ID: 919865239

View in Genome Browser
Species Human (GRCh38)
Location 1:201776918-201776940
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919865237_919865239 17 Left 919865237 1:201776878-201776900 CCACACCAAGGCACATCATTAGC 0: 1
1: 0
2: 11
3: 56
4: 287
Right 919865239 1:201776918-201776940 GAAGATGCTAAAAGTTCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 167
919865236_919865239 18 Left 919865236 1:201776877-201776899 CCCACACCAAGGCACATCATTAG 0: 1
1: 1
2: 8
3: 43
4: 239
Right 919865239 1:201776918-201776940 GAAGATGCTAAAAGTTCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 167
919865238_919865239 12 Left 919865238 1:201776883-201776905 CCAAGGCACATCATTAGCGATGT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 919865239 1:201776918-201776940 GAAGATGCTAAAAGTTCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type