ID: 919866415

View in Genome Browser
Species Human (GRCh38)
Location 1:201786444-201786466
Sequence GCCTCTCCTTGGTCTCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919866415_919866418 -1 Left 919866415 1:201786444-201786466 CCAGGAGGAGACCAAGGAGAGGC 0: 1
1: 1
2: 4
3: 46
4: 361
Right 919866418 1:201786466-201786488 CGACATTCCCATACCATTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 34
919866415_919866419 0 Left 919866415 1:201786444-201786466 CCAGGAGGAGACCAAGGAGAGGC 0: 1
1: 1
2: 4
3: 46
4: 361
Right 919866419 1:201786467-201786489 GACATTCCCATACCATTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 78
919866415_919866417 -4 Left 919866415 1:201786444-201786466 CCAGGAGGAGACCAAGGAGAGGC 0: 1
1: 1
2: 4
3: 46
4: 361
Right 919866417 1:201786463-201786485 AGGCGACATTCCCATACCATTGG 0: 1
1: 0
2: 0
3: 11
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919866415 Original CRISPR GCCTCTCCTTGGTCTCCTCC TGG (reversed) Exonic
900704406 1:4071035-4071057 ACGTCTCCTTGGGCTCCTCTTGG + Intergenic
902990851 1:20186179-20186201 GCCTGCCCTTGGCCTCCGCCAGG + Intronic
903064090 1:20688854-20688876 CCTTCCCCTGGGTCTCCTCCAGG + Intronic
903448618 1:23437802-23437824 GGCCCTTCCTGGTCTCCTCCTGG + Intronic
904263913 1:29306900-29306922 GCCTCTCCTTGGTCTTGCCAAGG + Intronic
904587440 1:31588080-31588102 GCCTCTCCTCGGCCTGCTCTTGG + Intergenic
905204110 1:36333126-36333148 GAATTTCCTTGGTCTCCTCTTGG - Intergenic
905462098 1:38128741-38128763 CACTCTCCAAGGTCTCCTCCTGG - Intergenic
906141120 1:43534055-43534077 ACTTCTTCTTGGTCTCCTCTGGG - Intronic
907029701 1:51158306-51158328 GGATCTCCTTGCCCTCCTCCAGG + Intergenic
907546247 1:55262461-55262483 TTCTCTCCTGGGTCTTCTCCTGG - Intergenic
908408952 1:63843523-63843545 GGATCTTCTTGGTCTCCTCCAGG + Intronic
912910991 1:113759135-113759157 GCCTCTCCGGCGTCTCCGCCTGG - Exonic
915283911 1:154840992-154841014 GCCTGCCCCTGGTCTCCACCTGG - Intronic
916536724 1:165710343-165710365 GCACCTGCTTGTTCTCCTCCTGG - Intergenic
917780663 1:178392767-178392789 GCTTCTCCTTGATCTCCTTAAGG - Intronic
917975266 1:180233936-180233958 TCCTCTCCTGGGGCTCCTCCGGG + Intronic
918356496 1:183710078-183710100 GCCACAACTTGCTCTCCTCCAGG + Intronic
918577808 1:186084873-186084895 GCCTCGCCTTTTTCACCTCCAGG - Intronic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
920379985 1:205529575-205529597 GCCTCTCCCTGGGCCCCGCCGGG - Intronic
921132852 1:212234561-212234583 CCCTCTTGGTGGTCTCCTCCTGG - Intergenic
924146086 1:241076099-241076121 GCCTCTCTGTGGGGTCCTCCAGG - Intronic
924599935 1:245479816-245479838 CTCTCCCCTTGGTCTTCTCCAGG - Intronic
1062905123 10:1174632-1174654 GATTTTCCTCGGTCTCCTCCCGG + Intergenic
1063287814 10:4709441-4709463 GCTTCCCCTTGGCCTTCTCCAGG + Intergenic
1063538665 10:6910373-6910395 GCCTCTCTTTGGTCCCTCCCTGG + Intergenic
1064256985 10:13750743-13750765 GCCTCTCCTGGGTTTGATCCAGG + Intronic
1065239982 10:23695187-23695209 GCCTCTCCTCGCTCTCCCACTGG - Intronic
1065955894 10:30693248-30693270 CCTGCCCCTTGGTCTCCTCCTGG - Intergenic
1067044738 10:42979099-42979121 TCCTCTCCTTCCTCTCTTCCAGG - Intergenic
1067053635 10:43039105-43039127 GCTTCTCCCTGAGCTCCTCCAGG + Intergenic
1067720429 10:48723802-48723824 GCCTCACATGGGTCACCTCCAGG + Intronic
1069521484 10:69124615-69124637 GCCAGTCCCTGTTCTCCTCCCGG + Intronic
1069550364 10:69360084-69360106 GCATCCCCTTGGTTACCTCCAGG + Intronic
1069882729 10:71603643-71603665 TCCTCACCTTGCTCACCTCCTGG + Intronic
1071598249 10:86943220-86943242 GGCTCACCTGGGTCTCCTCCAGG + Exonic
1072608582 10:97002369-97002391 GCCTTTTCTCTGTCTCCTCCAGG - Exonic
1072631157 10:97147558-97147580 GCCTCACCTGGGTCTCCCACAGG - Intronic
1072835507 10:98707193-98707215 TCCTCTCCTGGGTCTCATCTTGG - Intronic
1073085061 10:100883046-100883068 GTCTCGCCTTTGTCACCTCCTGG - Intergenic
1074276371 10:112006172-112006194 ACTTCTCCTAGGTCTTCTCCTGG - Intergenic
1075810141 10:125219122-125219144 CCCTCTCCTTGGTCACCCGCTGG + Intergenic
1075960994 10:126567623-126567645 CCCTTTCTGTGGTCTCCTCCAGG - Intronic
1076219163 10:128719259-128719281 GTCTCTGCTTAGCCTCCTCCCGG + Intergenic
1076514435 10:131035862-131035884 GACACTCCTTGGTCTCATCCAGG + Intergenic
1076871902 10:133198596-133198618 CCCTCTCCTCGGACTCCTCCTGG - Exonic
1077101993 11:826418-826440 GCCCCTCCTGGCTCTCCTTCTGG - Intronic
1077289382 11:1781882-1781904 ACCTCGCCTTGGTCTCCACATGG - Intergenic
1077480420 11:2812003-2812025 GCCTCTCGTTCCTGTCCTCCTGG + Intronic
1077888630 11:6403640-6403662 GCCTCACCTGGGACTCCTCTTGG + Exonic
1078664453 11:13313194-13313216 GCCTCTCCTGGGTCGGCTCCCGG + Intronic
1078758884 11:14235858-14235880 CTCTCTCCTTTGTTTCCTCCAGG - Intronic
1079210886 11:18459774-18459796 GTATCTCCTTGGGCTCCTCTAGG + Intronic
1080418586 11:32091424-32091446 GCCTCTCCTTGCTCTCGTCCGGG - Exonic
1081803795 11:45878246-45878268 GCCTATCCTTGGGCTCCTTAAGG + Intronic
1083159797 11:60848023-60848045 GCCTCTCCTTCTCCTCCTCCAGG - Exonic
1083592121 11:63902027-63902049 GTGTCTCCAGGGTCTCCTCCAGG + Intronic
1083932990 11:65856080-65856102 GGATCTCCTTGCCCTCCTCCAGG + Exonic
1084064022 11:66693179-66693201 CCCTCACCTTGGCCTTCTCCTGG + Exonic
1084535435 11:69753555-69753577 TCCCCTCCCTGTTCTCCTCCAGG - Intergenic
1084957414 11:72698659-72698681 GCCTCTGCTTGCTCGCCTCCAGG + Intronic
1087118287 11:94545738-94545760 GCCTCCCCTGGGTCGCTTCCAGG - Exonic
1087239020 11:95754869-95754891 TCTACTCCTTGGTCTTCTCCAGG + Intergenic
1087504597 11:99003478-99003500 GCCTCTACCTGGTCTCTCCCTGG - Intergenic
1088459751 11:110070199-110070221 GCCTCTGATCTGTCTCCTCCTGG + Intergenic
1088830466 11:113532221-113532243 GGCTCTGCTTGTTCTCCTCCAGG - Intergenic
1088909212 11:114178078-114178100 TCATTTCCTTGATCTCCTCCTGG + Intronic
1089280118 11:117368372-117368394 GCCTCTCATGGCTCACCTCCAGG - Intronic
1089392843 11:118113812-118113834 GCCCCTGTTTGCTCTCCTCCAGG + Intronic
1089453170 11:118610685-118610707 GCCCTTCCTTGGCCTCCTTCAGG + Intronic
1092262062 12:6958196-6958218 GCTTCTCCTGGGTCCCCTCATGG + Intronic
1092847405 12:12596584-12596606 GCCTCTCCTCTCTCTCCTCTAGG + Intergenic
1095939359 12:47716129-47716151 ACCTCTCCTTGGCTTCCCCCTGG + Intronic
1095981437 12:47976885-47976907 GCCTCTCCTTTGTCACCTCTGGG + Exonic
1096500867 12:52063205-52063227 GGCTCCCCGTCGTCTCCTCCTGG + Intergenic
1096584894 12:52613681-52613703 GCCTCACCTTGGTCTGGTACAGG + Exonic
1097022777 12:56032631-56032653 ACCGCTCCTTGTGCTCCTCCAGG - Exonic
1097241186 12:57576331-57576353 GCTTCTCGTTGATCTCGTCCCGG - Exonic
1098891507 12:76014131-76014153 GGCTGCCCTTGGTCTCCCCCAGG + Intergenic
1100339065 12:93660621-93660643 GCCTCTCCTATGTCACCTCTTGG + Intergenic
1100685539 12:96983161-96983183 GCCTCTCGTTCCCCTCCTCCAGG - Intergenic
1101427172 12:104597830-104597852 ACATCTCCCTAGTCTCCTCCTGG - Intronic
1101824697 12:108210979-108211001 GGCACTCCTGGGTCCCCTCCTGG + Intronic
1102529686 12:113536990-113537012 GGCTCTCTTTTGTCTCCTGCAGG - Intergenic
1102768793 12:115455292-115455314 GCCCCTCCTGCGGCTCCTCCAGG - Intergenic
1102880717 12:116482598-116482620 GCCTCCCCTTAGTCTCCGCGGGG + Intergenic
1103209188 12:119154368-119154390 GCCTCACCTGGTTATCCTCCGGG - Exonic
1103465741 12:121140638-121140660 GCCTCTCCTTGGTCTTCTTCAGG - Intronic
1103489816 12:121308557-121308579 TCCTCTCCTGGGTCTTCCCCAGG + Exonic
1103504901 12:121435748-121435770 GACTCTCCTTGATCTCCTAAGGG - Intronic
1104312253 12:127663916-127663938 GCCTCTGCCTGGCATCCTCCAGG + Intergenic
1104763672 12:131313212-131313234 GCCTCTGCTTGGGGTCCTGCGGG + Intergenic
1105505747 13:21008237-21008259 GGCTCTCCTGGGACTCCTGCTGG + Intronic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1107942951 13:45391099-45391121 GCCTCTCCTTGCTCTCGTCCGGG + Intergenic
1108530881 13:51325898-51325920 CACTCTCCTTGGTCTCCAGCTGG + Intergenic
1108685501 13:52815592-52815614 GCCTCTCCTTCCACACCTCCCGG + Intergenic
1112161027 13:96868079-96868101 GCAACCTCTTGGTCTCCTCCAGG + Intergenic
1112936712 13:104809596-104809618 GCCTCTCCTTAGCCTCAGCCTGG - Intergenic
1113849086 13:113407838-113407860 CCGGCTCCTTGGTCTTCTCCAGG + Intergenic
1113914395 13:113862199-113862221 GCCCCTCCTCGCTGTCCTCCAGG - Intronic
1114082985 14:19218026-19218048 GCTTCTCTTTGGCCACCTCCAGG + Intergenic
1114266341 14:21074670-21074692 GCCTCCCCTGAGTCTCCCCCAGG + Exonic
1117610520 14:57478537-57478559 GTTTCTCCTTGGTCCCCTCCAGG + Intronic
1119298666 14:73553167-73553189 GCCTCCCCTTCTTCTCCCCCAGG + Intronic
1119302955 14:73585345-73585367 GCCTCCCCTTCTTCTCCCCCAGG + Intergenic
1119675518 14:76550719-76550741 GCCTCTCTTTGGTAGACTCCTGG + Intergenic
1120037049 14:79709649-79709671 GCCTCTCCACTTTCTCCTCCCGG + Intronic
1121780260 14:96617680-96617702 GCCTCTCCCTGGGCTCATCCAGG - Intergenic
1122362679 14:101176618-101176640 GGCTCCCCTGTGTCTCCTCCAGG - Intergenic
1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG + Intergenic
1122523475 14:102363179-102363201 GCCCCTCCTCGGCCTCCCCCGGG + Intronic
1122810618 14:104285956-104285978 GCCTCTCCTTGTCCTGCTCCTGG - Intergenic
1122849375 14:104519162-104519184 ACGTCTCCTTAGGCTCCTCCTGG - Intronic
1122959428 14:105087704-105087726 GCCTCTGCGGGGGCTCCTCCGGG - Intergenic
1123880815 15:24676302-24676324 CCCACACCTCGGTCTCCTCCAGG - Exonic
1124354166 15:28983093-28983115 GCCTCTCCAGGGTCTGCACCAGG - Intronic
1125715192 15:41815684-41815706 GCATCAGCTTTGTCTCCTCCAGG - Exonic
1125766109 15:42137585-42137607 GGCTCTGCTTGGTCTACTGCGGG - Intergenic
1126666274 15:51078452-51078474 GGCCCTCCTTAGCCTCCTCCAGG + Intronic
1126904549 15:53350279-53350301 ACGTCTCCTTAGTCTCCTCTTGG - Intergenic
1127347468 15:58114808-58114830 GCCTCTCCTGTATCTCCTCTTGG + Intronic
1127382939 15:58445190-58445212 GCGCCTTCTTGGTCTCCTGCCGG - Intronic
1127407922 15:58672365-58672387 GCTGCTTCTTGTTCTCCTCCTGG - Intronic
1127619683 15:60721410-60721432 GCCCAGCCTTGGTCTCCTCAGGG - Intronic
1127976146 15:63998606-63998628 GATTCCCCTGGGTCTCCTCCGGG - Intronic
1129423334 15:75447743-75447765 GAGTCTTCTTGGTGTCCTCCAGG - Intronic
1130904941 15:88233695-88233717 TCCTCTCCTCCCTCTCCTCCTGG + Intronic
1131073482 15:89480300-89480322 GTCTCTCCTTGCTCTGCTCTAGG + Exonic
1131990051 15:98084318-98084340 GCCTCTACCTGGTCCCTTCCAGG - Intergenic
1132196680 15:99918965-99918987 GGCTCTCCTGGGTCTCCAGCTGG - Intergenic
1132556318 16:574281-574303 GGCTCTCCTCGGGCTCCTGCCGG - Exonic
1133363042 16:5189074-5189096 TTCTCTGCTTGGTCTCCTCAAGG + Intergenic
1133847126 16:9465665-9465687 CCCTCTCTTTGGGCTGCTCCTGG + Intergenic
1134136418 16:11679362-11679384 TCCTCTCCATGGTCGCCACCAGG + Exonic
1134830516 16:17319085-17319107 GCCTCTCCTTATTCTCTTGCTGG + Intronic
1135415403 16:22264910-22264932 GCCTCTTCCCTGTCTCCTCCAGG + Intronic
1135496271 16:22954269-22954291 GTGCCTCCTTGGTTTCCTCCAGG - Intergenic
1135767713 16:25192264-25192286 GCTTCTCCAGGGTCTCCTGCAGG - Intergenic
1135983338 16:27165825-27165847 GCACCTCCTTGGTCTCACCCTGG - Intergenic
1136109124 16:28053586-28053608 GCCTCGCCTTGCTCTTTTCCAGG - Intronic
1136165547 16:28450666-28450688 GCCTCTGCTTGGGTTCCTGCTGG + Intergenic
1136197425 16:28664343-28664365 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136213764 16:28778490-28778512 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136258498 16:29058414-29058436 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136272666 16:29157913-29157935 GCCTCTCCTGGTTCTCCTCTGGG + Intergenic
1136281196 16:29212395-29212417 TCCCCTCCTTCCTCTCCTCCTGG - Intergenic
1137005100 16:35268740-35268762 CCCACTCCTTGTTCCCCTCCTGG - Intergenic
1139663575 16:68439339-68439361 GCCAGACCCTGGTCTCCTCCTGG + Intronic
1139755357 16:69138603-69138625 GCCCATCCTTGGGCTCCACCTGG + Intronic
1140729379 16:77842396-77842418 GTTGCTCGTTGGTCTCCTCCAGG - Intronic
1141160843 16:81628200-81628222 ACCTCCCCTGGGTCGCCTCCTGG + Intronic
1141468095 16:84220351-84220373 GCCTTTCCTTGGAGTCCTCCAGG - Exonic
1141542197 16:84734104-84734126 GCCCCTCTGTGGGCTCCTCCGGG + Intronic
1142076218 16:88119727-88119749 GCCTCTCCTGGTTCTCCGCTGGG + Intergenic
1142085560 16:88178318-88178340 TCCCCTCCTTCCTCTCCTCCCGG - Intergenic
1142400569 16:89856172-89856194 GCTCCTGCTTGATCTCCTCCAGG - Exonic
1142994284 17:3751614-3751636 CCCTCTCCTTCCTCTCCTCTGGG - Intronic
1143937120 17:10497826-10497848 GCCTCTGCTTCGTCTTCTCAAGG + Exonic
1144483236 17:15644585-15644607 CCATCTCCCTGATCTCCTCCAGG - Intronic
1144669863 17:17126824-17126846 CGATCTCCTTGGTCTCCGCCCGG - Exonic
1144877974 17:18412231-18412253 GACTCTCCTGGGTCTCCTGTTGG - Intergenic
1144915450 17:18720444-18720466 CCATCTCCCTGATCTCCTCCAGG + Intronic
1145154255 17:20532194-20532216 GACTCTCCTGGGTCTCCTGTTGG + Intergenic
1146502009 17:33372581-33372603 ACCTCACCTTGGTCTCCACATGG + Intronic
1146652450 17:34614972-34614994 ACCTTTCCTTGGCCTCCTCTTGG + Intronic
1146737043 17:35247376-35247398 GCCTCTGCTTGTTCTCATCCAGG + Intronic
1146835703 17:36108812-36108834 GCCTCTGCTTGCTCGGCTCCTGG - Intergenic
1146850334 17:36216081-36216103 GCCTCTGCTTGCTCGGCTCCTGG - Intronic
1147239855 17:39083576-39083598 GCCTCTCCTTGGGCTCCAAAGGG + Intronic
1147840641 17:43369056-43369078 CCCCCTCCTGGGTCACCTCCTGG - Intergenic
1148072298 17:44915433-44915455 GCCGCTCCTACGTCTCCTCAGGG - Exonic
1148113815 17:45162844-45162866 GACTTACCTTGGCCTCCTCCAGG - Exonic
1148825927 17:50394212-50394234 GCCACTCCTTGCTGTACTCCAGG - Intronic
1149256103 17:54828574-54828596 GCCTCTCCTGTGTCTCCTCTTGG + Intergenic
1149589990 17:57821865-57821887 GCCTCTCCTTGGCTGGCTCCTGG + Intergenic
1150847026 17:68669722-68669744 ACCACTGCTTGGTCTCCTTCAGG - Intergenic
1151879303 17:76885559-76885581 CCCTGCCCTTTGTCTCCTCCTGG + Intronic
1152151570 17:78604419-78604441 GCCTCTGCTTGTTCTCATCTGGG + Intergenic
1152427129 17:80224146-80224168 TCCTGTCCTTGGTCTTCTCATGG - Intronic
1154333396 18:13447966-13447988 GCCACCCCTTGGCCTCCCCCAGG - Intronic
1154499692 18:14989701-14989723 GCTTCTCTTTGGCCACCTCCAGG + Intergenic
1155982570 18:32196385-32196407 AGCTCTCCTTGGTCTTCTCCTGG + Intronic
1156036095 18:32769979-32770001 CCAGCTTCTTGGTCTCCTCCAGG + Exonic
1157424655 18:47574592-47574614 GCCTCTCAATTGTCTGCTCCTGG - Intergenic
1157993212 18:52522355-52522377 GCCTCCTCTTGTTCTCTTCCAGG + Intronic
1158249114 18:55467029-55467051 CCCTTCCCTTGGTCTCCTGCTGG + Intronic
1158515143 18:58124399-58124421 GCTCCTCCTTGGTCTCCCTCTGG + Intronic
1158803812 18:60945711-60945733 GCCTGTGATTGGTCACCTCCTGG + Intergenic
1160229375 18:77034781-77034803 GCCTCTCCTTGGTGGGCTCCTGG + Intronic
1160702900 19:517238-517260 CCTCCTCCCTGGTCTCCTCCAGG - Intronic
1160810526 19:1011108-1011130 GCCTGGCCCTGGTCACCTCCTGG - Exonic
1160983650 19:1827768-1827790 CCGTCTCCTTGGTCTCCCGCAGG + Exonic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161513378 19:4683649-4683671 ACCTCTCAGTGGCCTCCTCCCGG + Intronic
1162589405 19:11581006-11581028 ATCTCTCTCTGGTCTCCTCCAGG + Intronic
1163272969 19:16265344-16265366 GCCACTCCTTTATCTCCTGCTGG - Intergenic
1164581928 19:29439998-29440020 GCCTCTCCCTCCTCACCTCCCGG - Intergenic
1165348586 19:35264555-35264577 GCCAGTCCTTGGTTTCCTTCAGG + Intronic
1166096244 19:40541288-40541310 GCCACTCCCTTGTCTCCTCTGGG - Intronic
1166357460 19:42235596-42235618 CCCTGTGCTTGGTCTCCTCCAGG + Intronic
1166867915 19:45852223-45852245 GCCTCTCAGTGGTGGCCTCCAGG + Intronic
1167771360 19:51521611-51521633 GCCTCTCCCTGGGCTTCCCCTGG + Intronic
1167787055 19:51645588-51645610 GCCCCTCCTTGGGTCCCTCCCGG - Intronic
925290691 2:2746609-2746631 GTGTCTCCTTGGGCTCCGCCTGG + Intergenic
926139706 2:10360957-10360979 TTCTCTCCACGGTCTCCTCCTGG + Intronic
927151480 2:20198795-20198817 GCCTCACCTTGCTCTCCTACAGG - Intergenic
927214100 2:20656735-20656757 GCCTGCCCTGGGCCTCCTCCAGG - Intergenic
927986813 2:27417239-27417261 GCCTCTCCCGTGTCTCCTCTTGG + Intergenic
928371177 2:30741287-30741309 TCCTGTCCTTGGCCTCTTCCTGG + Intronic
928778058 2:34790498-34790520 GCGTCTCCTTCGTCTCTACCAGG - Intergenic
929048840 2:37816825-37816847 GCAGCACCTTGGGCTCCTCCAGG - Intergenic
929104730 2:38353487-38353509 GCCTCACTTTGTTCTCCTTCTGG - Intronic
931918235 2:66982924-66982946 GGCTCTCTTTGGTCACTTCCTGG - Intergenic
933041168 2:77468731-77468753 CTCTCTCCCTGCTCTCCTCCTGG + Intronic
935787716 2:106563901-106563923 GCCTCTCCTTCCTCTTCTTCGGG - Intergenic
936444956 2:112587920-112587942 GCCTCTCTCTGGTCTCCTTGTGG + Intronic
938090344 2:128427191-128427213 GCCTTTACCTGGTTTCCTCCAGG + Intergenic
938493589 2:131778611-131778633 GCTTCTCTTTGGCCACCTCCAGG - Intergenic
938498902 2:131820054-131820076 GCTTCTCTTTGGCCACCTCCAGG + Intergenic
943678913 2:190747064-190747086 GCTTCTCCTTGTTTTCCTCGTGG + Intergenic
944936549 2:204575634-204575656 GCCCCTGCCTGTTCTCCTCCTGG + Intronic
946023965 2:216660747-216660769 GCAGCTTCTTGGGCTCCTCCAGG - Exonic
947451478 2:230212779-230212801 GCCTCTCCCTGCACTCATCCAGG - Exonic
947848642 2:233266001-233266023 ACCTCTCCTTGTTCTCTTGCAGG - Intronic
948488083 2:238293985-238294007 ACCTCTCCTTGGGCTCCTTCAGG - Intergenic
948602466 2:239115244-239115266 GCTCCTCCTCCGTCTCCTCCGGG + Exonic
948854196 2:240722476-240722498 GCCTCTCGTTGGGAGCCTCCAGG + Exonic
1168939301 20:1695225-1695247 ACTCCTCCTAGGTCTCCTCCTGG - Intergenic
1170584940 20:17727568-17727590 GCCGCATCTGGGTCTCCTCCTGG - Intronic
1170847685 20:19975642-19975664 GGCACTCCTTGTTCTCCTGCAGG - Exonic
1171485032 20:25480154-25480176 CCCTCACCTTGGTCTCCAGCTGG + Exonic
1171978548 20:31610802-31610824 GCCCCTCCCTGTGCTCCTCCTGG - Intergenic
1174059262 20:47821129-47821151 GCCTGTTCTTGTTCTCTTCCTGG + Intergenic
1174452077 20:50626516-50626538 GCCTCTCGTTGGCCCCTTCCTGG - Intronic
1175286443 20:57839982-57840004 TCCTCTGCCTGGTCACCTCCTGG - Intergenic
1175596992 20:60243190-60243212 TCCTAGCCTTGGTCTGCTCCTGG + Intergenic
1176037826 20:63048990-63049012 CCCTCTCCCCGGGCTCCTCCTGG - Intergenic
1176246472 20:64099591-64099613 GCCTCTCGCTGGTCTCCTGAAGG - Exonic
1176254758 20:64146187-64146209 GCCCCTCCTGGGTCCCATCCTGG + Intergenic
1178896580 21:36563802-36563824 GTCTCTGCGTGGTCTCCTCTGGG + Intronic
1179112589 21:38460238-38460260 GCCTTTCCTGGTTCACCTCCTGG - Intronic
1179721693 21:43319978-43320000 CCCTGTCCTTGGTTTCCTCTGGG - Intergenic
1179726970 21:43346282-43346304 GCCTGTCCTTCCTGTCCTCCTGG + Intergenic
1180131663 21:45830621-45830643 GGCAGTCCTTGGTGTCCTCCTGG - Intronic
1180219703 21:46350755-46350777 GTCTCTCCCTGGTCCCTTCCAGG + Intronic
1180497794 22:15904655-15904677 GCTTCTCTTTGGCCACCTCCAGG - Intergenic
1180911758 22:19455653-19455675 GTCTGTCCTGGCTCTCCTCCAGG - Intronic
1181581264 22:23829344-23829366 GCCTGTCCCTGGTCTCCTCTCGG - Intronic
1182711069 22:32323688-32323710 GCCTCTGCTTGGTTTCCCCCAGG + Intergenic
1182878006 22:33708919-33708941 GCCTCTCCTTGGCCTGCAGCTGG + Intronic
1183230457 22:36578802-36578824 ACCTCTCCTGGGTCTGATCCTGG + Intronic
1183454002 22:37911698-37911720 GCCTCTGCTTGGATGCCTCCAGG + Intronic
1184168668 22:42745582-42745604 GCCTCTCCTCGCTCAACTCCTGG - Intergenic
1184245280 22:43232700-43232722 GCCTCTGCTTGCACACCTCCAGG + Intronic
1184387843 22:44186444-44186466 GCCTCTCTGTTGCCTCCTCCAGG + Intronic
1184427180 22:44417795-44417817 GTATCTCCTTGGGCTCCTCTTGG + Intergenic
1184884405 22:47333504-47333526 GCCTCTCCTTCTTCTTCTCCAGG - Intergenic
950536815 3:13583626-13583648 GCCTCTCCCTGGTACCTTCCTGG + Intronic
950697483 3:14714485-14714507 GCCTCTCCTTCACCTACTCCTGG - Intronic
951875818 3:27424122-27424144 GCCTCTCCCCAGTCTGCTCCTGG - Exonic
953413744 3:42703850-42703872 GCGTCTCCTTGCTGTTCTCCAGG - Intronic
953627165 3:44580615-44580637 CGATCTCCTTGGTCTCCGCCCGG + Intronic
953881827 3:46694780-46694802 GCCCCACATTGCTCTCCTCCTGG + Intergenic
954752724 3:52822861-52822883 GTCTCTGCTGGGCCTCCTCCAGG + Intronic
955703737 3:61707383-61707405 GGCTCTCCTGGGTCTCCAGCTGG - Intronic
957931162 3:86880063-86880085 TCCTCTCCCTGCTCTCCACCAGG + Intergenic
959293341 3:104502869-104502891 GCTCCTCCTTGGTCTTCACCAGG - Intergenic
961170720 3:124796054-124796076 GCCTCTTCTTGATTGCCTCCTGG - Intronic
961475810 3:127145597-127145619 TCCTCTCCCTGTCCTCCTCCTGG + Intergenic
962455791 3:135564318-135564340 TCCTCACCTTGGTCTCCTCTAGG - Intergenic
966847652 3:184143152-184143174 GCCCCTCCCTGTTCTCCTCGGGG + Intronic
967238288 3:187410375-187410397 ACTTCTCTTTTGTCTCCTCCTGG - Intergenic
968446377 4:654285-654307 GCCTGTCTGTGGTCTCCACCAGG + Intronic
968627562 4:1634029-1634051 GCCCCTCCCTGGGCCCCTCCTGG - Intronic
969629645 4:8328863-8328885 GCCTCCTCCTGGCCTCCTCCAGG - Intergenic
971294676 4:25377579-25377601 GCCTGTGCTGGGTCTGCTCCCGG + Intronic
972689210 4:41380357-41380379 GGCTGGCCTTGATCTCCTCCTGG + Intronic
979104245 4:116664368-116664390 GCAGCTCCTTGCTCCCCTCCTGG + Intergenic
982675737 4:158373886-158373908 GCCTCTCAGTGGTCCCCTCCTGG - Intronic
984943041 4:184951012-184951034 GCTTCAGCTTCGTCTCCTCCGGG - Intergenic
985486817 5:156544-156566 GCCCCACCTGGGTCCCCTCCAGG + Intronic
985591286 5:766746-766768 GCCTTTCCTTGGCCACCTTCAGG - Exonic
985822688 5:2170647-2170669 GTCTCTCTCTGGTCTCCTCAGGG - Intergenic
986332767 5:6729820-6729842 GCCTCCCCTGGGTTTGCTCCGGG + Intronic
987229547 5:15879345-15879367 GCCTCTGCTTGCCCTCCACCAGG + Intronic
988698075 5:33644212-33644234 GCCTCTCCTTTCTCTCCTTTTGG + Intronic
994555480 5:101295389-101295411 GCATCTCCTTAGGCTCCTCTTGG - Intergenic
995250361 5:109985940-109985962 ACCTTTCCTTTGTGTCCTCCAGG - Intergenic
995635843 5:114189240-114189262 GACTCTCCTGGGTCTCTGCCTGG - Intergenic
996944124 5:129046312-129046334 GGCTTTCCTTGTTCTCCACCTGG - Intergenic
997205558 5:132047101-132047123 GCCTCTCCATGGAAACCTCCAGG + Intergenic
997443028 5:133921983-133922005 TCTTCTCCTGGCTCTCCTCCAGG + Intergenic
998192029 5:140033721-140033743 GCCTCCCCCTGGTCTGCTTCTGG + Intronic
998215602 5:140236669-140236691 GCCTCTGCTTCCTCTCCTACAGG - Intronic
999321114 5:150615566-150615588 GTCTCACCATGGTGTCCTCCGGG + Intronic
999638816 5:153650442-153650464 GCCGCTCCTTTTTCTTCTCCAGG - Exonic
1000256679 5:159545718-159545740 ACCTCTCCTCTGTCTCCTCTAGG + Intergenic
1000447037 5:161334789-161334811 TCCTCTCCTGGGTCTCCTTCTGG - Exonic
1001058917 5:168471635-168471657 GCCTCTCCTTGGTCTAATCATGG - Intronic
1001318710 5:170663007-170663029 GCCTCTCCTAGGTGTCCTCAGGG - Intronic
1001636997 5:173217681-173217703 GTCTCTCCTTGGGCTCCCCAGGG + Intergenic
1001828341 5:174764605-174764627 GGCTCACCGTGGGCTCCTCCAGG + Intergenic
1002308113 5:178296246-178296268 GCCCCTCCTTCGTCTCATCTGGG - Intronic
1002382578 5:178840913-178840935 GCCTTTCCTTCTCCTCCTCCAGG - Intergenic
1002644842 5:180648064-180648086 GCCTGTCCCATGTCTCCTCCAGG + Intronic
1003256397 6:4478963-4478985 GCCTCACCTTGGTCACCTGTGGG + Intergenic
1003290541 6:4775860-4775882 GCCGCCTCTTGGGCTCCTCCTGG + Intronic
1003403625 6:5810595-5810617 GGCTCTCCTGGGTCTCCTGCTGG + Intergenic
1004146250 6:13069483-13069505 GCCTCTCCTTGGACCAGTCCTGG + Intronic
1004381029 6:15132646-15132668 TCCTCTCCTTGGGATTCTCCTGG + Intergenic
1006025888 6:31146494-31146516 GACACTCCTTGGCCTCCTCCTGG - Intronic
1006596015 6:35192848-35192870 TCCTGTCTTTGGCCTCCTCCTGG + Intergenic
1007380653 6:41488301-41488323 GCCCCTCCTCAGTCTCCTTCTGG + Intergenic
1007532592 6:42555973-42555995 ACCTCTGATTGGTCCCCTCCTGG + Intergenic
1007744794 6:44036950-44036972 GCCTGTGCTTGGTCTCCGCACGG - Intergenic
1007998168 6:46330620-46330642 CCCTCTCCTTGATCGCATCCTGG + Intronic
1010064750 6:71669141-71669163 GTGTCTCCTTAGGCTCCTCCTGG + Intergenic
1010924512 6:81727675-81727697 GGCTCTTCTTGGTCAACTCCTGG - Intronic
1011416171 6:87122428-87122450 GCCTCTCCTTGCTCTTGTCCGGG + Intergenic
1016987356 6:149905387-149905409 GGCTCCCCTGGGTCTCCTTCAGG - Intergenic
1017059362 6:150467820-150467842 ATATCTCCTTAGTCTCCTCCTGG + Intergenic
1017907565 6:158767470-158767492 GCTCCTCCTTGGTCTTCACCAGG + Exonic
1018398581 6:163400433-163400455 GACTATCCTTGGTCTCCTGTGGG - Intergenic
1019178780 6:170174850-170174872 GCCTGTCCCAGGCCTCCTCCTGG + Intergenic
1019783668 7:2959628-2959650 CCATCTCCCTGGTCTCCTCACGG + Intronic
1021584849 7:22197066-22197088 CGCTCTCCTGGCTCTCCTCCTGG - Intronic
1022064076 7:26832793-26832815 TATTCTCCTTGGTATCCTCCTGG - Intronic
1022100586 7:27166805-27166827 GCCTCGCCTTGGTTACCTACGGG + Intronic
1022140828 7:27491885-27491907 GCCTCTCCTACTCCTCCTCCAGG + Intergenic
1022552185 7:31251439-31251461 GCCTCTCCTGGCTCTGCTGCTGG - Intergenic
1022710538 7:32845039-32845061 CCCTCTCCTGGGCCGCCTCCAGG - Intergenic
1023000362 7:35801614-35801636 GCCTTTCCTCAGTCTCCTCCCGG + Intronic
1023368096 7:39485142-39485164 TCCTCACCTTGGTCTCCTCTAGG - Intronic
1023414418 7:39918706-39918728 CCCTCTCTCTGGTCTCCTTCTGG + Intergenic
1023852874 7:44159861-44159883 GCCTCTCCTTGGGCTCACCTGGG + Intronic
1024342617 7:48282640-48282662 GCCTTTCCTTGATTTACTCCTGG + Intronic
1024658614 7:51473003-51473025 GCCTCGCCTTGTTCTCCCTCTGG - Intergenic
1025021157 7:55481232-55481254 GCCTCTCCTGTGGCCCCTCCTGG - Intronic
1025235651 7:57232904-57232926 GCCTGTTCTTGTTCTCTTCCTGG - Intergenic
1026637294 7:72095587-72095609 GCCCCTCCCTAGTCTCCTGCAGG - Intronic
1026911123 7:74092612-74092634 GCCTCTGCGAGGTCCCCTCCAGG + Intronic
1029285225 7:99461094-99461116 GGCCCTCCATAGTCTCCTCCTGG - Intronic
1029515665 7:101021579-101021601 ACCTCTCCTTGGCCCCTTCCTGG + Intronic
1030188860 7:106790943-106790965 CCCTCCCCATGTTCTCCTCCAGG + Intergenic
1030867524 7:114717646-114717668 GCTTTTCCTTGGTCTCATTCAGG + Intergenic
1031963221 7:128008410-128008432 AGCACTCCTTGGTTTCCTCCGGG - Intronic
1032456387 7:132076235-132076257 GCATCTCTTTGGACTCCTCTCGG + Intergenic
1033742072 7:144283510-144283532 GTCCCTGCTTGCTCTCCTCCTGG - Intergenic
1033751830 7:144366104-144366126 GTCCCTGCTTGCTCTCCTCCTGG + Intronic
1034519070 7:151604779-151604801 GCATCTCCTCGGGCTCCTCCTGG + Intronic
1034967202 7:155398742-155398764 GTCTCCACTTGGTCTCCCCCAGG - Intergenic
1035594362 8:843506-843528 GCCTCTCCTGGGGTTCCACCGGG + Intergenic
1037476572 8:19263615-19263637 GCATGTCCTTGATCTCCTCCTGG + Intergenic
1038272312 8:26085253-26085275 ACGTCTCCTTGGTCTCCTTTGGG - Intergenic
1038349489 8:26763171-26763193 GGCTCTCCTTGGTGAGCTCCAGG + Intronic
1038617737 8:29110641-29110663 ACCTCTCCTTGGTCGGCTCCAGG - Intronic
1040639597 8:49317945-49317967 GGCTCTCCTTCCTCTGCTCCTGG + Intergenic
1040806874 8:51405153-51405175 GCCTCTCCTTCCACACCTCCTGG + Intronic
1040811266 8:51456258-51456280 GCCTCTCCTCTGTATGCTCCAGG + Intronic
1041588333 8:59547107-59547129 GCCTCTCCTTCCACCCCTCCCGG - Intergenic
1041613696 8:59881598-59881620 CTGTCTCCTTGGGCTCCTCCTGG - Intergenic
1044182908 8:89218054-89218076 GTGTCTACTTAGTCTCCTCCTGG - Intergenic
1045075286 8:98559438-98559460 GCCTTTCATGGGGCTCCTCCAGG - Intronic
1046071417 8:109259496-109259518 GGCTCTCATTTTTCTCCTCCAGG - Intronic
1048437803 8:134433867-134433889 TCCTCTCCTTCCTCTCCTGCTGG - Intergenic
1048941373 8:139403450-139403472 GCCTCTGCTTGCTCTCCTCTGGG + Intergenic
1049028353 8:140013246-140013268 GCCTCTCCGTGCACTCCTCCAGG + Intronic
1049572762 8:143377413-143377435 CCAGCTCCTTGGTCTCCTTCAGG - Exonic
1049615000 8:143572222-143572244 ACCTCTCCTAGCTCTCCTCCTGG + Intronic
1049643060 8:143724045-143724067 GCCTCTCCATGGACTCCAGCTGG + Exonic
1049681314 8:143919716-143919738 CCTTCTCCTTGGTGTCCTCCAGG + Exonic
1049853258 8:144845721-144845743 GCCTCTTCAGGGGCTCCTCCCGG + Intronic
1051136262 9:13925310-13925332 GACTCTCCTTGGTATCTTCCTGG - Intergenic
1051414452 9:16824475-16824497 GCCTGTCCTCAGTCACCTCCTGG + Intronic
1051852780 9:21528398-21528420 GCCTCTCCTAGGTCCCAGCCTGG - Intergenic
1051857825 9:21589508-21589530 CCCTCTCCTTGGTCTCCTCCTGG + Intergenic
1052314815 9:27105341-27105363 CCATCTTCTTGGTCACCTCCTGG + Intergenic
1053221391 9:36316073-36316095 ACCCCTCCTTTGGCTCCTCCTGG - Intergenic
1053357307 9:37457042-37457064 GCCACTCCTTGCTCTCATTCTGG - Intronic
1055393176 9:75845407-75845429 GCCTCACGCTGGTCTCCTTCAGG + Intergenic
1057302724 9:93896057-93896079 CCATCCCCTCGGTCTCCTCCAGG - Intergenic
1057383731 9:94590281-94590303 GCCTCTCCTTGGCTTTCTCATGG - Intronic
1059204144 9:112447625-112447647 GCCTCTGCTTGGTCAACTTCTGG + Intronic
1059378994 9:113908897-113908919 GCCTCTGCTTGGGCCCCTTCTGG + Intronic
1060062419 9:120472726-120472748 GCATTTTCTTGGTCTCCTCTGGG - Intronic
1060223445 9:121776272-121776294 GCTTCTGCGTCGTCTCCTCCTGG - Exonic
1061083063 9:128383688-128383710 GCCTCTCTTTGAACACCTCCAGG - Intronic
1061517208 9:131096780-131096802 GCCGCCTCTTTGTCTCCTCCAGG + Exonic
1061847427 9:133395486-133395508 GGCTCTCCCTGGTCTCCTCCTGG + Intronic
1062006630 9:134241699-134241721 TCCTCCCCTTGGGCTCCTCCTGG - Intergenic
1062539587 9:137035676-137035698 GTCTGTCCTTGTTCTCCTCCAGG + Exonic
1186758048 X:12693967-12693989 ACCACTCCATGGTCTCCTGCAGG + Intronic
1189219315 X:39357573-39357595 GCATCTTCTTGGGCTTCTCCTGG - Intergenic
1189882847 X:45509656-45509678 GCTGCTCCTTTGTCCCCTCCAGG - Intergenic
1190245188 X:48686116-48686138 GCACCTCCTTGGTCTCCACCTGG - Exonic
1193186475 X:78519634-78519656 GACTCTCCTTGGTTTTCTGCAGG + Intergenic
1194666262 X:96680940-96680962 GCCTTTTATTGGTCTCCCCCAGG + Intergenic
1195169076 X:102248473-102248495 ATTTCTCCTTAGTCTCCTCCAGG + Intergenic
1195189781 X:102438616-102438638 ATTTCTCCTTAGTCTCCTCCAGG - Exonic
1195320652 X:103719156-103719178 TCCTGTCCTGGGTCTCCTTCTGG - Exonic
1195328691 X:103778968-103778990 GCCTCTGCTTAATCACCTCCAGG + Intronic
1195616377 X:106915824-106915846 GTCTCTCCTTCCTCTTCTCCTGG + Intronic
1196824101 X:119727505-119727527 GCCTCTCCTTGTTCCACTGCTGG + Intergenic
1196976402 X:121162442-121162464 GCCCTGCCTTGGTCTCCTTCAGG + Intergenic
1199560950 X:149161824-149161846 GCCTCTCCTGGGACTCAGCCTGG + Intergenic
1199617806 X:149671656-149671678 GTCTCTCAATGGTCTACTCCAGG + Intergenic
1199624836 X:149731593-149731615 GTCTCTCAATGGTCTACTCCAGG - Intergenic
1200016102 X:153164857-153164879 GTCTCTCAGTGGTCTACTCCAGG + Intergenic
1200041800 X:153376035-153376057 GCCACTCCTTGGTCTCCAAAGGG - Intergenic
1202372893 Y:24210320-24210342 GCTTCTCCATGGCCTCCTGCAGG + Intergenic
1202497889 Y:25459800-25459822 GCTTCTCCATGGCCTCCTGCAGG - Intergenic