ID: 919866153

View in Genome Browser
Species Human (GRCh38)
Location 1:201784533-201784555
Sequence GTAGGTAAAAACTACCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919866153_919866157 15 Left 919866153 1:201784533-201784555 CCTATATGGTAGTTTTTACCTAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 919866157 1:201784571-201784593 TTTTTTTTTTTTTTTGAGATGGG 0: 2999
1: 17290
2: 21616
3: 48511
4: 122087
919866153_919866158 16 Left 919866153 1:201784533-201784555 CCTATATGGTAGTTTTTACCTAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 919866158 1:201784572-201784594 TTTTTTTTTTTTTTGAGATGGGG 0: 1710
1: 4662
2: 23038
3: 43204
4: 191852
919866153_919866156 14 Left 919866153 1:201784533-201784555 CCTATATGGTAGTTTTTACCTAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 919866156 1:201784570-201784592 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919866153 Original CRISPR GTAGGTAAAAACTACCATAT AGG (reversed) Intronic
915238072 1:154500621-154500643 GAAGATAAAAACAACCAGATCGG + Intronic
916705395 1:167344153-167344175 GTAGTTAGTGACTACCATATTGG + Intronic
917096486 1:171403794-171403816 GTAGAGAAAAACTATCAGATGGG - Intergenic
918779594 1:188681666-188681688 ATAGGGAAAAACTACAACATTGG - Intergenic
919585180 1:199429493-199429515 GTTGGTTAAAAATACCATTTGGG - Intergenic
919866153 1:201784533-201784555 GTAGGTAAAAACTACCATATAGG - Intronic
924277828 1:242405901-242405923 TTAGGTCAAAAGTATCATATAGG - Intronic
1064373591 10:14775564-14775586 GTAGGTGATATATACCATATAGG - Intergenic
1064511911 10:16103836-16103858 GTAGGTAGAAGAAACCATATTGG - Intergenic
1064877975 10:20016982-20017004 GTAGGTAAAAACAGCCACCTCGG - Intronic
1064923503 10:20544272-20544294 ATGGTTAAAAACTACCATATTGG + Intergenic
1065295573 10:24271417-24271439 GTAAGTATAAACTAACAAATTGG - Intronic
1065934410 10:30508084-30508106 TTAGGTTAAATCTACAATATAGG + Intergenic
1068351373 10:55850027-55850049 GTAGAGAAAAACAACCACATTGG - Intergenic
1068996016 10:63205226-63205248 ATAGGTAAAAATTAACATAAGGG - Intronic
1074758033 10:116641890-116641912 GTAGGTAAAAACTAAAACAGTGG + Intronic
1078593536 11:12666567-12666589 GTAGCTAGTACCTACCATATTGG - Intergenic
1078965521 11:16336062-16336084 GTAGGTAGAAATAACCATAGTGG - Intronic
1079161957 11:18003400-18003422 GTAGGTAGTGGCTACCATATTGG - Intronic
1080328172 11:31102697-31102719 GTAGCTAGTGACTACCATATTGG - Intronic
1088412637 11:109552231-109552253 GTAGGTAAAGAGTATCAGATAGG + Intergenic
1089244370 11:117107704-117107726 GTAGGTAAACAATAACATACTGG + Intergenic
1089374344 11:117983919-117983941 GAAGGTACAAACTACAATACAGG + Intergenic
1093139188 12:15487852-15487874 GTAGCTAATAGCTACCATATTGG + Intronic
1094413779 12:30196401-30196423 GTAGGGAACACCTACCAAATGGG + Intergenic
1098540162 12:71646464-71646486 GTAGCTAACAGCTACCATATTGG + Intronic
1101364740 12:104061408-104061430 TTAGAAAAAAACTACCATCTAGG + Intronic
1103111009 12:118278259-118278281 GGATCAAAAAACTACCATATTGG - Intronic
1107535057 13:41321154-41321176 GCAGGTGTAAACTACCATACCGG - Intronic
1108045084 13:46375761-46375783 GAAGGTATAAACTAAAATATAGG - Intronic
1110861576 13:80350029-80350051 CTAGTTAGAAACAACCATATCGG - Intergenic
1112335411 13:98511170-98511192 TTAGGTAAATGCTACCATGTGGG - Intronic
1112849392 13:103686005-103686027 GTATAAAAAAAATACCATATTGG - Intergenic
1120495289 14:85226951-85226973 GCAGGTAAAAATTAGCATTTTGG - Intergenic
1125091952 15:35803178-35803200 AAAGATAAAAACTACCAAATTGG - Intergenic
1125308757 15:38354829-38354851 GGAGGAAAAAAATACCATTTTGG - Exonic
1127717750 15:61666245-61666267 GTAGCTAGTAGCTACCATATTGG - Intergenic
1128348683 15:66874278-66874300 GTAGGTATATCCTACAATATAGG + Intergenic
1132967140 16:2663459-2663481 GGACGTAAAAACTAACACATGGG - Intergenic
1138275849 16:55734192-55734214 GTGGGTGAAAACTAACAGATAGG - Intergenic
1138844155 16:60544896-60544918 GTGGGTACCAGCTACCATATTGG - Intergenic
1142770717 17:2094762-2094784 GTGGGTAGAAAATACCATATTGG - Intronic
1147491433 17:40870954-40870976 CTTGGTAAAAACCTCCATATGGG - Intergenic
1147552960 17:41457735-41457757 GTCGTTATGAACTACCATATTGG + Intergenic
1148393851 17:47293015-47293037 GTGGCTAAAGCCTACCATATTGG - Intronic
1148767958 17:50050297-50050319 TTAGGTAAAAATTATCTTATTGG - Intergenic
1149206947 17:54258696-54258718 GTGGGAAAAAACTGGCATATTGG + Intergenic
1150828489 17:68497438-68497460 GTAGCTAGTGACTACCATATTGG - Intergenic
1151462559 17:74263251-74263273 GAAGGTAAAATTTTCCATATGGG - Intergenic
1154378685 18:13830324-13830346 GTGGCTAATGACTACCATATTGG + Intergenic
1156323089 18:36046527-36046549 TTAAGTAAAATCTACCATCTTGG + Intronic
1156542081 18:37923774-37923796 GTTGTTCAAAACTTCCATATTGG + Intergenic
1158260634 18:55602160-55602182 GTATATAATACCTACCATATAGG - Intronic
1166785505 19:45364515-45364537 GTAGCTATAAACCACCACATTGG + Exonic
926760503 2:16274463-16274485 GTAGTTAGTGACTACCATATTGG - Intergenic
929860472 2:45672722-45672744 GATGGTAAAAACTGCCATAAGGG + Intronic
930211838 2:48647621-48647643 GTAGGGAAAAGTTTCCATATAGG - Intronic
931143010 2:59484471-59484493 GTAGGGAAAAAATAACATGTGGG - Intergenic
932106540 2:68948278-68948300 ATAGCTAATAACTATCATATTGG - Intronic
933942472 2:87255916-87255938 GTATGTAAAAAATAGCATCTAGG - Intergenic
936337753 2:111605652-111605674 GTATGTAAAAAATAGCATCTAGG + Intergenic
938985961 2:136576524-136576546 GTAGCTAACAACTACTGTATTGG - Intergenic
941129738 2:161632225-161632247 GTATATAACAACTACCAGATGGG + Intronic
941875628 2:170430036-170430058 GCAGATAAAAAATACAATATTGG + Intronic
942600178 2:177633000-177633022 GAAAATAAAAACTACCTTATAGG - Intronic
942718901 2:178926995-178927017 GAAGGTAAAAATAACCACATGGG - Intronic
945668045 2:212766312-212766334 ATTGGTAAAGGCTACCATATTGG - Intergenic
1173351128 20:42246532-42246554 GGAGGTTAAAACTACCACAAAGG + Intronic
1177672081 21:24245661-24245683 GAAGGTAATAATTACTATATGGG - Intergenic
1178967034 21:37130452-37130474 TTAGGTAATATCTACCATATGGG + Intronic
1183005035 22:34894327-34894349 GTATATAATAAATACCATATAGG + Intergenic
949910258 3:8898570-8898592 GGAGATAAAAACAACTATATTGG - Intronic
951304413 3:21040791-21040813 GAAGGTAGAAACTAGCATATGGG - Intergenic
953489145 3:43333449-43333471 AGTGGTAGAAACTACCATATAGG + Intronic
955577505 3:60381925-60381947 GTAGTTACCACCTACCATATTGG - Intronic
956316452 3:67942978-67943000 ATAGGTAAAAAGGAACATATAGG - Intergenic
956402670 3:68896789-68896811 GTGGGAGCAAACTACCATATGGG + Intronic
957521594 3:81325489-81325511 ATAGGTAAAATGTACCTTATTGG - Intergenic
958949831 3:100404490-100404512 GTGGCTAATGACTACCATATTGG + Intronic
960414920 3:117372681-117372703 GTAGGCAAGAACTACCACCTTGG - Intergenic
960882985 3:122364801-122364823 GTAAGTAAGAGCTAGCATATTGG - Intronic
964131246 3:153289385-153289407 GTGGGTAAAGACTTCCAAATTGG + Intergenic
967424122 3:189306661-189306683 GTAGCTCAAAATTACTATATGGG + Intronic
967474332 3:189898438-189898460 GTAGCTAGTGACTACCATATTGG - Intergenic
970657188 4:18244218-18244240 TTAGGAAAAAACTACCAGATGGG + Intergenic
971130929 4:23809782-23809804 GTGGCTAAAGGCTACCATATTGG + Intronic
971542322 4:27834562-27834584 GTAGGTACCAGCTACAATATAGG - Intergenic
971896248 4:32599607-32599629 GTAGCTAAAAATTACCGTACTGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978949851 4:114544970-114544992 GCCTGAAAAAACTACCATATAGG + Intergenic
979735668 4:124079942-124079964 GCAGGAATAAAATACCATATAGG + Intergenic
981242657 4:142496502-142496524 GTAAATAAAAACTACCATTTTGG - Intronic
983911728 4:173247435-173247457 GTGAGTAAAAAATACCAAATCGG + Intronic
984136995 4:175953599-175953621 GTATATAAAAACTACCATGGAGG + Intronic
988271176 5:29019267-29019289 GTAGCTAGCAGCTACCATATTGG + Intergenic
988319398 5:29672743-29672765 GTATGTAAAATCTCCCGTATAGG - Intergenic
989088536 5:37702771-37702793 GTGGATAATAACTACCACATAGG + Intronic
992510254 5:77425742-77425764 GTAAGAAAAAACCACCACATAGG - Intronic
992568933 5:78031691-78031713 GTGGGGGAAAACTACCATAATGG - Intronic
993996234 5:94726839-94726861 GTACCGAAAAAATACCATATGGG - Intronic
994252878 5:97557456-97557478 TTAGGGAAAAATTACCAGATAGG - Intergenic
995655298 5:114419689-114419711 CTAAATAAAAACTACCTTATTGG + Intronic
997079903 5:130726010-130726032 CTAGGTAACAACTTCCATTTAGG - Intergenic
999860267 5:155637562-155637584 ATAGGTAAAAATTATCATTTAGG + Intergenic
1000637280 5:163658896-163658918 GTAGATAAAATTTACCAGATGGG + Intergenic
1000874279 5:166617217-166617239 GTAAGTAAAATCTACTATGTCGG - Intergenic
1004665869 6:17748128-17748150 TTAGGTAAAAACTAAGAAATTGG - Intergenic
1008284928 6:49637823-49637845 GCAATTCAAAACTACCATATAGG + Intergenic
1008305335 6:49892481-49892503 GTAGGGAAAGACTATCATGTGGG - Intergenic
1010259662 6:73800505-73800527 GAAGGTTACAACTACCATGTAGG - Intronic
1012163504 6:95918957-95918979 GTAGGTAAGAAATAGCATAATGG - Intergenic
1012793756 6:103734441-103734463 GTAGGGAAAGACTATCAGATGGG - Intergenic
1015823046 6:137283220-137283242 GTAGGAAAAATATACCATAGGGG - Intergenic
1017853739 6:158330218-158330240 GTGGCTAGTAACTACCATATTGG + Intronic
1022430068 7:30310141-30310163 GGAGGTAAAATCTACCAGGTGGG + Intronic
1027451705 7:78339054-78339076 GTACGTAATAACCACAATATTGG - Intronic
1027970823 7:85078832-85078854 GTAGGTAAAAATTACTAGAGAGG + Intronic
1028197672 7:87926310-87926332 GTAGCTAGTAACTACTATATTGG - Intergenic
1029329593 7:99841021-99841043 GTAAGTAAAAACTCCCAGAAAGG - Intronic
1030478862 7:110076439-110076461 GAAGGTAAAAATAACAATATTGG - Intergenic
1031478408 7:122249859-122249881 GTGGCTAGAAGCTACCATATTGG - Intergenic
1031601720 7:123718054-123718076 GTAGAAAAAAAGTACCAAATAGG + Intronic
1031780204 7:125952373-125952395 ATAAGTAAAAACTACCTGATGGG - Intergenic
1033629196 7:143140371-143140393 GCAGGTAAACACTTTCATATTGG + Intergenic
1040022369 8:42752306-42752328 ATAAATAAAAACTACCAGATAGG - Intergenic
1040652225 8:49462108-49462130 GAAGGTAAAATCTTCCATTTTGG - Intergenic
1044867285 8:96584477-96584499 GTTTGTAAAAACTACCATAATGG - Intronic
1045700472 8:104861009-104861031 GGGGGTAAAAATAACCATATAGG - Intronic
1046225293 8:111270915-111270937 GGATGGAAAAACTACCTTATAGG - Intergenic
1048263582 8:132966043-132966065 GTAGATGAAGACTACCATTTTGG + Intronic
1050776098 9:9262495-9262517 GTAGCTAAAGGCTACTATATTGG + Intronic
1051550769 9:18326412-18326434 TTAGGTAAAAAATTACATATAGG - Intergenic
1053207673 9:36200840-36200862 GTAGCTAGTAGCTACCATATTGG + Intronic
1054943715 9:70772162-70772184 GTGAGTAACAGCTACCATATTGG - Intronic
1054959212 9:70948742-70948764 GAAGCTAAAGACTACCATTTGGG - Intronic
1055095200 9:72406155-72406177 GTAGCTAAAGGCTGCCATATTGG - Intergenic
1055159448 9:73107774-73107796 TTAGGTAAAAGCTACCATTGAGG - Intergenic
1055368199 9:75568752-75568774 ATAGGTAAAAAATAACATAGAGG - Intergenic
1056279505 9:85027578-85027600 GTGGGTAGAGGCTACCATATTGG - Intergenic
1059637921 9:116188552-116188574 GTTGCTAGGAACTACCATATTGG - Intronic
1061809192 9:133152609-133152631 GCAGGTAAAAACCACCTTAGTGG + Intergenic
1186344419 X:8677071-8677093 GTAGCTAGAAACTGCAATATTGG - Intronic
1186543933 X:10429132-10429154 GTATGTAAAAAATATCATTTCGG + Intergenic
1186971975 X:14856191-14856213 GTATTTATAAACTACAATATTGG - Intronic
1188628571 X:32320360-32320382 GTAGCTAATGACTACCATACGGG - Intronic
1188923291 X:36006820-36006842 GTAGGTACTGACTACCATATAGG - Intergenic
1194539587 X:95154735-95154757 GTAGGGAAATACTGACATATTGG - Intergenic
1194660182 X:96622301-96622323 ATAGATAAAAGTTACCATATAGG - Intergenic
1195106070 X:101602242-101602264 GTAGCTAATGACTACCATATGGG - Intergenic
1197172377 X:123448689-123448711 GTGGCTAGAAGCTACCATATTGG + Intronic
1197515500 X:127422922-127422944 GTAGAGAAAAACCACCAGATTGG + Intergenic
1198267574 X:135023443-135023465 GTAGGTCAGAAGTTCCATATGGG + Intergenic
1198424833 X:136506949-136506971 GTAGCTAGTAGCTACCATATTGG + Intronic
1198752279 X:139948021-139948043 GTAGGTAAAAAATAAAACATAGG - Intergenic
1200178184 X:154133181-154133203 TTAATTAAAAACCACCATATTGG + Intergenic