ID: 919865239 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:201776918-201776940 |
Sequence | GAAGATGCTAAAAGTTCCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 185 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 15, 4: 167} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
919865237_919865239 | 17 | Left | 919865237 | 1:201776878-201776900 | CCACACCAAGGCACATCATTAGC | 0: 1 1: 0 2: 11 3: 56 4: 287 |
||
Right | 919865239 | 1:201776918-201776940 | GAAGATGCTAAAAGTTCCAGAGG | 0: 1 1: 0 2: 2 3: 15 4: 167 |
||||
919865236_919865239 | 18 | Left | 919865236 | 1:201776877-201776899 | CCCACACCAAGGCACATCATTAG | 0: 1 1: 1 2: 8 3: 43 4: 239 |
||
Right | 919865239 | 1:201776918-201776940 | GAAGATGCTAAAAGTTCCAGAGG | 0: 1 1: 0 2: 2 3: 15 4: 167 |
||||
919865238_919865239 | 12 | Left | 919865238 | 1:201776883-201776905 | CCAAGGCACATCATTAGCGATGT | 0: 1 1: 0 2: 0 3: 2 4: 92 |
||
Right | 919865239 | 1:201776918-201776940 | GAAGATGCTAAAAGTTCCAGAGG | 0: 1 1: 0 2: 2 3: 15 4: 167 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
919865239 | Original CRISPR | GAAGATGCTAAAAGTTCCAG AGG | Intronic | ||