ID: 919869264

View in Genome Browser
Species Human (GRCh38)
Location 1:201808289-201808311
Sequence TTCAATCAGCATGAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919869264_919869267 -9 Left 919869264 1:201808289-201808311 CCTTTCTTCTCATGCTGATTGAA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 919869267 1:201808303-201808325 CTGATTGAATATCAATGGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919869264 Original CRISPR TTCAATCAGCATGAGAAGAA AGG (reversed) Intronic
902811936 1:18892874-18892896 ATCTACCATCATGAGAAGAATGG + Intronic
904723203 1:32526670-32526692 TACAACCACCATGAGAAAAAGGG + Intronic
905997259 1:42391981-42392003 TTGAAACAACATGAGATGAAAGG - Intronic
907396846 1:54196885-54196907 TTCAGGCAGAATGAGAAGACAGG + Intronic
907550452 1:55300504-55300526 TTCATTTAGCCTGAGATGAAGGG - Intergenic
908442282 1:64167155-64167177 TTCAGTCAGCCTGAAAATAAAGG - Intronic
909181753 1:72433145-72433167 CACAATCAGCATGAGAAAAGGGG + Intergenic
909713140 1:78674550-78674572 TTCAGTCAGCCTGTGAAGCAGGG + Intergenic
910109360 1:83666237-83666259 TGCAGTCAGAATGACAAGAATGG - Intergenic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
911811995 1:102294940-102294962 TTCACTCACTATGACAAGAACGG - Intergenic
912011831 1:104976291-104976313 TTCTATTAGAATGTGAAGAAAGG + Intergenic
912126257 1:106542596-106542618 TGCTATCACCATGTGAAGAAGGG - Intergenic
913531260 1:119735869-119735891 TCCACCCAGCAAGAGAAGAAGGG - Intronic
915811976 1:158922790-158922812 TGCAATGAACATGAGATGAATGG + Intergenic
916285562 1:163101209-163101231 TTAAATCAGCAGGCTAAGAAGGG + Intergenic
918218947 1:182418238-182418260 TTCAAACAGCAGGGGAAGACAGG + Intergenic
918702177 1:187618797-187618819 TTCAGTCAGCAGGTGAAAAAGGG - Intergenic
919185800 1:194147461-194147483 TTTAGGCAGAATGAGAAGAAAGG - Intergenic
919869264 1:201808289-201808311 TTCAATCAGCATGAGAAGAAAGG - Intronic
921624403 1:217362391-217362413 TTCAGTAAGGATCAGAAGAATGG + Intergenic
921970964 1:221148731-221148753 TGCAACCAGCAAGAGAAGGAAGG - Intergenic
923861706 1:237898279-237898301 TTAGATCAGCAGGAGCAGAATGG + Intergenic
924524216 1:244832424-244832446 GTCAATCAGAAAGAAAAGAAAGG + Intergenic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1063583712 10:7332252-7332274 TTCAATAAGGCTGAGAAGAGTGG + Intronic
1063690573 10:8283299-8283321 TTCCACCAGCATCAGAAAAAAGG + Intergenic
1064338190 10:14462812-14462834 CTCACTCAGTATTAGAAGAACGG + Intergenic
1064635851 10:17366248-17366270 GTCAACCAGCATGGGAAAAAGGG + Intronic
1065484438 10:26223463-26223485 TTCTAGCAGCATGAGTATAAAGG + Intronic
1067169568 10:43895552-43895574 TTTAATCACCATCAGAAGTAGGG + Intergenic
1067243522 10:44516956-44516978 TTCCAAAAGCATGAGAAGAGGGG - Intergenic
1068049392 10:51930081-51930103 TTCATTCAGCCTTAGAAGGAAGG - Intronic
1068545278 10:58337526-58337548 TTCAGTGAGCTTAAGAAGAAAGG - Intronic
1071810284 10:89172460-89172482 TTTCATCAGCATGAGGATAATGG - Intergenic
1073159255 10:101375518-101375540 TACATTCAGCAGGAGAATAATGG + Intronic
1076051683 10:127339319-127339341 TTGAATCAGAGTGACAAGAAGGG + Intronic
1076221533 10:128737367-128737389 TTCAATAAGCATGTGCTGAATGG + Intergenic
1076677761 10:132156285-132156307 AGCAATCAGCATGAGCAGGATGG - Intronic
1078070349 11:8104573-8104595 TTCAGAGAGCATGAGATGAATGG - Exonic
1078291468 11:10014718-10014740 TTCAATTAGGATAAGAAGAAAGG - Intronic
1086158175 11:83691725-83691747 TACAATGAGAATGAGAAAAAAGG - Intronic
1086572653 11:88303346-88303368 TTCAATTGGCATGAGAAGTAGGG - Intronic
1087320201 11:96649088-96649110 TTAAAAGAGCATGAAAAGAATGG - Intergenic
1088778893 11:113114440-113114462 TTTAAGCAGCAGGAAAAGAAAGG + Intronic
1089016142 11:115166919-115166941 TTCATTCTGCCTCAGAAGAAAGG + Intergenic
1090849110 11:130555919-130555941 TTCAATCAACATGACAAAGAGGG + Intergenic
1091562935 12:1628719-1628741 TTTCATCAGCATGGGCAGAATGG - Intronic
1091598810 12:1903974-1903996 GTCCATCAACATTAGAAGAATGG + Intronic
1092393906 12:8107731-8107753 TACAATCAGAATGACAAAAAGGG - Intergenic
1092854266 12:12657864-12657886 TTCGATGAAGATGAGAAGAAAGG + Intergenic
1096844888 12:54401011-54401033 CACAATCATCATGAGAAGGAAGG + Intronic
1097163836 12:57070906-57070928 TAAAATCAGGATGAGAAAAAAGG + Intronic
1099158372 12:79208531-79208553 TTCGATCAGAATGAGAAGAGAGG + Intronic
1099488806 12:83261771-83261793 TTCAATCATTAGGAGAATAATGG + Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101038731 12:100732518-100732540 TACAAACAGAATGAGAAGACAGG - Intronic
1102411134 12:112719805-112719827 TTCTATCAGTATGACAAGATGGG - Intronic
1105891288 13:24684236-24684258 CTCAATCAGTATTAGTAGAAGGG + Intronic
1106066956 13:26362522-26362544 TTCCAAGAGCAGGAGAAGAAAGG + Intronic
1107144680 13:37047159-37047181 TTAAATCATCATGAGAAAACAGG + Intronic
1109146310 13:58784399-58784421 GTAAATAAGAATGAGAAGAAAGG - Intergenic
1109679627 13:65733188-65733210 TTCCAGCAGTATGGGAAGAATGG - Intergenic
1111857256 13:93654121-93654143 ATCATTCAGCATTAGAAGGAGGG - Intronic
1112407139 13:99131047-99131069 TCCAATGAGCTAGAGAAGAAGGG + Intergenic
1114852633 14:26399726-26399748 TTCAATGAGCAAGAGAGGACTGG - Intergenic
1115062933 14:29216039-29216061 TTCAACCAGCACGAGAAAACAGG - Intergenic
1115619892 14:35131241-35131263 TTCAATCAGAAAGAAAAGGATGG - Intronic
1115793543 14:36906818-36906840 TTCTATCAGCATCAGGAAAATGG + Intronic
1116160305 14:41259273-41259295 TTCAACAAGCATGACAAGCAAGG - Intergenic
1117035021 14:51719808-51719830 TTCAAGCAGTATAAGAAGAGTGG - Intronic
1121057378 14:90869514-90869536 TACAATCAGTAAGTGAAGAAGGG + Exonic
1125773743 15:42191770-42191792 TTCACTCGGCATCAGCAGAAAGG + Intronic
1127852570 15:62926649-62926671 GGCAATCAGGATGAGGAGAACGG - Intergenic
1127907119 15:63384131-63384153 TTCACTTAGCGGGAGAAGAAGGG - Intergenic
1129056979 15:72826970-72826992 TTCAGTCAGCATTAGACGAACGG - Intergenic
1130943718 15:88534427-88534449 TTCAAGCAGCAGGAGAACCAGGG - Intronic
1132300552 15:100772971-100772993 TTCAATTAGCTTGAGAGGGAAGG - Intergenic
1133604667 16:7374591-7374613 ATTAATCTGCATGAGATGAAGGG + Intronic
1134275173 16:12769597-12769619 TTTAATCAGCCTCAGCAGAAGGG + Intronic
1134674789 16:16082500-16082522 CACAAACAGCATGAGAATAAAGG - Intronic
1136397019 16:29998584-29998606 TGCAACCAGCATTAAAAGAAGGG - Intronic
1137648794 16:50100160-50100182 TTCTATCAGCATGTGAAAACCGG - Intronic
1140320733 16:73949329-73949351 ATCAATCAGGATGATCAGAAAGG + Intergenic
1140788644 16:78368227-78368249 TTCAATTAACATGAGTGGAATGG + Intronic
1143783130 17:9239927-9239949 TTCCAGCAGCGTGAGAAGAAGGG + Exonic
1144051116 17:11497875-11497897 GTCAATCAGCAAGAGAGGAATGG - Intronic
1145345810 17:21989801-21989823 TTGAATCAACATGAGTGGAATGG + Intergenic
1145345954 17:21990676-21990698 TGGAATCAACATGAGAGGAATGG + Intergenic
1148251781 17:46087829-46087851 TTTAATAACCATGAAAAGAAAGG + Intronic
1148368366 17:47073552-47073574 TTTAATAACCATGAAAAGAAAGG + Intergenic
1149622090 17:58053282-58053304 TTTAACAAGCAAGAGAAGAAGGG - Intergenic
1149951799 17:60996134-60996156 TTCACTCAGCATGAGATGGAGGG + Intronic
1150079415 17:62223477-62223499 TTCACACGGCAGGAGAAGAAAGG + Intergenic
1150517367 17:65827550-65827572 TTCTAGCTGCATGAGAACAAAGG - Intronic
1151261380 17:72918571-72918593 TACAACCAGCATCAGAAGAAGGG + Intronic
1151427735 17:74041898-74041920 TTCAACCAGCAAATGAAGAAAGG - Intergenic
1203174640 17_KI270729v1_random:110-132 TTGAATCAGCACGAGTGGAATGG - Intergenic
1153320377 18:3767875-3767897 TTGAATAAGCATGATAAGAGTGG - Intronic
1154353042 18:13602956-13602978 TTCAGTCAGAAAGAAAAGAAAGG + Intronic
1156363114 18:36401492-36401514 TTCCAAGAGCATGAGAAGGAGGG + Intronic
1156627868 18:38931517-38931539 TTCAAAGAGCAGGAGAATAAAGG + Intergenic
1156981724 18:43297610-43297632 TTCCATCAACAAGAGAAGAGAGG - Intergenic
1157719021 18:49909190-49909212 GTCACTCAGCATGAGAAGTATGG + Intronic
1158083106 18:53617289-53617311 TTCAATTCACATGAGAAGAATGG - Intergenic
1159504354 18:69315551-69315573 TTGATTCATTATGAGAAGAAAGG + Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1160918267 19:1507866-1507888 GCCAATCAGGATGAGGAGAAAGG + Intronic
1161728794 19:5946336-5946358 TTCAGTGACCTTGAGAAGAATGG + Intronic
1164144545 19:22504084-22504106 TCAAATCAGCAAGAGAAAAAAGG + Intronic
1166386019 19:42381712-42381734 TTCCACCTGCATGAGCAGAAAGG + Intergenic
1166567467 19:43774046-43774068 TTCAGCCAGCAAGAGGAGAAGGG + Intronic
1168127228 19:54291740-54291762 TACAATCAGTAAGTGAAGAAAGG + Intergenic
1168673751 19:58261204-58261226 TTCATTAATCATGAGAAAAATGG + Exonic
925798984 2:7578011-7578033 TTTAAAAAGCAAGAGAAGAAAGG - Intergenic
926118814 2:10229871-10229893 TTCAGGCAGCATGAAGAGAAGGG + Intergenic
926183468 2:10667538-10667560 TTCCACTACCATGAGAAGAAAGG + Intronic
929237914 2:39625994-39626016 TCAAAACAGGATGAGAAGAAAGG + Intergenic
929899971 2:45992445-45992467 TTCACGCAGAATGAGGAGAAAGG - Intronic
930801835 2:55450819-55450841 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
930802331 2:55455921-55455943 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
931077302 2:58730234-58730256 ATAAACCAGCATGAGAAGAGGGG + Intergenic
931505245 2:62919237-62919259 TTCAATCAGCAAGAGCAGACAGG - Intronic
931816043 2:65901728-65901750 TTCACTCTGCAAGAGAAAAATGG - Intergenic
932919343 2:75891811-75891833 TTCAACTAACATTAGAAGAAGGG - Intergenic
934196074 2:89838537-89838559 TTTAATCAACCTGAGTAGAACGG + Intergenic
936587549 2:113771544-113771566 TTCAGTAAGCCTGAGACGAAAGG - Intergenic
936695498 2:114942475-114942497 TTCATTCCGCATGGGAAGGATGG + Intronic
937661948 2:124440389-124440411 TTCAGACAGCCTGAGAAAAAGGG - Intronic
939004961 2:136776169-136776191 TAGATTCAGCATGGGAAGAAAGG + Intronic
939202994 2:139062677-139062699 TGCAATTAGCATCTGAAGAAGGG - Intergenic
939650791 2:144759422-144759444 TTATTTCAGCATGATAAGAATGG + Intergenic
939937097 2:148306000-148306022 TTAAATAAGCATGGCAAGAATGG + Intronic
940312393 2:152292261-152292283 CTCAATGAGAATGAGAGGAAAGG + Intergenic
941963644 2:171278393-171278415 TTCAATCTGCATTTGAAGATGGG - Intergenic
942504127 2:176623781-176623803 TTCAATTAGGAAGAGAGGAAAGG - Intergenic
943532542 2:189102172-189102194 TTCAGTCAGAATGAGAAAAATGG + Intronic
943803514 2:192092163-192092185 TTCAATCAGAAATAGGAGAAAGG - Intronic
945396067 2:209319997-209320019 TTTAATCAGAATGAGAAGAGAGG + Intergenic
945979751 2:216299597-216299619 TTCATTCACCATGAAAAGATAGG - Intronic
946073983 2:217058501-217058523 TTCCTTCAGCAAGAGCAGAATGG - Intergenic
946253919 2:218429906-218429928 GCCAATGAGCAGGAGAAGAAGGG + Exonic
947126751 2:226876896-226876918 TTCAAACAAAATGAGATGAATGG + Intronic
947210853 2:227707265-227707287 TTCTACCAGCAAAAGAAGAAAGG - Intronic
948562527 2:238864167-238864189 TTCCATCAGCATGGGGGGAAGGG + Intronic
1168845938 20:944753-944775 TTCCATCAGTAGGAGAAGACAGG + Intergenic
1169648607 20:7842214-7842236 ACCAATGAGCATTAGAAGAATGG + Intergenic
1171241462 20:23570362-23570384 TTAAATAAATATGAGAAGAATGG - Intergenic
1173760290 20:45553914-45553936 TTCAACCAAGATGAGAAGCATGG + Intronic
1174526986 20:51180354-51180376 TTCAATGCACATGAAAAGAATGG + Intergenic
1176890307 21:14308955-14308977 TTCAAGCTGCATGAGAAGAAAGG - Intergenic
1177658048 21:24045059-24045081 TGGAATCAGTATGAGAATAAAGG - Intergenic
1177665129 21:24147012-24147034 TATAATAAGCATGTGAAGAATGG + Intergenic
1177754785 21:25333253-25333275 TTCAAAAAGCAAGAGAAGAAGGG + Intergenic
1178210192 21:30521621-30521643 TTGAATTAGAATGATAAGAAAGG + Intergenic
1180518427 22:16170883-16170905 TTCACTCAGTATCACAAGAACGG - Intergenic
1180664477 22:17498931-17498953 TTCAATCAGCATAAGAAACACGG - Intronic
1184221752 22:43105302-43105324 TAAAATAAGCAGGAGAAGAAGGG + Intergenic
949503757 3:4706705-4706727 TTGAATCAGCAGGTGAACAAGGG + Intronic
949893869 3:8754625-8754647 TTCAAGCACCAAGGGAAGAAAGG + Intronic
954605061 3:51903091-51903113 TGCAATCAGCATTAGGGGAAAGG + Intronic
956343247 3:68249501-68249523 ATCAAACAGCATAAGAAGAGTGG + Intronic
957113237 3:75992818-75992840 TTCCATCAGCATGACATGGATGG + Intronic
957843879 3:85705166-85705188 TTAAATAAGAATGAAAAGAAGGG - Intronic
958704377 3:97635295-97635317 TTCAATCATCATGGTAATAACGG - Intronic
960574949 3:119220358-119220380 AGCAATCAGCATGAGAACAAGGG + Intronic
965520870 3:169667187-169667209 TTCAATTAAAATGAGAGGAAAGG - Intergenic
965778822 3:172261884-172261906 TTCCAGCTGCATCAGAAGAAGGG + Intronic
966040442 3:175479462-175479484 TTCAATCATCTTGTGAAAAATGG + Intronic
966579548 3:181545074-181545096 TTACATCAACATGATAAGAATGG - Intergenic
967599463 3:191367925-191367947 ATCAATCAGGAAGAGAGGAACGG - Intronic
967763231 3:193249046-193249068 TTCAAAAAGGAAGAGAAGAAGGG - Intronic
969334055 4:6496451-6496473 TACAATCAACATGTGATGAAGGG + Intronic
969340328 4:6536456-6536478 TTTAATCCACATAAGAAGAAAGG + Intronic
969743241 4:9049182-9049204 TCAACTCTGCATGAGAAGAAGGG + Intergenic
969878133 4:10151040-10151062 TTCAAACAGCTTGAGTAGATCGG - Intergenic
970205376 4:13650224-13650246 TTCATACAGCATGAGAATAATGG - Intergenic
970382253 4:15519756-15519778 TTCATTCACCATCATAAGAACGG + Intronic
970660690 4:18282030-18282052 TTCACTCAAGATGAGAAGACAGG + Intergenic
970669956 4:18385144-18385166 TTGAAGCAGAATGAGAAAAATGG + Intergenic
971356982 4:25903920-25903942 TTCCAAAAGCAGGAGAAGAAGGG + Intronic
971549169 4:27927758-27927780 TCCAATCAGCATAAGAAGGTGGG + Intergenic
972594515 4:40518062-40518084 TTCAATGAGGATGAGAAAATGGG + Intronic
975184585 4:71386516-71386538 TCCAAAGAGCATGGGAAGAAGGG - Intronic
975937387 4:79598449-79598471 TACAAGCAGCATGAGACGCATGG - Intergenic
977182402 4:93893067-93893089 GTAAATCAGAATGAGGAGAAAGG + Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
983484661 4:168318894-168318916 TTCAATCAGAATCTTAAGAAGGG + Intergenic
983892563 4:173045744-173045766 TCCAAGAAACATGAGAAGAACGG - Intergenic
984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG + Intergenic
985029285 4:185772698-185772720 TTCAAACATCATGAGATAAATGG + Intronic
986670981 5:10142356-10142378 TTCACTCAGTATCACAAGAATGG - Intergenic
987168835 5:15231399-15231421 TTCCACCAGCAAGAGCAGAATGG - Intergenic
987621437 5:20341848-20341870 TTCACTGATCATGAGAAGCAAGG + Intronic
987920549 5:24274532-24274554 TTGAATCAAAGTGAGAAGAAAGG + Intergenic
987984186 5:25124618-25124640 ATCAAACAATATGAGAAGAACGG + Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988593086 5:32566282-32566304 TTAACTCTGAATGAGAAGAAAGG - Intronic
989181010 5:38577176-38577198 TTAAGTCAGGATGAGAAGAAAGG - Intronic
992205744 5:74428849-74428871 TTTAATCTGAAAGAGAAGAATGG - Intergenic
992444385 5:76820510-76820532 CTTAATCAGCATCAGAATAAAGG + Intronic
992912352 5:81408381-81408403 TTCAATTAACATGGGAAGACAGG - Intergenic
993076386 5:83237251-83237273 TGCAATAAGCATGAGAATAAAGG - Intronic
993179070 5:84525277-84525299 TACACTCAGCATGAGAATATGGG + Intergenic
993920340 5:93793758-93793780 TACAATCAACATCTGAAGAAGGG + Intronic
994122463 5:96131913-96131935 TTCAATCAGCAAGAGTAGCAGGG + Intergenic
996164500 5:120208689-120208711 TTCACTCAGAATGAGAGAAAAGG - Intergenic
996302280 5:122003041-122003063 TTCATTCATAAAGAGAAGAAAGG + Intronic
996729825 5:126706166-126706188 TCCAGTCAGCTAGAGAAGAATGG - Intergenic
997043645 5:130287410-130287432 TTCACACAGCCAGAGAAGAAAGG - Intergenic
997879056 5:137573638-137573660 TCCAACCAGCATGAGGAGTATGG - Intronic
997992026 5:138552497-138552519 TACAAACTGCATGAGAAGATTGG - Intergenic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999376973 5:151093643-151093665 TTCTATCAGCATTTGAAAAATGG + Intergenic
999474334 5:151884617-151884639 TTTAATCACCATGGGAAGTAAGG + Intronic
1000216027 5:159157134-159157156 TTCAATCTGAATCAGAAGTAAGG + Intergenic
1000887901 5:166768278-166768300 TACAAGCAGCATGACAAAAATGG - Intergenic
1000974448 5:167749730-167749752 TGAGATCAGCATGAGAAGAAGGG + Intronic
1001128102 5:169038991-169039013 TTCAATCCCCAGCAGAAGAAGGG - Intronic
1005180731 6:23103126-23103148 TCCAGTCAGGATGAGCAGAATGG - Intergenic
1007507662 6:42348713-42348735 TTCACTAAGTATGAGCAGAAAGG + Intronic
1007547787 6:42707623-42707645 TTCACTCATAATGAGAAAAATGG - Intronic
1010050588 6:71499252-71499274 TTTAAAAAGCATGAGATGAAAGG - Intergenic
1010313546 6:74417881-74417903 TTCAATAAGGATGCCAAGAATGG - Intergenic
1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG + Intergenic
1012737324 6:102965725-102965747 TTTGATCAGCATGAGAAACAGGG - Intergenic
1013608061 6:111768924-111768946 TTGAATCAGCATGGGATAAAAGG + Intronic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014946837 6:127508789-127508811 TGTAATCATCAAGAGAAGAAGGG - Intronic
1014956908 6:127630950-127630972 TTCAACCAGCTTGAGAAGATAGG + Intergenic
1015806732 6:137117503-137117525 TTCAATCAACATCAAAAGATAGG - Intergenic
1016246657 6:141989777-141989799 TTCCATCAGAATGAGGAGAGAGG - Intergenic
1019372822 7:671903-671925 TTCATTCAGGATGGGCAGAAAGG - Intronic
1020963786 7:14840284-14840306 TGCAATAAGAATGATAAGAATGG - Intronic
1022458841 7:30585147-30585169 TGCAGTCAGCAGGAGATGAAGGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1028146955 7:87329481-87329503 TTAACACAGCATGCGAAGAAGGG + Intergenic
1030177181 7:106666595-106666617 TTCTTTCAGCATGTGAAAAAAGG - Intergenic
1032809717 7:135400093-135400115 TTTACTCAGCAGGAGAAGAAAGG + Intronic
1036088383 8:5637954-5637976 TACAAACAGCCTGAGAAGCATGG + Intergenic
1036252358 8:7173369-7173391 TCAACTCTGCATGAGAAGAAGGG - Intergenic
1036365136 8:8114091-8114113 TCAACTCTGCATGAGAAGAAGGG + Intergenic
1037149179 8:15615151-15615173 TTCAATAAACATGAGAGGACAGG - Intronic
1037292520 8:17366433-17366455 ATGAATCAGCATCAGCAGAATGG + Intronic
1037690408 8:21177020-21177042 TTCAACAAGCAGGAGAACAAAGG + Intergenic
1038174614 8:25169113-25169135 TTCTATCAGGGTGACAAGAATGG - Intergenic
1040643462 8:49369019-49369041 TGCACTCAGCCTGAGCAGAAAGG - Intergenic
1041028119 8:53707551-53707573 TTTAATCAGCCTAAGAAGACTGG + Intergenic
1041610275 8:59838449-59838471 ATAAATCAGCATGTGAAAAAAGG - Intergenic
1042390168 8:68225305-68225327 TTCACACAGCATCATAAGAAAGG + Intronic
1042472975 8:69212329-69212351 TTTCATCTGCATGAGAAGGATGG + Intergenic
1042734859 8:71976967-71976989 TGCCATCTGCATGAGAAGACTGG + Intronic
1042963589 8:74328196-74328218 TGCAATCAGTATCTGAAGAATGG - Intronic
1043254351 8:78114931-78114953 TTCCATCAGCAAGAAAGGAAAGG - Intergenic
1043440229 8:80270271-80270293 TTCACTGAGCATGTGACGAAGGG + Intergenic
1043687967 8:83112003-83112025 TACATTCAGTATCAGAAGAAAGG - Intergenic
1044084456 8:87926716-87926738 ATCAAACAGAATGAAAAGAAAGG + Intergenic
1046905349 8:119566392-119566414 TTGAAGCAGTATGAGAAGCATGG - Intronic
1050316898 9:4411580-4411602 TTAAAGCAGAATGAGAAGATGGG - Intergenic
1056658531 9:88528001-88528023 TTCAAAAAGCAGGAAAAGAATGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060554464 9:124501135-124501157 TCCACTCAGCATGATAAGAGTGG - Intronic
1061500297 9:130997996-130998018 TTCAGACAGCGTGAGTAGAAGGG - Intergenic
1203719569 Un_GL000216v2:3466-3488 TTGAATCAGCCTGAGTGGAATGG - Intergenic
1203719710 Un_GL000216v2:4469-4491 TTGAATCAGCCTGAGTGGAATGG - Intergenic
1203721619 Un_GL000216v2:17510-17532 TTCAATCAACCTGAGAGGAATGG - Intergenic
1203721704 Un_GL000216v2:18099-18121 TTGAATCAACATGAGTGGAATGG - Intergenic
1203721868 Un_GL000216v2:19278-19300 TTGAATCAACATGAGTGGAATGG - Intergenic
1203721872 Un_GL000216v2:19323-19345 TTGAATCAACATGAGTGGAAGGG - Intergenic
1203723003 Un_GL000216v2:27263-27285 TTCAATCAACCTGAGAGGAATGG - Intergenic
1203723091 Un_GL000216v2:27872-27894 TTGAATCAACATGAGTGGAATGG - Intergenic
1187070674 X:15884584-15884606 TGCAAACAGCAGGAGGAGAAAGG + Intergenic
1187301177 X:18051412-18051434 TTCAATCAGCATGTTTTGAATGG - Intergenic
1189607393 X:42694537-42694559 ATTAATCATCATGAGAAGAGAGG - Intergenic
1190035151 X:47016058-47016080 TCCAGTCAGCATGAAAAGAGTGG + Intronic
1190111909 X:47595385-47595407 TGCCATCAGCATTAGAAGTAGGG + Intronic
1192397319 X:70795131-70795153 TTCAGTCAGCTTGTGATGAATGG - Intronic
1193149413 X:78109197-78109219 TTCAAAAAGCCTGAGAAGAGAGG - Intronic
1194408285 X:93525371-93525393 GTGAGTCAGAATGAGAAGAATGG + Intergenic
1195623076 X:106977961-106977983 TTCAATAAGCATCATAAGATGGG + Intronic
1196232487 X:113240217-113240239 TTCAGTTAGCAAGAGATGAATGG + Intergenic
1197677854 X:129349313-129349335 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1198296738 X:135294711-135294733 TTCAATCTAAATGAGATGAAGGG - Intronic
1198855931 X:141016567-141016589 TTCAATCAGAAAGAAAAGGACGG - Intergenic
1198876200 X:141229544-141229566 TTCAATCAGAAAGAAAAGGATGG + Intergenic
1198906762 X:141570800-141570822 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1199932029 X:152532574-152532596 TTTAATCAGGGAGAGAAGAAGGG - Intergenic