTTGGTGTGGG - Intergenic
1074911279 10:117911608-117911630 CTAATGAAGTGACTTAGGGTAGG - Intergenic
1075234280 10:120712325-120712347 CTTATGCTGTGCCTTGGAGCAGG + Intergenic
1075595818 10:123728277-123728299 CTAACTGTGTGCCTTGGTTTGGG - Intronic
1076555042 10:131316055-131316077 CTACTCATCTGCCTTGGTGAAGG - Intergenic
1077668988 11:4140150-4140172 ATTATAATGTGTCTTGGTGTGGG + Intergenic
1078165600 11:8881205-8881227 ATAGTGATGTGCCTTAGTATGGG + Intronic
1078204800 11:9219243-9219265 ATCATGACGTGTCTTGGTGTGGG - Intronic
1078395675 11:10979913-10979935 ACAATGATGTGCTTTGGTTTGGG + Intergenic
1079285844 11:19131331-19131353 ATTATGATATGTCTTGGTGTAGG + Intronic
1080446238 11:32339519-32339541 AGAATGATGTTCCTTTGTGTAGG - Intergenic
1080480685 11:32646677-32646699 ATAATGATATGCATTGGTATTGG + Intronic
1080492652 11:32783088-32783110 CCAATGATGTGTCTTGGTGCTGG - Intronic
1080907629 11:36562540-36562562 CTAATGTTGAGCTGTGGTGTGGG - Intronic
1082878095 11:58008864-58008886 ACAAGGATATGCCTTGGTGTAGG - Intergenic
1083549742 11:63578346-63578368 ATAGTAATGTGCCTTTGTGTAGG - Intronic
1084487250 11:69455804-69455826 CTAATTCTGTGACTTGGGGTGGG + Intergenic
1084755375 11:71235163-71235185 CTAATGAGGTGACTTAGGGTGGG + Intronic
1084886343 11:72210125-72210147 ATTATGATGTGTCTCGGTGTGGG - Intergenic
1085857846 11:80196234-80196256 CTAATGAGGTGACTTAGGGTGGG + Intergenic
1088616667 11:111636945-111636967 CCAATGATGTGCTTTGGTGTGGG + Intronic
1089208088 11:116781345-116781367 TTCAGGGTGTGCCTTGGTGTGGG - Intronic
1089481694 11:118810850-118810872 TTGATGATGTGCCTTGCTGTGGG - Intergenic
1090661223 11:128883128-128883150 ACAACGATGTGCCTTGGTGTGGG - Intergenic
1091164210 11:133457046-133457068 ATAATAATGTGTCTTGGGGTTGG - Intronic
1094117509 12:26933370-26933392 TCAGTGGTGTGCCTTGGTGTTGG - Intronic
1095150684 12:38792747-38792769 GTTTTGATGTGCTTTGGTGTTGG - Intronic
1095248025 12:39945319-39945341 CTGATAATGTGCCTAGGTGAAGG + Intronic
1095599444 12:43998747-43998769 TTAATGATGTCCCTTGATGAAGG - Intronic
1095796716 12:46226983-46227005 ACAATGACGTGCCTTGATGTGGG - Intronic
1095844983 12:46734900-46734922 CTGAAGATCTGCCTTGGTGTGGG - Intergenic
1097257616 12:57692183-57692205 ATAATGATGTGTCTTGGTGTGGG + Intergenic
1097851325 12:64413152-64413174 TTAATGAGGTAACTTGGTGTGGG - Intronic
1098500342 12:71184976-71184998 CTCAGGATCTGCCTTGATGTGGG - Intronic
1098562833 12:71896279-71896301 CTTATGATGTTCCTGGGGGTTGG + Intronic
1098826783 12:75306679-75306701 CTGATGATGTGTATTGGGGTAGG + Intronic
1099283636 12:80686784-80686806 ATCATGATATGCCTTGGTATAGG - Intergenic
1099941634 12:89196037-89196059 ATAATGTTGTGTATTGGTGTGGG - Intergenic
1101116866 12:101540637-101540659 ATAATAATGTGACTTGGTATAGG + Intergenic
1101175093 12:102141951-102141973 ATAATTATGTGTCTTGGAGTTGG + Intronic
1101249629 12:102919161-102919183 CCAGTGCAGTGCCTTGGTGTTGG - Intronic
1101336190 12:103799138-103799160 CTAATGACTTGCTTTGGGGTGGG + Intronic
1101336468 12:103801349-103801371 CTAATGACTTGCTTTGGGGTGGG + Intronic
1102845740 12:116180480-116180502 ATAATGATGTGTCTTGGGGATGG - Intronic
1103126336 12:118425887-118425909 ATGATGATGGGCCTTGGTGTGGG + Intergenic
1105569704 13:21590122-21590144 CTGATTATGTGTCTTGGGGTTGG - Intronic
1105960517 13:25331201-25331223 CTAATAATGCACTTTGGTGTAGG - Intronic
1106282230 13:28285484-28285506 ACAGTGATGTTCCTTGGTGTAGG + Intronic
1106895644 13:34298804-34298826 ATAATAATGTGTCTTGGTGTAGG + Intergenic
1107362179 13:39631439-39631461 CTTATTATGTGCCTTGGTGTGGG + Intergenic
1110352395 13:74523994-74524016 CTATTGATGTGCCTAGGTGTGGG - Intergenic
1112343184 13:98569063-98569085 ACAATGATGTGGCTTGGAGTGGG - Intronic
1112409757 13:99152881-99152903 CTCATGATGTGCATTGAAGTTGG - Intergenic
1112545572 13:100366054-100366076 ATAAAGATGTAACTTGGTGTGGG + Intronic
1112867741 13:103927628-103927650 ATAATAATGTGCCTTAGTGTGGG - Intergenic
1114911850 14:27209923-27209945 AGAATGATGTGCCTTACTGTGGG + Intergenic
1116907432 14:50417645-50417667 GTAATGATGTGCTTTGGTAAAGG + Intergenic
1119796608 14:77403735-77403757 TTTATGATGTGCCATGATGTAGG - Intronic
1120106452 14:80501196-80501218 GTGATGATGTGCCTCAGTGTGGG - Intronic
1121193688 14:92051538-92051560 ATAATGGTGTGCTTTGATGTGGG + Exonic
1121300102 14:92863224-92863246 CTAATGATGTCCATTGCTTTGGG + Intergenic
1121566185 14:94911158-94911180 TTTATGATGTGTCTTGGTGAGGG - Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1127203444 15:56684907-56684929 ATAATGATATAACTTGGTGTTGG - Intronic
1127408834 15:58684357-58684379 CTAATGAGGTGACTTAGAGTGGG + Intronic
1128482031 15:68047483-68047505 CTAATGAGGTGACATGGAGTGGG + Intergenic
1128482188 15:68048571-68048593 CTAATGAGGTGACATGGAGTGGG - Intergenic
1128485446 15:68081921-68081943 ACAATGTTGTGCCTTGGGGTTGG - Intronic
1129084103 15:73070166-73070188 CTAATGCTTTGCCATGATGTAGG + Intronic
1129405080 15:75311767-75311789 CTAATGATGTGCCTTGCTGTAGG + Intergenic
1129430095 15:75494326-75494348 ACAATGATGTGCCTTAGTGTAGG - Intronic
1129478752 15:75806665-75806687 CCAATGCTGTGCCTTGCTGTAGG + Intergenic
1129836873 15:78714177-78714199 TCAATGATGTGCCTTGTTGTAGG + Intronic
1130175302 15:81562702-81562724 CAAATGATGTGCCTGGCTGTGGG + Intergenic
1130425035 15:83788663-83788685 CTAACGTTATGCCTTGGTGTGGG + Intronic
1130510339 15:84583676-84583698 CCAATGATGTGCCTTGTTGTAGG - Intergenic
1130962552 15:88672526-88672548 ATAGTGATGTCCCTTGGTGTGGG - Intergenic
1131319314 15:91370865-91370887 AAGATGATGTGCCTTGGTGTGGG + Intergenic
1131955137 15:97727513-97727535 CCAAGGATGTGACTTTGTGTAGG + Intergenic
1131966143 15:97845337-97845359 ATAATGATGTGCCTTAATGTAGG + Intergenic
1137415876 16:48278728-48278750 CTAATAATCTGCCTTGGCATGGG + Intronic
1139141685 16:64271103-64271125 TTTATAATGTGTCTTGGTGTGGG - Intergenic
1142555988 17:777838-777860 CTAATGAAGTGACTTAGAGTGGG + Intronic
1144034944 17:11356614-11356636 CTAATGCTGTGTCTGGGTGGAGG + Intronic
1145760100 17:27420860-27420882 CTAATGGGGCCCCTTGGTGTGGG - Intergenic
1149929774 17:60740050-60740072 AAAATGGTATGCCTTGGTGTAGG + Intronic
1155324088 18:24648649-24648671 CTAATGATTTGTCTTTGTTTTGG + Intergenic
1157591388 18:48838220-48838242 CTGTTGATGTGCCGGGGTGTTGG - Intronic
1159093677 18:63877298-63877320 ACAGTGATGTGCCTTGGGGTGGG - Intronic
1159237109 18:65690783-65690805 CTTATGATGTTCCTTTGTATGGG + Intergenic
1161690599 19:5731125-5731147 CTAAGGGTGTGCTTTGGTTTAGG - Intronic
1164313056 19:24063094-24063116 CAAATTATGTGCCTTAGTCTAGG - Intronic
1164449416 19:28347564-28347586 ATAATGATGTGCATTCATGTGGG - Intergenic
1164948220 19:32313969-32313991 CTAATGATGTAGCTTAGTCTGGG - Intergenic
1165733221 19:38159507-38159529 CTAATGATGGGCCGTGGGCTTGG - Intronic
925801749 2:7608629-7608651 CAAATGTTGTGGCTTGGTCTTGG - Intergenic
930030148 2:47053485-47053507 TGAATGATTTGCCTTGGTTTTGG + Intronic
930284226 2:49408055-49408077 TTCATGATGTGCCTTTTTGTGGG + Intergenic
930725656 2:54678876-54678898 TTAATCACGTGCCTTGGTGCAGG + Intergenic
930917511 2:56711835-56711857 ACAATGATGTGCCTTGGAGTTGG + Intergenic
932801461 2:74745916-74745938 CAAGTTATGTGCCCTGGTGTGGG + Intergenic
932804198 2:74768859-74768881 CTAATGATCTGCCTGGGGCTGGG - Intergenic
932897553 2:75656712-75656734 ATGATGATGTGTCTTGGTGTGGG + Exonic
933768036 2:85724183-85724205 ACAATGATGTGTCTTGCTGTAGG + Intergenic
935610465 2:105018662-105018684 ATTATAATTTGCCTTGGTGTGGG - Intergenic
936549170 2:113420402-113420424 CAAATAATGTGCCTTGGGATGGG - Intergenic
937884534 2:126890804-126890826 CTTATGATGTGGCCTGGTGGGGG - Intergenic
938059795 2:128243880-128243902 TAAATGATATGCCTAGGTGTGGG - Intronic
940024741 2:149194018-149194040 TTAATGATGTGCTTTAGTGATGG + Intronic
940877500 2:158912690-158912712 ATAGTGATGTGCCCTGGTATAGG + Intergenic
942100668 2:172579744-172579766 TCAGTGATGTGACTTGGTGTGGG + Intronic
942175719 2:173332552-173332574 CTATTTATGTGCCTTCCTGTGGG + Intergenic
942256536 2:174106889-174106911 CTCATGATGTGCTTTGCTGCTGG + Intronic
942257677 2:174121542-174121564 CTAATGATCTGGCTTGGGGTTGG - Intronic
943661852 2:190567451-190567473 TCAATGATGTGCCTTGGTGTGGG - Intergenic
943822477 2:192344169-192344191 ATAATTATATGCCTAGGTGTAGG + Intergenic
944048400 2:195439298-195439320 CTAATGAGGTGACTTAGGGTGGG - Intergenic
944083925 2:195821963-195821985 CTGAGGAGGTGCCTAGGTGTGGG - Intronic
947064414 2:226205862-226205884 ATAATGATGTGCACTGGAGTGGG + Intergenic
947276703 2:228400263-228400285 TTAACTATGTGCCTTGGTGATGG + Intergenic
1169271963 20:4207515-4207537 CTAATGAGGTGACTTAGGGTTGG + Intergenic
1169320387 20:4627707-4627729 ATTATGATATGTCTTGGTGTAGG - Intergenic
1171435473 20:25119585-25119607 CTGATGATGTTCCTTGATGTTGG - Intergenic
1171940644 20:31325778-31325800 ATAATTATGTGCTCTGGTGTTGG - Intergenic
1173774708 20:45694738-45694760 CTAATGAGGTTACTTGGAGTGGG + Intronic
1174541092 20:51290047-51290069 CTAATGATGCACCCCGGTGTGGG - Intergenic
1175629955 20:60527469-60527491 TAAATGATGTGCATGGGTGTGGG - Intergenic
1175727183 20:61326724-61326746 CAATTGATGTGACCTGGTGTGGG - Intronic
1177036387 21:16048402-16048424 CTAATGATGTGCCTTGGGCCTGG + Intergenic
1178052911 21:28767727-28767749 CAGTTGATGTGCCTTGGGGTAGG + Intergenic
1180003405 21:45005918-45005940 ATTATGATGTGTCTGGGTGTGGG + Intergenic
1180756101 22:18162539-18162561 ATTATGATGTGTCTTGATGTGGG + Intronic
1181075665 22:20374871-20374893 ATTATGATGTGTCTTGATGTGGG - Intronic
1182133913 22:27882996-27883018 CCAAAGATGTGTTTTGGTGTGGG - Intronic
1182407566 22:30149985-30150007 ATAATGGTGTCCCTTGATGTAGG + Intronic
1182839816 22:33379811-33379833 CTAATGAGGTGTCTTAGAGTAGG - Intronic
949119430 3:367994-368016 CCACTGATGGGCCTTGGTATCGG + Intronic
953304881 3:41819424-41819446 CTAATGAGGTGCCTTCGGGAAGG - Exonic
953501463 3:43439070-43439092 ATTATAATGTGTCTTGGTGTAGG - Intronic
953688759 3:45099461-45099483 ACAATACTGTGCCTTGGTGTGGG + Intronic
954829161 3:53403917-53403939 TTAATTATGTGTCTTGGTGTAGG - Intergenic
956339227 3:68203249-68203271 AAAATGATGTGCCTAGGTGTAGG + Intronic
957129679 3:76206836-76206858 TTAATGATGTGCCTAGCTGTGGG - Intronic
959153053 3:102630550-102630572 CTAATGAGGTGACTTGGACTGGG - Intergenic
959365461 3:105452471-105452493 CTATTGATGGGCATTTGTGTTGG + Intronic
960653404 3:119977294-119977316 ATAATGATGTTCCTTGCAGTGGG - Intronic
960800585 3:121535210-121535232 ATACTGATGTGTGTTGGTGTTGG - Intronic
960926870 3:122803127-122803149 ACCATGATGTGCCTTGGTGTAGG - Intronic
961323566 3:126095949-126095971 CAAATGATATGGCTTGTTGTAGG + Intronic
961850056 3:129807538-129807560 ACAATGATGGGCCTTGGTGTGGG - Intronic
961948840 3:130723743-130723765 CTGATGATTTGCCTTGCTGTGGG - Intronic
965340581 3:167485929-167485951 CTAACTATGTGCCTTGGGGATGG - Intronic
965427238 3:168542087-168542109 ATAATGTTGTGTCTTGGTGTGGG + Intergenic
966524491 3:180906085-180906107 TTCTTGATGTGCTTTGGTGTGGG + Intronic
966700926 3:182849940-182849962 ACCATGATGTGCTTTGGTGTGGG - Intronic
966731721 3:183157000-183157022 ATAATGATGATCCTTGGTGAGGG + Intronic
970358115 4:15278489-15278511 TAAATGATTTGCCTTGGTGCAGG - Intergenic
972244759 4:37234135-37234157 CTAATGATGAGCCTTGCTCCTGG + Intergenic
972405600 4:38743712-38743734 ATAATGATGTGTCTTGGTATGGG - Intergenic
973173962 4:47180973-47180995 ATTATAATGTGCCTTGGTATGGG + Intronic
973877796 4:55238727-55238749 GTTATGATGTGTCTTGGTATGGG + Intergenic
974854190 4:67439930-67439952 AAAATGATGTGCCTAGGTGTAGG - Intergenic
975488458 4:74961492-74961514 ATTATAATGTGCTTTGGTGTGGG - Intronic
978358464 4:107902996-107903018 CTAATAATATGTCTTGGTGGTGG - Intronic
979193744 4:117895241-117895263 CTAATACTGTGCCATGGTGAAGG - Intergenic
980032227 4:127844547-127844569 CTGAAGATATGCCTCGGTGTGGG - Intergenic
980059925 4:128117870-128117892 AAGATGATGTGCTTTGGTGTAGG + Intronic
981177597 4:141700587-141700609 ATGATGATGTGCCTTAGTGATGG + Intronic
981617466 4:146656219-146656241 GTAATGTTGGGCCTGGGTGTGGG + Intergenic
981839748 4:149097370-149097392 ATAATGAAGTGCCATAGTGTGGG - Intergenic
984789927 4:183605999-183606021 CTAATGACGTGACTTAGGGTGGG - Intergenic
986359265 5:6960251-6960273 CCAGTTCTGTGCCTTGGTGTGGG + Intergenic
987706261 5:21464605-21464627 CTATTGAAGTGACTTAGTGTGGG - Intergenic
990329224 5:54709326-54709348 ATGATGACATGCCTTGGTGTGGG + Intergenic
990575535 5:57120256-57120278 CTAATGAGGTGAGTTGATGTGGG - Intergenic
991150021 5:63356843-63356865 CTAATGATATGCCTATATGTAGG + Intergenic
991267496 5:64739082-64739104 ATAATGGTGTGCCTTTGTGTGGG + Intronic
991576002 5:68103903-68103925 ATAATTATGTGTCTTGGGGTTGG - Intergenic
992195397 5:74334273-74334295 CTGATCATGTGACTTGGTTTTGG - Intergenic
994841134 5:104926491-104926513 CATATGATGTGACTTAGTGTAGG - Intergenic
995104863 5:108365296-108365318 CTAATGAAGTGACTTAGAGTGGG + Intronic
995499942 5:112793826-112793848 CTCATGATGTGTCTTAGTGTAGG - Intronic
995988162 5:118205931-118205953 ATAATGGTGTGCCTTGTTGCTGG - Intergenic
999790903 5:154938434-154938456 CTAATTTTGTGCCTTTCTGTGGG - Intergenic
1001760784 5:174206390-174206412 CTACTGATTTGACTTGGTGAAGG + Intronic
1002615657 5:180453915-180453937 CTAGTGATGTGCTTTAGTGTTGG - Intergenic
1003487686 6:6593825-6593847 CTCATGATGCCCCTTGGTGCAGG + Intronic
1003928096 6:10896161-10896183 CTAAAGATGTTCCTTTCTGTAGG - Intronic
1005273642 6:24192932-24192954 CCAATTATGTGTCTTGGTATGGG - Intronic
1005878571 6:30035338-30035360 ATTGTGATGTGTCTTGGTGTGGG + Intergenic
1007402764 6:41613521-41613543 TTGATGATGTGCTTTGGTGAAGG - Intergenic
1008874944 6:56315506-56315528 CTAAAGATGGGCCTTTCTGTTGG - Intronic
1009021862 6:57955037-57955059 CTATTGAAGTGACTTAGTGTGGG + Intergenic
1011026731 6:82877682-82877704 CTAATGATGTGATTTTGAGTTGG + Intergenic
1012133767 6:95529316-95529338 CTGATGATGTGCCTTTGAGATGG - Intergenic
1012925683 6:105264804-105264826 CAAATGATATGCCTAGGTGTAGG - Intergenic
1013037503 6:106400541-106400563 GGAAAGATTTGCCTTGGTGTTGG + Intergenic
1013068706 6:106708722-106708744 ACAATGATGTGCTTTGGTGTTGG + Intergenic
1014432276 6:121385206-121385228 CAAATGATGTATCTTGATGTGGG - Intergenic
1017376810 6:153780078-153780100 ATTATGATGTTTCTTGGTGTGGG - Intergenic
1017399676 6:154045894-154045916 CTTCTGATGTGCCTTGTAGTTGG - Intronic
1017600381 6:156073969-156073991 CTAAAGAAATGCCTTTGTGTAGG - Intergenic
1019199671 6:170304388-170304410 GTGGCGATGTGCCTTGGTGTTGG + Intronic
1020372959 7:7454587-7454609 TTAATGCTGTTCCTTGGTGGAGG - Intronic
1020975334 7:14999345-14999367 CTAAAAATGTGCCTTGGATTTGG - Intergenic
1022153290 7:27632608-27632630 ATAATGATGTGCCTTTATTTTGG - Intronic
1022638946 7:32163270-32163292 CTGATGATATGGCATGGTGTGGG - Intronic
1023786396 7:43712571-43712593 CTAATGATGGGCCCCAGTGTGGG + Intronic
1025923625 7:65938520-65938542 CAAAGGATGTGCCTTGTTGTGGG - Intronic
1026397773 7:69975311-69975333 ACTATGATGTGTCTTGGTGTGGG + Intronic
1026630786 7:72036297-72036319 CTGATAATGTGTCTTGCTGTGGG + Intronic
1029840529 7:103358301-103358323 ATGGTGATGTGCCTTGGTGTTGG + Intronic
1032806396 7:135359100-135359122 ATAGTGATCTCCCTTGGTGTGGG - Intergenic
1033774657 7:144594608-144594630 ACAGTGATGTGTCTTGGTGTGGG - Intronic
1033812923 7:145038163-145038185 CTAATAATTTGCCTTGATGAGGG - Intergenic
1035549618 8:510326-510348 CTAATGAAGTGACTTGAAGTGGG - Intronic
1038298055 8:26314717-26314739 TGGATGATGTGCTTTGGTGTGGG + Intronic
1038532906 8:28333035-28333057 CTAATGAGGTGACTTGCAGTAGG + Intronic
1038738549 8:30195482-30195504 CCTATAATGTGTCTTGGTGTGGG - Intergenic
1039623523 8:39024228-39024250 CTGATGATGTGTTTTGGTGTGGG + Intronic
1039790180 8:40869406-40869428 ATAATGCTGGGCTTTGGTGTCGG + Intronic
1039860197 8:41450730-41450752 ATAATAATGTGCCTAGGTGTAGG + Intergenic
1040419791 8:47228016-47228038 AAAATGATATGCCTAGGTGTAGG - Intergenic
1041116280 8:54540538-54540560 GTCATAATGTGCTTTGGTGTGGG + Intergenic
1044442843 8:92241787-92241809 CAAATGATATGGCTTGTTGTAGG + Intergenic
1044871506 8:96624824-96624846 CTCATTATGTTCCTTGGTATTGG + Intergenic
1045336883 8:101213055-101213077 ATTTAGATGTGCCTTGGTGTGGG - Intergenic
1051114072 9:13674105-13674127 CTGATGCTGTGCCTTGCTATAGG + Intergenic
1051199164 9:14597854-14597876 CAGATGATGTGTCTGGGTGTTGG - Intergenic
1051515031 9:17920938-17920960 ATAATGCTGTGCCTTGCTGTGGG + Intergenic
1051812427 9:21065357-21065379 CTAATGATGTGCCTGGGAGCTGG - Intergenic
1053746778 9:41206749-41206771 CAAATAATGTGCCTTGGGATGGG + Intergenic
1054480504 9:65658609-65658631 CAAATAATGTGCCTTGGGATGGG - Intergenic
1054681566 9:68224533-68224555 CAAATAATGTGCCTTGGGATGGG - Intergenic
1054912234 9:70465250-70465272 CTAATGAGGTGACTTAGGGTAGG - Intergenic
1055258584 9:74404530-74404552 ATTATAATGTGTCTTGGTGTGGG + Intergenic
1056342523 9:85651998-85652020 CTAATGATGTGACTCTTTGTGGG + Intronic
1056346814 9:85705236-85705258 ATTATGATGTCCCTTGATGTAGG - Intronic
1056855339 9:90123643-90123665 ATTACAATGTGCCTTGGTGTGGG + Intergenic
1058275297 9:103033683-103033705 CTAATGATTAGACTTGGTGATGG - Intergenic
1059289458 9:113209938-113209960 CTAATGAGGTGACTTAGAGTGGG + Intronic
1060097734 9:120807888-120807910 ATTATGATGTGTCTTGATGTGGG + Intergenic
1060150329 9:121284292-121284314 CTGATGCTGTGCCTTGGTACGGG + Intronic
1061931209 9:133834110-133834132 CTCATGATGGGTCATGGTGTGGG - Intronic
1062149794 9:135011875-135011897 CTGATGATGTGCATGGGTGGAGG - Intergenic
1202782909 9_KI270718v1_random:17528-17550 CAAATAATGTGCCTTGGGATGGG + Intergenic
1186981702 X:14964111-14964133 CTAATGAGGTGACTTAGGGTGGG + Intergenic
1189783049 X:44534530-44534552 CCAGTGATGTGCCTTACTGTGGG - Intronic
1190498322 X:51049331-51049353 CTTATTATATGCCTTGGGGTAGG - Intergenic
1190508069 X:51148260-51148282 CTTATCATATGCCTTGGTATAGG + Intergenic
1191176943 X:57514356-57514378 ATTCTGATGTGCCTTGGTGTAGG + Intergenic
1191672508 X:63761581-63761603 CTAATGAAGGCCCTTGGGGTGGG - Intronic
1191920167 X:66247126-66247148 ATTACAATGTGCCTTGGTGTGGG + Intronic
1192955713 X:76068307-76068329 CTAATCATGTGCTGTGATGTGGG - Intergenic
1195512488 X:105733327-105733349 AAAATGATATGCCTAGGTGTAGG + Intronic
1195887531 X:109655703-109655725 ATAATGATGTATCTTAGTGTGGG - Intronic
1196079034 X:111611371-111611393 ATAATGATTTGCATTGTTGTCGG - Intergenic
1197805834 X:130397723-130397745 CAAAGGATGTGCCTTTATGTTGG + Intergenic
1199143603 X:144338593-144338615 ATTATAATGTGCCTTAGTGTGGG - Intergenic
1200056936 X:153466495-153466517 CTAGTGTTGGTCCTTGGTGTGGG - Intronic
1201349321 Y:13022328-13022350 ATGATGATGTGCCTTGGGGATGG + Intergenic