ID: 919865801

View in Genome Browser
Species Human (GRCh38)
Location 1:201782162-201782184
Sequence CAGGTTTGCCTGCAAGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919865801_919865809 24 Left 919865801 1:201782162-201782184 CCGTCCTCTTGCAGGCAAACCTG 0: 1
1: 0
2: 2
3: 21
4: 241
Right 919865809 1:201782209-201782231 AGCTTGCAGTGAAGAATACTGGG 0: 1
1: 0
2: 1
3: 11
4: 139
919865801_919865806 -2 Left 919865801 1:201782162-201782184 CCGTCCTCTTGCAGGCAAACCTG 0: 1
1: 0
2: 2
3: 21
4: 241
Right 919865806 1:201782183-201782205 TGAGGGCAAAGCTACAGACAAGG 0: 1
1: 0
2: 1
3: 20
4: 211
919865801_919865808 23 Left 919865801 1:201782162-201782184 CCGTCCTCTTGCAGGCAAACCTG 0: 1
1: 0
2: 2
3: 21
4: 241
Right 919865808 1:201782208-201782230 AAGCTTGCAGTGAAGAATACTGG 0: 1
1: 0
2: 1
3: 23
4: 214
919865801_919865807 -1 Left 919865801 1:201782162-201782184 CCGTCCTCTTGCAGGCAAACCTG 0: 1
1: 0
2: 2
3: 21
4: 241
Right 919865807 1:201782184-201782206 GAGGGCAAAGCTACAGACAAGGG 0: 1
1: 0
2: 0
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919865801 Original CRISPR CAGGTTTGCCTGCAAGAGGA CGG (reversed) Exonic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902187368 1:14735422-14735444 CAGGGCTGCCTGGAAGAAGAAGG - Intronic
902641423 1:17768680-17768702 CTGGGTTGCCTGGAATAGGAGGG + Intronic
903773443 1:25778322-25778344 CAGGTAACCCTGCAAGGGGAAGG + Exonic
905371982 1:37487210-37487232 GAGATTTGCCTGAAAGAGGCAGG + Intergenic
907666066 1:56434842-56434864 CAGTTCTGCCTGCAGGAGGTGGG + Intergenic
907986758 1:59539241-59539263 CAGATTTGTGTGTAAGAGGATGG + Intronic
908815033 1:68023024-68023046 CAAGTTTCCCTGCAACATGAGGG + Intergenic
910424284 1:87103278-87103300 CAGGTGTGCCTCCCACAGGATGG + Intronic
911149999 1:94589452-94589474 CAAGCTTGCCTGAGAGAGGAAGG - Intergenic
913190474 1:116408970-116408992 CAGGTTTGCATCTAGGAGGACGG - Intronic
913489983 1:119370081-119370103 CAGCTTTGCCTTCTTGAGGATGG + Intronic
914228728 1:145744933-145744955 CAGCTTGGCCTGGAAGAGGTAGG - Exonic
915349056 1:155213275-155213297 CAGCTTTGCCTGCAGCAGCAGGG - Exonic
915352243 1:155233902-155233924 CAGCTTTGCCTGCAGCAGCAGGG - Intergenic
917487162 1:175465831-175465853 CAGGTCTGCTTATAAGAGGAGGG - Intronic
917527341 1:175800662-175800684 CAGATTTGACTGCAGGAGGGTGG + Intergenic
919664926 1:200282803-200282825 TAGATCTGCTTGCAAGAGGAAGG + Intergenic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
920373088 1:205492013-205492035 CAGGTTTCCCTGAAAGGGGATGG - Intergenic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
921899496 1:220435360-220435382 TTGGATTGCCTACAAGAGGAAGG + Intergenic
922775202 1:228211350-228211372 CAGGTCTGCCTGCCTCAGGAAGG + Intronic
1064128803 10:12689252-12689274 CAGCTTTGCTTGAAAGAGCAGGG - Intronic
1065541978 10:26779612-26779634 CTAGTTTGCTTGGAAGAGGAGGG + Intronic
1065791344 10:29263463-29263485 CAGGTTTGCCTGCATGAGATGGG - Intergenic
1067082908 10:43221651-43221673 CAGGTTAGGCTGCAAGCGCAGGG + Intronic
1067582643 10:47455365-47455387 CTGGTTTCCCTGGATGAGGACGG + Intergenic
1069038533 10:63670500-63670522 CATTTGTGCCTGAAAGAGGAAGG - Intergenic
1072680814 10:97505039-97505061 CACGTGTGCCTGGAAGAGGGGGG - Intronic
1076056127 10:127374675-127374697 CTGGATTACCTGCAAGGGGAGGG + Intronic
1076280382 10:129241836-129241858 CAGGTGTGCATGCAAAGGGATGG + Intergenic
1076534923 10:131170811-131170833 CCGGTTTGACTTCAAGAGGCTGG - Intronic
1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG + Intergenic
1078370688 11:10742211-10742233 CAGCTTTCCCTGCATGAGGAAGG + Intergenic
1080592777 11:33737762-33737784 CAAGTCTTCCTCCAAGAGGATGG + Intergenic
1083284754 11:61651245-61651267 CAGGTTTCCCTGTGAGAGGGAGG - Intergenic
1083696362 11:64445399-64445421 AAGGTTTGCCAGCAGGAAGAAGG + Intergenic
1083712734 11:64559121-64559143 CAGGTCCCACTGCAAGAGGAGGG - Exonic
1085291697 11:75404866-75404888 CAGGTATGTCTGCAAGGGCAGGG + Exonic
1085439379 11:76544485-76544507 CTGGTCTGCCTGCAGGTGGATGG - Exonic
1085542600 11:77286471-77286493 GAGGTTTCCCTGCAGTAGGAAGG - Intronic
1087010960 11:93513648-93513670 CAGGTTTGTCTGTGAGAGGAAGG + Intronic
1089184876 11:116608010-116608032 CAGTTATGCATGCCAGAGGATGG - Intergenic
1089284267 11:117395596-117395618 CTGGTTTGACTGCAACAGGTGGG - Exonic
1090248713 11:125236349-125236371 CAGGCTTTCCTGGAACAGGATGG - Intronic
1092921971 12:13240221-13240243 CAGGTTTTTCTTCAAGATGATGG - Intergenic
1092997139 12:13961135-13961157 CAGATATGCCTGCAAGTGGGTGG + Intronic
1094846227 12:34362572-34362594 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1094846913 12:34365387-34365409 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1095683356 12:45004260-45004282 CAGGTTTGTTGGCAAGTGGATGG - Intergenic
1095999808 12:48119596-48119618 CAGCTGAGCCTGCAAGCGGAGGG - Intronic
1097294107 12:57944510-57944532 GAGGTTTCCCTGTAAGGGGACGG - Intronic
1097415425 12:59310364-59310386 CAGGTTTAATTGGAAGAGGAAGG - Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1100241221 12:92712098-92712120 CACATTTGCATGCCAGAGGATGG - Intergenic
1101209306 12:102520262-102520284 CTTGAATGCCTGCAAGAGGAAGG - Intergenic
1102576681 12:113860212-113860234 CAGGTTTCCCTGCTGGAGGGGGG + Intronic
1103733901 12:123046275-123046297 CAAGTGTGCCTGCCAGAGGGTGG - Intronic
1104736962 12:131140898-131140920 CAGGTGTGCCCGCCAGAGCACGG - Exonic
1108267337 13:48725361-48725383 AAGGTTTGCCTGCAAGGAAATGG + Intergenic
1109078525 13:57867930-57867952 CATGTTTTCCTGCAAGTAGATGG + Intergenic
1109517589 13:63464457-63464479 CAGGCCTGCCTTCAAGAGCATGG - Intergenic
1109951096 13:69502703-69502725 AACATTTGCCTGCCAGAGGATGG - Intergenic
1110425467 13:75362017-75362039 CAGGTGTACCTGGAAGAGCATGG + Exonic
1110754230 13:79152596-79152618 CAGGTTTTCCTGCAACTAGACGG - Intergenic
1113117150 13:106885698-106885720 CAGGAGTGCATGCAAGAAGAGGG - Intergenic
1118318815 14:64741611-64741633 CCGGTCTTCCTGCAAGAAGAAGG + Exonic
1119062117 14:71485576-71485598 CAGGTTTTCCTGCAACTAGATGG - Intronic
1119410141 14:74425508-74425530 CAGGTTTGGGTGCGAGAAGAGGG + Intronic
1119582933 14:75803913-75803935 CAGGCTTGCCTGCACGGAGAGGG - Intronic
1122274682 14:100585486-100585508 CAGGAGTGCCTGCAGGAGTAGGG + Intronic
1123020160 14:105394280-105394302 CAGGGCTGCCTGCAGGTGGAAGG - Intronic
1124140540 15:27073258-27073280 CATGTCTGCCTGGAAGAGGAGGG + Intronic
1125333548 15:38605369-38605391 CATGTGTGCGTGCAAGAGGGAGG + Intergenic
1125745101 15:41992501-41992523 CAGGTTTGCCTCCAACACGAGGG + Intronic
1126049964 15:44676546-44676568 CAGGTTTACCTTCCAGAGGCTGG - Exonic
1126665130 15:51069024-51069046 CAGGCTTGGGTGCAATAGGACGG + Intronic
1127890135 15:63243007-63243029 CATGTTTTCCTGCAACAAGATGG + Intronic
1128600785 15:68993768-68993790 CTGGTTGGCCTCCAAGAGGAGGG + Intronic
1129072361 15:72961939-72961961 CAGATTTAGCTTCAAGAGGAGGG - Intergenic
1129510970 15:76122169-76122191 CAGGCTGGCCTGCTAGAGGATGG - Intronic
1131664159 15:94552315-94552337 CAGGGGTGCGTGCAAGAGGCTGG - Intergenic
1132306764 15:100820644-100820666 CAGCTGTGCCTGCTAGAGGGAGG - Intergenic
1133863784 16:9622338-9622360 CATCTTTGTTTGCAAGAGGATGG - Intergenic
1134135491 16:11674027-11674049 CAGGTTTGCCTGAAGGACAAAGG - Intronic
1134299083 16:12973557-12973579 CATTTTTGTCTGCAGGAGGAAGG - Intronic
1135227886 16:20677183-20677205 CTGGTTAGCCTCCTAGAGGAGGG - Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1138137672 16:54537487-54537509 CAGTTTTTCCTGGGAGAGGAAGG + Intergenic
1140280806 16:73553755-73553777 CAGGTCTGCCTCCAAGTGTAGGG + Intergenic
1140736054 16:77898700-77898722 GAGGTTTGACTGCAAGGTGATGG - Intronic
1141292637 16:82734435-82734457 CAGGTGCGCCTGCAACAGAATGG + Intronic
1142776463 17:2143929-2143951 CAGTTTTGGCTGCAAGTGGCAGG + Intronic
1142889145 17:2931757-2931779 CAGGCTGACCTGCAAGAAGAGGG - Intronic
1143471226 17:7177318-7177340 GAGGTGGCCCTGCAAGAGGAGGG + Exonic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1146079101 17:29761244-29761266 CACGTTGGCCCGCAAGAGGAAGG - Intronic
1147528628 17:41252254-41252276 CTGGATTGCCTGCTATAGGATGG + Intronic
1147722001 17:42545087-42545109 GAGGTTTTCCTGCAACAGAAGGG - Intergenic
1149510434 17:57236890-57236912 CAGCTTTGCCAGGAAGGGGAAGG - Intergenic
1151108778 17:71650874-71650896 AAGGGTTACCTGCAAGAGCATGG + Intergenic
1151343736 17:73488451-73488473 CAGTTTTGTCTGCAAGAAGCAGG + Intronic
1151743194 17:75997719-75997741 GAGGTTTGTCTGCAAAGGGAGGG - Intronic
1152181583 17:78825525-78825547 CAGGATTGCTGGAAAGAGGAGGG - Intronic
1152651352 17:81494919-81494941 CAGGTCTGCCTGCCACAGGTGGG + Intergenic
1155505315 18:26527199-26527221 CAGGTCTGCCTGCCAGAGGAGGG + Intronic
1155568949 18:27168734-27168756 CTTGTTTGCATTCAAGAGGAGGG - Intronic
1159025306 18:63177941-63177963 CAGGTCAGCCTGCATGAGGAGGG + Intronic
1160755472 19:754900-754922 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1160755479 19:754924-754946 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1161772773 19:6240289-6240311 CAGGCCTGCCTGGAAGAGGCTGG + Intronic
1162501222 19:11055034-11055056 CAGGCTTCCCTGCAACAGGCAGG - Intronic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1164097203 19:22022184-22022206 GACGTTTGCATGCCAGAGGATGG - Intergenic
1164286413 19:23821468-23821490 CTGGTCTGCCTCCCAGAGGAGGG + Intronic
1164749492 19:30641978-30642000 AAGGTTTTCCTGCAAGTGCATGG - Intronic
1164929387 19:32163894-32163916 CAGCTTTGCCTAGAAGAAGAAGG - Intergenic
1166404682 19:42511504-42511526 CAGGATTCCCTGCCAGGGGAGGG + Intronic
1166514983 19:43439692-43439714 CAGGTTGGTCTGCAACAGGTTGG - Intergenic
1167119886 19:47510578-47510600 CACGTTTGTATCCAAGAGGAAGG + Intronic
1168191120 19:54739461-54739483 CTGGTTTGCCTGCAGATGGATGG + Intronic
1168201264 19:54817488-54817510 CTGGTTTGCCTGCAGAGGGATGG + Intronic
925133912 2:1513210-1513232 CAAGCCTGCCTGCATGAGGAAGG + Intronic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
926312408 2:11684212-11684234 CAGGTGTGTCTGCTAGAGCAAGG + Intronic
927491073 2:23521280-23521302 CAGCTCTGCCTGCAGGAGGAAGG + Intronic
929523854 2:42681204-42681226 CAGGTTTGCTTGGAACAGCAAGG - Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
932037802 2:68264915-68264937 CAGGTATGGCTGGAAGAGCATGG + Intergenic
933986448 2:87595874-87595896 CAGGTCTGCCTGCGAGGGAATGG - Intergenic
936307390 2:111354927-111354949 CAGGTCTGCCTGCGAGGGAATGG + Intergenic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
936835921 2:116709459-116709481 CAGGTTGGCCTGCTAAAGTAAGG - Intergenic
937840320 2:126518587-126518609 CAGGTGTGCCTGCAAATGCAGGG + Intergenic
938381659 2:130839573-130839595 CTGGTCTGCCTGCACGGGGAGGG - Intronic
939454219 2:142412322-142412344 CATGTTTTCCTTCAAAAGGATGG + Intergenic
939994030 2:148903281-148903303 CAGGTCTGCCCACAAGAGCATGG + Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942468016 2:176229407-176229429 CATGTTTGACTGGAAGTGGAAGG - Intergenic
943670983 2:190659947-190659969 CAGATTTGACTCAAAGAGGAAGG + Exonic
945368645 2:208988935-208988957 CAGGTTTGACTGCATGAAGTAGG - Intergenic
945794955 2:214351004-214351026 CAGCTTAGCCTGCAACAGGCTGG - Intronic
946523631 2:220494020-220494042 AAGGATTGTCTGCAAGATGATGG - Intergenic
947541614 2:230983799-230983821 CAGGATGGCCTGGAAGAGGCAGG - Intergenic
948395223 2:237640451-237640473 CAGGTGTGGCTGCAGGAGAAGGG + Intronic
1169037493 20:2465544-2465566 GAGGTTACCCTGCAAGAGGCCGG - Intronic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1169970847 20:11268045-11268067 TAGGCTAGCCTGCTAGAGGATGG + Intergenic
1170764079 20:19275293-19275315 CAGCATTCCCTGCAAGAGGATGG + Intronic
1171102274 20:22395275-22395297 AAAGTATGCCTTCAAGAGGAAGG + Intergenic
1172303310 20:33864690-33864712 CTGCTTTGCCTGCAATGGGAGGG + Intergenic
1172808360 20:37629512-37629534 CAGGTGTGCCTGCCAGTGGGAGG + Intergenic
1174672977 20:52325072-52325094 GAGTTTTCCATGCAAGAGGAGGG + Intergenic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175012917 20:55757989-55758011 CAGGCTTGCCTGAGAGAGGGAGG - Intergenic
1175240834 20:57547471-57547493 CAGGTTTGCCTGCCCGAGGGAGG + Intergenic
1176904966 21:14489254-14489276 CAGGTTTGCCTACAAAATTATGG + Intronic
1177676459 21:24307578-24307600 CAGCTTTGCAGGTAAGAGGATGG + Intergenic
1180036514 21:45253073-45253095 CTGGTGTCCCTGTAAGAGGAGGG + Intergenic
1180843386 22:18969592-18969614 CAGGTTGGCCTGCAAGACCCTGG + Intergenic
1181003634 22:19999374-19999396 TAGATTTGCCTACAAAAGGATGG - Intronic
1181367508 22:22389436-22389458 GACATTTGCATGCAAGAGGATGG - Intergenic
1181853548 22:25766996-25767018 CTGGTTTGAATGCAAGAGGAGGG + Intronic
1185267583 22:49912353-49912375 CAGGGTTGGCAGCAAGAGGTTGG - Intronic
950319361 3:12035856-12035878 GAGGTCTGCATGCAAGAGGATGG + Intronic
950426958 3:12929524-12929546 CAGGTTGCCCAGCAAGATGATGG + Intronic
950718095 3:14863863-14863885 CAGGCTCCCCTGCCAGAGGAAGG - Intronic
951046684 3:18047263-18047285 CAGGTTTGCCTGCATGGCAATGG + Intronic
951886629 3:27531160-27531182 CAGGTTGGCCTGGCAGAGGGAGG - Intergenic
952401619 3:32968683-32968705 CTGGTTGGCCTCCTAGAGGAGGG - Intergenic
953136892 3:40189500-40189522 TAGGCTTGCCTGGAAGGGGAGGG - Intronic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953476337 3:43208958-43208980 CTCTTTTTCCTGCAAGAGGAAGG - Intergenic
955144227 3:56300114-56300136 CAGGTTTGACAGCAACGGGAGGG + Intronic
957816037 3:85298301-85298323 CAGATTTGCCTCCTATAGGAAGG + Intronic
960118980 3:113927442-113927464 CAGGTTTGCAAGCCAGTGGAGGG - Intronic
961624813 3:128254591-128254613 GAGGTTTGCCTAGGAGAGGAGGG + Intronic
964768638 3:160202070-160202092 CTGGGCTGCATGCAAGAGGAAGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967546650 3:190737822-190737844 CAGCTTTGACTGAGAGAGGATGG + Intergenic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
970825346 4:20266420-20266442 CAGGTTTGACAGCCAGAGAATGG + Intronic
973563206 4:52157458-52157480 TAGGTTTGGGGGCAAGAGGAGGG + Intergenic
974289505 4:59912246-59912268 CACGTTTGCATGCCAGAGGATGG + Intergenic
974976861 4:68903438-68903460 CTGGTTGGCCTCCCAGAGGATGG + Intergenic
975827662 4:78336799-78336821 CAGGTCTGAGTCCAAGAGGAGGG - Intronic
976034265 4:80796311-80796333 GACGTTTGCATGCCAGAGGATGG - Intronic
977019255 4:91739447-91739469 CAGGTTGTCCTCCAAGAGGCTGG - Intergenic
977051263 4:92130605-92130627 TGGGTTTTCCTGGAAGAGGATGG + Intergenic
978643712 4:110902855-110902877 GTGGTTAGCCTGGAAGAGGAAGG + Intergenic
978937873 4:114399851-114399873 CAGGCTTTTCGGCAAGAGGATGG + Intergenic
982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG + Intergenic
982074450 4:151724581-151724603 CACGTTTGGCTGCAGGAGCATGG - Intronic
982541190 4:156673695-156673717 CAGGCTAGCCTGCTGGAGGATGG + Intergenic
984697147 4:182790599-182790621 CAGGTGAGTTTGCAAGAGGACGG - Intronic
985882912 5:2654031-2654053 CAGGTTTTCCTGGAAGACGAGGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988692739 5:33588802-33588824 CATGTTTGCCTGCAGGTGGTGGG - Exonic
990374091 5:55152003-55152025 CATGTATCCCTGTAAGAGGAAGG + Intronic
995748069 5:115424651-115424673 CATCTGTGCCTGCAAGAGAAAGG - Intergenic
996426087 5:123314669-123314691 CAGGGTTGGGTGCAAGGGGAGGG - Intergenic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
997512586 5:134463756-134463778 CAAGTTTGGGTGCGAGAGGAGGG - Intergenic
997521954 5:134528593-134528615 CAAGTTTGCATGGTAGAGGAAGG + Intronic
997814166 5:136999999-137000021 GAGGTTTGCCTGAGAGAGGGGGG - Intronic
1002647599 5:180668506-180668528 CAGGTTAGCCTGCTGGAGGGTGG + Intergenic
1004049614 6:12063505-12063527 CAGGTGTGGCTGCACGTGGAAGG + Intronic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1008448307 6:51619316-51619338 CAGGTGTACCTGCAAGAGACTGG - Exonic
1009731716 6:67616508-67616530 CATGTTTCACTGCAAGAGTAGGG - Intergenic
1010958482 6:82118449-82118471 CACATTTGCCTGCTACAGGAAGG + Intergenic
1011039428 6:83013773-83013795 GAGATTTGCCTGCCAGAGGATGG - Intronic
1012344510 6:98169826-98169848 GATGTTTGCATGCCAGAGGATGG + Intergenic
1012532182 6:100251329-100251351 CAGGTTAGCCTGGAAGAAAAAGG + Intergenic
1015091185 6:129361580-129361602 CAGGTTAGCCTCCTTGAGGAAGG - Intronic
1016004953 6:139079771-139079793 CAGGATTGTCTGCCACAGGAAGG - Intergenic
1017501110 6:155023867-155023889 CGTCTTTGCCTGCAAGATGAAGG + Intronic
1017520288 6:155195862-155195884 CAGGTGTGCCTGGAAGGGCAAGG + Intronic
1018299660 6:162388172-162388194 CAGGTTTCATTGCAGGAGGAGGG + Intronic
1019735458 7:2647944-2647966 CAGGTTTGCCTGCAGGTGGCTGG + Exonic
1022443578 7:30452466-30452488 CAGGTTGGCCAGCAAGACCAGGG + Exonic
1022626063 7:32037406-32037428 GAGGTTTGTATGCAAGAGAAGGG - Intronic
1024958325 7:54949574-54949596 GATGTTTGCATGCCAGAGGATGG - Intergenic
1026126198 7:67581864-67581886 CACGTTTGCCTGTAGGATGATGG + Intergenic
1026575935 7:71571560-71571582 CAGGTTTCCCTACATAAGGAGGG - Intronic
1027048993 7:75009763-75009785 AGGGCTTGCCTGGAAGAGGAGGG + Intronic
1027540166 7:79454883-79454905 CAGGTTTGCATCCAAGAGAGGGG + Intergenic
1028097973 7:86786250-86786272 CAGGTTTGCCACCTAGGGGAGGG - Exonic
1029889650 7:103914026-103914048 CAGGGTTGCCTGTGAGAGGAAGG + Intronic
1031630039 7:124033664-124033686 CAGGTGTGACTGCAAGTTGATGG + Intergenic
1035344008 7:158186481-158186503 CAGGTGGGCTTCCAAGAGGACGG - Intronic
1036584793 8:10113411-10113433 GGGGTTAGCCTGAAAGAGGAGGG + Intronic
1036775890 8:11613082-11613104 CAGCCTAGCCTGCGAGAGGAAGG + Intergenic
1036919762 8:12840863-12840885 CTCATTTGCCTGAAAGAGGAAGG - Intergenic
1040900786 8:52414972-52414994 CAGGTTTGGCTGGATGAAGAAGG - Intronic
1041026486 8:53692017-53692039 CAGGTTGGCCTTCATCAGGATGG + Intergenic
1041231458 8:55757062-55757084 CAGGTTTCACTGTTAGAGGAGGG + Intronic
1044115541 8:88328841-88328863 ATGGTTTGGCTGAAAGAGGAAGG + Intergenic
1044599502 8:93989852-93989874 CAGGTCTGCCTGGAAGGAGATGG - Intergenic
1045221752 8:100206526-100206548 GACATTTGCATGCAAGAGGATGG + Intronic
1045586586 8:103544547-103544569 CAGGTGTGGCTGTAAGAGGTGGG - Intronic
1048318320 8:133378326-133378348 CAGGTTTGCCTGCTGCAGGCCGG + Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1055685538 9:78769778-78769800 GAGCTTTGCCTGTAAGAAGAGGG + Intergenic
1060279223 9:122204772-122204794 AAGGATGACCTGCAAGAGGAGGG + Exonic
1061397090 9:130349182-130349204 CCGGTGTGCCTGCAAGAGTTGGG - Intronic
1061653140 9:132067303-132067325 CTGTTTTCCCTGCAAGATGAAGG - Intronic
1062248474 9:135582553-135582575 CTTGTTTTCCTGCAAGTGGACGG + Intergenic
1186857259 X:13638268-13638290 CAGGCCTGCCTGCAACAGGCTGG + Intergenic
1186909711 X:14149836-14149858 CATTTTTTCCTGCAAGATGATGG - Intergenic
1187045867 X:15647077-15647099 CAGGCTTGCCTGCACCTGGAAGG + Intronic
1187051845 X:15703378-15703400 CAGGCTTGCCTGCACCTGGAAGG + Intronic
1189606892 X:42688067-42688089 CAATTTTGGCTGCAAGTGGAAGG - Intergenic
1194421098 X:93673617-93673639 GAGGTCTGACTGCAAGGGGAGGG - Intergenic
1195625760 X:107004518-107004540 CATGTCTGCAAGCAAGAGGATGG - Intergenic
1195641276 X:107177553-107177575 CAGATGTGACTGCAAGAGAATGG + Intronic
1199606133 X:149581122-149581144 AAGGGTTTCCTGCAAGATGAGGG - Intergenic
1199632988 X:149788246-149788268 AAGGGTTTCCTGCAAGATGAGGG + Intergenic
1199798499 X:151226877-151226899 CAGATTTGACTCAAAGAGGAAGG - Intergenic
1200651606 Y:5847262-5847284 GACGTTTGTGTGCAAGAGGATGG + Intergenic