ID: 919865240

View in Genome Browser
Species Human (GRCh38)
Location 1:201776919-201776941
Sequence AAGATGCTAAAAGTTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919865237_919865240 18 Left 919865237 1:201776878-201776900 CCACACCAAGGCACATCATTAGC 0: 1
1: 0
2: 11
3: 56
4: 287
Right 919865240 1:201776919-201776941 AAGATGCTAAAAGTTCCAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 196
919865238_919865240 13 Left 919865238 1:201776883-201776905 CCAAGGCACATCATTAGCGATGT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 919865240 1:201776919-201776941 AAGATGCTAAAAGTTCCAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 196
919865236_919865240 19 Left 919865236 1:201776877-201776899 CCCACACCAAGGCACATCATTAG 0: 1
1: 1
2: 8
3: 43
4: 239
Right 919865240 1:201776919-201776941 AAGATGCTAAAAGTTCCAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919865240 Original CRISPR AAGATGCTAAAAGTTCCAGA GGG Intronic