ID: 919869738

View in Genome Browser
Species Human (GRCh38)
Location 1:201811323-201811345
Sequence TACCATGGACTACTACTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919869738_919869744 23 Left 919869738 1:201811323-201811345 CCCATTAGTAGTAGTCCATGGTA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 919869744 1:201811369-201811391 TAGCATATGTTCCCCAACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 92
919869738_919869745 24 Left 919869738 1:201811323-201811345 CCCATTAGTAGTAGTCCATGGTA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 919869745 1:201811370-201811392 AGCATATGTTCCCCAACTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 114
919869738_919869746 25 Left 919869738 1:201811323-201811345 CCCATTAGTAGTAGTCCATGGTA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 919869746 1:201811371-201811393 GCATATGTTCCCCAACTTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
919869738_919869741 -3 Left 919869738 1:201811323-201811345 CCCATTAGTAGTAGTCCATGGTA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 919869741 1:201811343-201811365 GTACCAGTGAAAATCCATCTAGG 0: 1
1: 0
2: 0
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919869738 Original CRISPR TACCATGGACTACTACTAAT GGG (reversed) Intronic
901609310 1:10484488-10484510 TACGATGGAATACTACTCAGCGG - Intronic
905023334 1:34833095-34833117 CACCAAGGACTACTGCTGATAGG - Intronic
907535995 1:55157880-55157902 TTCCCTGGACCACTGCTAATTGG + Intronic
907783972 1:57594016-57594038 TACCATGAACTACTCAGAATAGG + Intronic
908868045 1:68574589-68574611 TATAATGGAATACTACAAATTGG - Intergenic
909720736 1:78767046-78767068 CACCATAGACTACTTCTAATTGG - Intergenic
912315715 1:108666123-108666145 TACCAAGGACTTCAACTGATTGG + Intergenic
912542473 1:110427489-110427511 TTCCATGGACTTCTAGAAATGGG + Intergenic
916837928 1:168568043-168568065 TGCCATGGACTTCAAGTAATGGG - Intergenic
918382867 1:183974256-183974278 TAACATGGACTTCTAAGAATAGG - Intronic
919869738 1:201811323-201811345 TACCATGGACTACTACTAATGGG - Intronic
924320894 1:242848971-242848993 TACCAAGAAATACTTCTAATAGG + Intergenic
924577740 1:245295720-245295742 TTTCATGGACTAGAACTAATTGG + Intronic
1063206976 10:3841859-3841881 TACCATGGAATACTTTTCATTGG - Intergenic
1064849840 10:19698377-19698399 TGCCAAAGACTACTAATAATTGG + Intronic
1064951446 10:20855097-20855119 TAGCTGGGACTACTACTACTAGG - Intronic
1065614872 10:27510257-27510279 TGCCAGGGACTGCTACTAAGAGG + Intronic
1066655870 10:37699589-37699611 TACCATGGAATACTGCTCAGTGG + Intergenic
1067040319 10:42949511-42949533 TACCATGGAATACTGCTCAGTGG + Intergenic
1070235600 10:74622245-74622267 GGCAATGGACTACTACTAAGAGG - Intronic
1070568310 10:77620459-77620481 TCCCATGGACAAGGACTAATAGG - Intronic
1073787346 10:106904450-106904472 TACCATGGGCATCTACTGATGGG + Intronic
1074759873 10:116659139-116659161 TAACATGAACTACTACTAAATGG - Intergenic
1079830154 11:25255368-25255390 TCACCTTGACTACTACTAATTGG + Intergenic
1088575578 11:111267921-111267943 TAGCATGGAATACTAATAATTGG - Intronic
1089929368 11:122294261-122294283 TACAATGGAATACTACTCAGGGG + Intergenic
1097231206 12:57512359-57512381 TACCCTGGAAGACTACTGATGGG + Intronic
1097422586 12:59398686-59398708 TAACTTGGAATACTACAAATAGG + Intergenic
1111022168 13:82465523-82465545 TACCATAAACTACTAATAAATGG + Intergenic
1120074415 14:80139397-80139419 AAACATGGACTCCTACTCATGGG + Intergenic
1141176379 16:81722446-81722468 GACAATGGAATACTACTATTTGG + Intergenic
1167386873 19:49168609-49168631 TCCCCTGGACTACAACTACTCGG + Exonic
926876943 2:17491127-17491149 TACCATGTTCAACTATTAATAGG - Intergenic
933890277 2:86762247-86762269 TACCATGGGCCATGACTAATCGG - Intronic
1172372828 20:34408416-34408438 TACCATGGAATTCTACTGATGGG + Intronic
954952174 3:54485167-54485189 TACAGTTTACTACTACTAATAGG + Intronic
956061756 3:65355415-65355437 AACCATGGGCTTCTACTAAAAGG + Intronic
965216005 3:165865651-165865673 TCCCATGGAAAACAACTAATAGG + Intergenic
974650899 4:64752826-64752848 TACCAAGGACTGTTACTAAAAGG - Intergenic
978447342 4:108792097-108792119 AACCATGGAGTACCACTAAATGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
990388967 5:55299165-55299187 TAACATGGAGTAATGCTAATTGG - Intronic
991680954 5:69138832-69138854 TACCCTGGAATCCTACTACTGGG - Intergenic
996892113 5:128433507-128433529 TATAATGCACTATTACTAATGGG + Intronic
998863570 5:146471557-146471579 TACCATGGAGTACCAGGAATAGG - Exonic
1004238862 6:13900685-13900707 TAGCATGAGCTACTACTTATTGG - Intergenic
1004652707 6:17626710-17626732 TACCATGGACTGATATTAGTAGG + Intronic
1011976963 6:93313868-93313890 TACCATGGCCTAGTACTAACTGG + Intronic
1012606997 6:101169816-101169838 TATCATGGAGTACTACTATATGG - Intergenic
1022513557 7:30960277-30960299 TACAATGGAATACTACTGAGCGG - Intronic
1037032374 8:14125064-14125086 TACCAAGGAATACCACTAACAGG + Intronic
1037924416 8:22833213-22833235 TACCAGGGATTTCTTCTAATTGG - Intronic
1041312969 8:56535195-56535217 TACCACGTACAACTAGTAATAGG + Intergenic
1058667062 9:107328968-107328990 TACCATGTATTACTAATAATTGG + Intronic
1194931877 X:99898718-99898740 TACCATGGACTTTTATTTATTGG - Intergenic
1200380061 X:155827405-155827427 TACTACGAACTACTACTACTAGG + Intergenic