ID: 919878073

View in Genome Browser
Species Human (GRCh38)
Location 1:201885121-201885143
Sequence ACAGCAAGAAAGATTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 387}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919878070_919878073 14 Left 919878070 1:201885084-201885106 CCCACCAAGAGGACAAACAGGAG 0: 1
1: 0
2: 1
3: 24
4: 171
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387
919878072_919878073 10 Left 919878072 1:201885088-201885110 CCAAGAGGACAAACAGGAGACAG 0: 1
1: 0
2: 2
3: 42
4: 375
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387
919878065_919878073 30 Left 919878065 1:201885068-201885090 CCACTTGCTAGTCCCTCCCACCA 0: 1
1: 0
2: 2
3: 22
4: 269
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387
919878068_919878073 17 Left 919878068 1:201885081-201885103 CCTCCCACCAAGAGGACAAACAG 0: 1
1: 0
2: 1
3: 16
4: 239
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387
919878071_919878073 13 Left 919878071 1:201885085-201885107 CCACCAAGAGGACAAACAGGAGA 0: 1
1: 0
2: 2
3: 19
4: 249
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387
919878067_919878073 18 Left 919878067 1:201885080-201885102 CCCTCCCACCAAGAGGACAAACA 0: 1
1: 0
2: 0
3: 18
4: 291
Right 919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919878073 Original CRISPR ACAGCAAGAAAGATTAAAGC TGG Intergenic
901585601 1:10288646-10288668 AGAGCAAAACAGATTAAAGAAGG - Intronic
901735972 1:11312419-11312441 CGAGGAAGAAAGATTAAAGAGGG + Intergenic
902168435 1:14591447-14591469 ACACCAAGAAAGATTCAAGGAGG + Intergenic
904241495 1:29149151-29149173 GGAGCAAGAAAGAGAAAAGCAGG - Exonic
904404474 1:30276979-30277001 ACAGCAAGAAAGAGTCACACCGG + Intergenic
904459246 1:30665775-30665797 ACAGTTCGCAAGATTAAAGCTGG + Intergenic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
905646947 1:39631758-39631780 ACAGCAAGAAAGCGCAGAGCTGG + Intronic
905991211 1:42338375-42338397 AAAGAAAGAAAGAATAAAGCAGG + Intergenic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
908392035 1:63692116-63692138 ACAACACGATGGATTAAAGCTGG + Intergenic
908552891 1:65227522-65227544 ACAGCAAGAATTATTCAAGGTGG - Exonic
908664937 1:66479619-66479641 ACAGCTAAAAAAATTAAAGGGGG + Intergenic
908927175 1:69269907-69269929 AGGGCAAAAAACATTAAAGCTGG + Intergenic
909306364 1:74084229-74084251 ACAGTAATAAAGTTTAAAGATGG + Intronic
910146574 1:84086585-84086607 GCAGCAAGAAAGAGAAATGCAGG - Intronic
910247539 1:85156401-85156423 AGAAAAAGAAAAATTAAAGCTGG + Intergenic
910283861 1:85531302-85531324 ACAGCAAGAAAGAGTAGAAATGG - Intronic
911247398 1:95533991-95534013 ACAGCATGAAACAAAAAAGCAGG + Intergenic
912097390 1:106161947-106161969 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
912181918 1:107229345-107229367 ACAGCAAGCATTACTAAAGCTGG + Intronic
913373754 1:118129224-118129246 ACAACAACAAAAATTAAAGTTGG - Intronic
913686127 1:121233687-121233709 ACAGAGAGAAAGAAAAAAGCAGG - Intronic
914037979 1:144021308-144021330 ACAGAGAGAAAGAAAAAAGCAGG - Intergenic
914151475 1:145046631-145046653 ACAGAGAGAAAGAAAAAAGCAGG + Intronic
914206158 1:145531683-145531705 ACAGCAAGAAAGAGTAGAAATGG + Intergenic
914880467 1:151542530-151542552 ACATCAAGAAAGAGTAAAAGGGG - Intronic
916288892 1:163141697-163141719 ACATAAAGAGAGATTAAAGCGGG - Intronic
917657353 1:177139748-177139770 AAAGCAAGAAAGATTAGTGAAGG - Intronic
919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG + Intergenic
920107766 1:203566576-203566598 ACTGCAAGATGGATTAAAGTTGG + Intergenic
920237554 1:204518388-204518410 ACGGCAGGGAAGATTAAAGTGGG - Intronic
920473450 1:206252245-206252267 ACAGAGAGAAAGAAAAAAGCAGG - Intronic
922967964 1:229707667-229707689 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
923194253 1:231649881-231649903 AAAGCAAAAAAGAAAAAAGCAGG - Intronic
923396156 1:233567087-233567109 ACAGCAAGAAAGAGGAAGCCTGG - Intergenic
924423480 1:243930836-243930858 GCAGAAAGAAAGATTCCAGCAGG - Intergenic
1063118354 10:3086753-3086775 ACATCAAGAGAGATTAAAGTGGG - Intronic
1063320565 10:5048379-5048401 AGAGAAAGAAAGATGAAAGTTGG + Intronic
1063369891 10:5514337-5514359 ACAGCAAGCGGGATTAAACCCGG - Intergenic
1065791425 10:29264003-29264025 ACACCAAGAAATACTAAACCTGG + Intergenic
1067280391 10:44866562-44866584 AGAGAAAGAAAGATTACAGCAGG + Intergenic
1067816935 10:49486133-49486155 ACAGCAATAAACACAAAAGCAGG + Intronic
1068005428 10:51387644-51387666 CCAGCCAGAAAGCTAAAAGCTGG - Intronic
1068158655 10:53235159-53235181 TCAGTAAGGAAGATTCAAGCTGG - Intergenic
1068271096 10:54725942-54725964 AAATGAAGAAAGATTTAAGCAGG + Intronic
1068526848 10:58139938-58139960 ACATAAAGAAAGATTAAACTCGG - Intergenic
1068837669 10:61571967-61571989 ACAGCTAGCTAGAATAAAGCAGG + Intergenic
1069243105 10:66166746-66166768 ACAGCAAAAAAAATTAAAATAGG + Intronic
1070310371 10:75268994-75269016 ACAGCAAGAAAGAAGGAGGCTGG - Intergenic
1070351625 10:75598043-75598065 ACATCAAGAAAAATCAATGCCGG - Intronic
1070519424 10:77238932-77238954 ACAGCAAGTAAAATTATAGAAGG - Intronic
1071873609 10:89820228-89820250 AAAGCAAGGGAGATTAAAGGTGG - Intergenic
1072597269 10:96885853-96885875 ATATCAAGAAATATTAAAACGGG - Intronic
1072766513 10:98098908-98098930 AAAGAAAGAAAGATTAATGCAGG - Intergenic
1073990799 10:109260610-109260632 GAAGCAAGAAATATTAGAGCTGG + Intergenic
1074215328 10:111378631-111378653 AGAGCAAGAAAAATTGAGGCAGG - Intergenic
1075301764 10:121331073-121331095 AGAGGAAGAAGGACTAAAGCCGG + Intergenic
1075541493 10:123317931-123317953 AGGGCAAGGAAGAATAAAGCAGG + Intergenic
1076346589 10:129783042-129783064 ATAGCATGACAAATTAAAGCAGG + Intergenic
1076947768 10:133664131-133664153 ACAGCAAGGAAAATAAAAGCAGG - Intergenic
1078198040 11:9153015-9153037 AAAGAAAGAAAGAAAAAAGCAGG + Intronic
1079185923 11:18236419-18236441 ACTGCATGAAAGATTGAAACGGG + Intronic
1079869170 11:25774869-25774891 GCAGAAATAAAGATAAAAGCTGG - Intergenic
1080380096 11:31760441-31760463 AAAGCAAGAAAGATAAAATCAGG - Intronic
1082751156 11:57019355-57019377 ACAGCCAGAAAGAACAAAGGTGG + Intergenic
1082753638 11:57049767-57049789 AGAGGAAGGAAGATTAAAGTAGG - Intergenic
1083346205 11:61994572-61994594 ACAGAAAGAAAGAATACAGTGGG - Intergenic
1083418241 11:62539150-62539172 CCAGCAAGAAACAGCAAAGCTGG + Intronic
1086193254 11:84106093-84106115 ATATCAAAAAAGATTAAAACAGG + Intronic
1086645408 11:89213641-89213663 TAAGCAAAAAAGATCAAAGCTGG + Intronic
1086772818 11:90790584-90790606 AGAGCAAGAAAGAAGGAAGCAGG + Intergenic
1087471447 11:98580816-98580838 AAAGAAAGAAAGAAGAAAGCGGG + Intergenic
1087644261 11:100789009-100789031 ACACCAAGAAAAATAAGAGCAGG - Intronic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1088520981 11:110700162-110700184 ACTGGATGAAAGATTAAAGTTGG + Intronic
1088989204 11:114937151-114937173 TGAGCATGAAGGATTAAAGCTGG - Intergenic
1089117785 11:116110434-116110456 ACAGAAAGCAATATAAAAGCAGG + Intergenic
1089813003 11:121147116-121147138 ACAGGAAAATAGATCAAAGCAGG - Intronic
1090600322 11:128363192-128363214 ACAACAAGAAACATGAAAGTAGG + Intergenic
1090689589 11:129164999-129165021 ACAGAAAGAAGGATTAAATGTGG - Intronic
1091243960 11:134075841-134075863 ACAGAAAGAAAAAGTTAAGCAGG - Intronic
1091609735 12:1995713-1995735 TCAGCTGGAAAGATAAAAGCAGG - Intronic
1093598920 12:20998151-20998173 ACAAAAACAAAGATAAAAGCAGG - Intergenic
1093964100 12:25307310-25307332 CCAGCAAGCTAGAATAAAGCAGG + Intergenic
1094567634 12:31614404-31614426 ACAGCAAGAATTATTCAAGGTGG + Intergenic
1095138093 12:38631039-38631061 AAACTAAGAAAGTTTAAAGCAGG + Intergenic
1098040311 12:66347680-66347702 AGGGCAAGAAAGTATAAAGCAGG - Exonic
1098181612 12:67853096-67853118 ACAGGAAGAAAGTTTACATCTGG + Intergenic
1101350704 12:103927890-103927912 ACAGCGAGAAACAACAAAGCTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101774206 12:107778892-107778914 ACAGCAAGAAAAAAAAAAGTAGG - Intergenic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1102365317 12:112329067-112329089 ACAGCACAAAAGATGAAAACTGG - Intronic
1102766508 12:115438284-115438306 AGACAAAGAAAAATTAAAGCAGG + Intergenic
1103199889 12:119079169-119079191 ACAGCAAGAAAGATTTGGGGTGG + Intronic
1107407991 13:40132991-40133013 AGTGTAAGAAAGAATAAAGCAGG + Intergenic
1108941161 13:55954912-55954934 CCAACCATAAAGATTAAAGCTGG - Intergenic
1109604318 13:64672314-64672336 ACAGAAAGAAAAACTATAGCTGG - Intergenic
1110362511 13:74643340-74643362 ACAGCACCAAAAGTTAAAGCTGG + Intergenic
1110986504 13:81977113-81977135 AGAGCAAGAAGAATCAAAGCTGG + Intergenic
1111118707 13:83816864-83816886 ACAGCCAAAAAGAGTAAAGAGGG + Intergenic
1111152780 13:84279513-84279535 ACAAAAAGAAAGAACAAAGCAGG - Intergenic
1111330000 13:86753038-86753060 ATAGCAACGAAGATTAAAGACGG - Intergenic
1112805805 13:103162923-103162945 ACAGCAAAAAAAATTACGGCCGG + Intergenic
1112957844 13:105083578-105083600 ACAGCCAGAAATAGTAAAGGTGG + Intergenic
1113258876 13:108538219-108538241 ACAGAAAGAAAGGTTCAAGGTGG + Intergenic
1113273266 13:108698796-108698818 ACAGGACGAAAGCTTAAAGGAGG - Intronic
1113327931 13:109300813-109300835 ACAGAAGGAAAGAAAAAAGCAGG - Intergenic
1113734171 13:112665287-112665309 TCAGGAAGAAACATTAAACCTGG - Intronic
1115246990 14:31305709-31305731 ACAGCAAGAAGGAGTTAACCAGG - Intronic
1116181332 14:41540484-41540506 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1116679474 14:47947090-47947112 ACAGCAAGATAGGTTACAACTGG - Intergenic
1117382101 14:55174571-55174593 ACAAAAAGAAATTTTAAAGCTGG - Intronic
1117731477 14:58726895-58726917 ACAGAAAGAGAGATGAAGGCAGG + Intergenic
1117903277 14:60558139-60558161 ACTGCAAGAATAATTCAAGCAGG + Intergenic
1118026345 14:61772688-61772710 ACAGTCAGAAAAATTAAAACCGG - Intronic
1118115800 14:62775577-62775599 ATAGCATGAAAGAGTAAGGCAGG - Intronic
1118307131 14:64664085-64664107 ACAGCATGAAAGATAAAAAATGG + Intergenic
1119082425 14:71708303-71708325 AAAGAAAGAAAGAATAAAGTTGG - Intronic
1120100524 14:80439628-80439650 ACAACAAAAAGGTTTAAAGCAGG + Intergenic
1122613913 14:103003866-103003888 ACAGCATAAAGGAATAAAGCCGG + Intronic
1202913201 14_GL000194v1_random:138689-138711 ACAGCAAGCTAGATAAAAGTGGG - Intergenic
1123803910 15:23851991-23852013 AAAGAAAGAAAGATGAAAGAAGG + Intergenic
1123931536 15:25173966-25173988 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1124204673 15:27707039-27707061 AAACCAAGAAAGATAAAATCAGG - Intergenic
1124416543 15:29477195-29477217 AAAGCAAGAAAAATTAATACAGG + Intronic
1125810185 15:42533165-42533187 ACATCAAGAAACACTACAGCAGG + Intronic
1125995781 15:44159514-44159536 ACAGCAAGAAAGAAGAATGAAGG + Intronic
1126527686 15:49675596-49675618 ACAGCAAGAAAGAAAAAAAAAGG + Intergenic
1126656468 15:50983178-50983200 ACAGCAAGAAAGGTGAAACTTGG - Intronic
1126687723 15:51262988-51263010 ATTTCAAGAAAGATTAAACCAGG + Intronic
1126930673 15:53646684-53646706 AAACCATGAAAGTTTAAAGCTGG - Intronic
1127607331 15:60599940-60599962 ACACCAAGGAAGAATAAAACTGG + Intronic
1130018446 15:80205676-80205698 ACAGTAAGAAAGATGAACGAGGG - Intergenic
1131069282 15:89455097-89455119 ACAGCAGGAAAGAATAAAACTGG - Intergenic
1132223862 15:100125702-100125724 ACAGCAACATAAATTATAGCAGG + Intronic
1133707381 16:8367836-8367858 ACAGAAAGAAATATAAAAACTGG + Intergenic
1137014913 16:35365019-35365041 ACAGCAATAAAGCTTATACCTGG + Intergenic
1138091190 16:54176025-54176047 ACAAAAAGAAAGATAAAGGCAGG - Intergenic
1138756879 16:59497933-59497955 ACAGCAAGAGAGAATTAAGGTGG + Intergenic
1139409320 16:66746415-66746437 ACAGTAAGAAAGACTAGGGCTGG + Intronic
1139877371 16:70157024-70157046 AGAGCAAAAAAGTTTAAAGTAGG - Exonic
1140026682 16:71297320-71297342 ACAGGAAGACAGATTTGAGCTGG - Intergenic
1140989584 16:80196065-80196087 AAAGCAAGCAAAATTAATGCAGG - Intergenic
1141149372 16:81553361-81553383 AAAGCAACAAAGTTGAAAGCAGG + Intronic
1144486976 17:15674698-15674720 AGAGCAGGATAGATGAAAGCTGG - Intronic
1144914053 17:18707602-18707624 AGAGCAAGATAGATGAAAGCTGG + Intronic
1144957549 17:19026752-19026774 ACAGCAAGAAAGGTCAGAGCTGG + Intronic
1144977607 17:19147764-19147786 ACAGCAAGAAAGGTCAGAGCTGG - Intronic
1145904037 17:28506658-28506680 ACAGCAAGAGGGATTAAAGTTGG - Intronic
1146251392 17:31347529-31347551 ACAGCAAGAATTATTCAAGGTGG - Intronic
1147732873 17:42614733-42614755 ACAGCAAAAAAGCTAGAAGCAGG - Intronic
1147851223 17:43444672-43444694 ACAGCAAGAGAGAGAAAACCTGG + Intergenic
1148349999 17:46934358-46934380 AAAGAAAGAAAGAAAAAAGCTGG + Intronic
1149219703 17:54402468-54402490 AGAGTAAGAAAGATAAAATCAGG - Intergenic
1149729487 17:58931088-58931110 AAAGAAAGAAAGAAAAAAGCCGG + Intronic
1150459330 17:65334286-65334308 ACAGTATGAAAGATTAAAAATGG - Intergenic
1151089884 17:71425957-71425979 ACAGCAATAAATGTTAAAGATGG + Intergenic
1152006203 17:77683136-77683158 ACAAAAAAAAAGATTAAACCAGG - Intergenic
1152491241 17:80636081-80636103 ACAGCTGGAAGGAATAAAGCTGG - Intronic
1153171861 18:2325901-2325923 ACAGGAAGATAGATTTGAGCTGG + Intergenic
1153566638 18:6425606-6425628 ACAGTATGAAAGATTAAAAACGG - Intergenic
1153824134 18:8859274-8859296 ACAGCATTTAAGATTAGAGCAGG + Intergenic
1155671935 18:28382175-28382197 ACACAAACAAAGAGTAAAGCAGG + Intergenic
1156623429 18:38880576-38880598 AAAGGAAGAAAGATAAAAGAAGG + Intergenic
1156728390 18:40158570-40158592 AGAGAAAGGAAGATTAAAACAGG + Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1159078981 18:63714126-63714148 ACAGAGAGAAATTTTAAAGCTGG + Intronic
1159491686 18:69143620-69143642 TCAGTAAGATAGATTAAAGATGG + Intergenic
1159769887 18:72537462-72537484 CCAGCAAGAAAAATAAAAGTGGG + Exonic
1160249183 18:77186161-77186183 AAAGAGAGAAAGTTTAAAGCTGG + Intergenic
1162884255 19:13684627-13684649 AAAGAAAGAAAAATTAAGGCTGG + Intergenic
1163268237 19:16234124-16234146 CCAGCAGGAAAGATTAAGGGGGG + Intronic
1163811327 19:19434071-19434093 ACAACAAGAAAAATGAAAGAAGG - Intronic
1164218100 19:23168699-23168721 AAAGAGAGAAATATTAAAGCTGG - Intergenic
1164634791 19:29784568-29784590 ACAGCAAGCAAGATTAGGGGTGG - Intergenic
1165035827 19:33032993-33033015 ACAACATGTAAGATTAAATCAGG - Intronic
1165852906 19:38860871-38860893 ACAACAAAAAAGAAGAAAGCAGG - Intergenic
1167388161 19:49176878-49176900 ACAGCAAGAAAGGGCCAAGCTGG - Intronic
925516856 2:4692381-4692403 AAAGAAAGAAAGAATAAGGCAGG + Intergenic
927644541 2:24869063-24869085 AAAGCAACAAAGATTAACGGTGG + Intronic
929360345 2:41081418-41081440 ACAGCTAGATATATTATAGCTGG - Intergenic
930431256 2:51279278-51279300 TAAGCAAAAAAGAATAAAGCTGG + Intergenic
930749654 2:54921626-54921648 ATCCCAAGAAAGAATAAAGCTGG + Intronic
930926017 2:56818769-56818791 ACAGAAAGAAAAAAAAAAGCAGG + Intergenic
931204822 2:60137021-60137043 GGAGCAACAGAGATTAAAGCAGG + Intergenic
931294516 2:60908353-60908375 ATGGCAAGAAAGATAAAGGCCGG - Intronic
931793969 2:65691865-65691887 ACAGCAAGAGAGCTTCAGGCTGG + Intergenic
931997384 2:67852259-67852281 ACTTGGAGAAAGATTAAAGCTGG - Intergenic
933479072 2:82832042-82832064 ACAGCAGGAAAGAATAATTCAGG + Intergenic
934707334 2:96492581-96492603 ACTCAAAGAAAGATTAGAGCTGG - Intergenic
935300480 2:101689640-101689662 ACAGCAAGAGGAATTAAAGATGG - Intergenic
935496169 2:103783970-103783992 AAAGAACAAAAGATTAAAGCTGG - Intergenic
935845150 2:107157918-107157940 TCAGCAAAAAAGAACAAAGCAGG - Intergenic
936339689 2:111620226-111620248 ACAGTATGAAAGATTAAAAATGG - Intergenic
936627626 2:114165158-114165180 AAAGAAAGAAAGCTGAAAGCTGG - Intergenic
936796145 2:116206418-116206440 ACAGCAAGCCAGCTGAAAGCAGG - Intergenic
939805788 2:146774881-146774903 ACGGAAAGAAAGATGAAGGCTGG - Intergenic
940061390 2:149573669-149573691 ACAGCAATAAATATTAAATATGG - Intronic
940424920 2:153520006-153520028 ACAGGGAGAGAGATTAAAGATGG - Intergenic
940537535 2:154965403-154965425 ACAAAATGAAATATTAAAGCAGG + Intergenic
941808986 2:169737085-169737107 TCAGCAAGTAAGAGGAAAGCAGG - Intronic
942144807 2:173016499-173016521 CCCACAAGAAAGGTTAAAGCTGG + Intronic
943393834 2:187306858-187306880 ACAGAAAGAATCATTAAAGAAGG + Intergenic
943658007 2:190529548-190529570 ATATGAAGAAAGAATAAAGCAGG - Intronic
943796941 2:192007932-192007954 AAAGCAGGAAAGAGTAGAGCAGG - Intronic
944153887 2:196591547-196591569 ACAAAAAGAAAAATTAAAGCTGG + Intronic
945569896 2:211453416-211453438 ACATCAAAAAAATTTAAAGCGGG - Intronic
945612772 2:212026112-212026134 AAAGCAAGCAAGATTAAATGAGG + Intronic
946285228 2:218697701-218697723 AAAGCAAGAAAGATGAGATCAGG + Intronic
947982727 2:234424315-234424337 ACAAGTAGAAAGATCAAAGCTGG + Intergenic
948106097 2:235414863-235414885 AAAGAAAGAAAGAAGAAAGCAGG - Intergenic
1169826151 20:9770957-9770979 CCAGCAAGAAAGATTAGAAAAGG + Intronic
1170487744 20:16836802-16836824 GCAGCAATAAAGACAAAAGCAGG + Intergenic
1170662023 20:18351303-18351325 ACAGCAAGAATTATTCAAGGTGG - Intergenic
1172080825 20:32339276-32339298 ACAGCAGGCAAACTTAAAGCAGG - Intergenic
1172832949 20:37852015-37852037 ACAGCAGGTAAGATTAATGCAGG + Intronic
1173291383 20:41717996-41718018 ATGGCAAGGAAGATTGAAGCTGG - Intergenic
1175040098 20:56041065-56041087 ACAGCAATAAGGATGATAGCTGG + Intergenic
1177538426 21:22460197-22460219 ACAGTAAGAAAGATTTCAACAGG + Intergenic
1179021232 21:37642860-37642882 TCATCATGAAAGATAAAAGCAGG + Intronic
1181322361 22:22018044-22018066 ACAGCAAGAAGGAATAGGGCCGG - Intergenic
1182857099 22:33527548-33527570 ACAGCAAGAGGGATTAAAGTTGG - Intronic
1184316860 22:43700409-43700431 AATGCAAGAAAGAGTAAAGAAGG - Intronic
1184822711 22:46922365-46922387 AAAGCAAAAAAGAACAAAGCTGG - Intronic
949312880 3:2719987-2720009 GCAGAAAGAATGATAAAAGCTGG + Intronic
951541409 3:23785774-23785796 CTATGAAGAAAGATTAAAGCAGG + Intergenic
951809034 3:26679189-26679211 TCTGCAAGAAAGATGATAGCAGG + Intronic
953422226 3:42763140-42763162 ACAGCTAGACTGATTACAGCTGG + Intronic
954013994 3:47669713-47669735 ACAGCAAGAAAAAGTAAAAGAGG + Intronic
955640254 3:61075068-61075090 ACGGCTAGAAAGAACAAAGCAGG + Intronic
955977298 3:64490869-64490891 ACATCATGAAACATAAAAGCAGG - Intergenic
956956690 3:74349393-74349415 ATAGCAAGTAACAATAAAGCTGG + Intronic
957438427 3:80210480-80210502 ACAGCAAGAAAGAGAAAGGCAGG - Intergenic
957529319 3:81420589-81420611 ACAAAGAGAAATATTAAAGCAGG + Intergenic
957554927 3:81754525-81754547 AAAGGAAGAAAGAAAAAAGCTGG + Intronic
958069107 3:88586267-88586289 TCAGCAAAACAGATTAAAGATGG - Intergenic
958594596 3:96205210-96205232 TCAGCAAAAAAGAGCAAAGCTGG + Intergenic
959107168 3:102077656-102077678 ACAGCAAGTCATTTTAAAGCAGG - Intergenic
960212091 3:114981824-114981846 AACTCATGAAAGATTAAAGCTGG - Intronic
960802650 3:121554970-121554992 AAAGAAAGAAAGATGAAAGAAGG + Intergenic
962151720 3:132900720-132900742 AGAGCAAGCAAGATTAAGGGTGG + Intergenic
962488569 3:135868274-135868296 ACAGCAAGATATGTTACAGCTGG - Intergenic
963009754 3:140758385-140758407 ACTACAAGGAAGATTAAAGACGG + Intergenic
963359339 3:144250569-144250591 ACAGAAAGAAACATGTAAGCTGG + Intergenic
963455955 3:145548260-145548282 AAATCAAGAAAGATTAAAAGTGG - Intergenic
963610490 3:147461196-147461218 ACAGCAAGTGGTATTAAAGCTGG + Intronic
963638386 3:147827881-147827903 AAGGCAAGAAAGAAGAAAGCAGG + Intergenic
964595834 3:158426856-158426878 TCATCAAAAAAGCTTAAAGCCGG - Intronic
964987869 3:162766569-162766591 ACAGGAAGAGAGATTCAATCTGG + Intergenic
965253018 3:166367529-166367551 AAAGTAAGAAAGATAAGAGCTGG - Intergenic
965297049 3:166960914-166960936 AGAGGAAGAAAGATTCAAGGAGG - Intergenic
965795650 3:172436113-172436135 ATAAAGAGAAAGATTAAAGCTGG + Intergenic
965875627 3:173315335-173315357 GCAGGAAGAAACATTAGAGCAGG - Intergenic
966280249 3:178217797-178217819 ACAGAAAGGCAGATTAAAGGAGG + Intergenic
966792888 3:183689858-183689880 ACAGTAAAAAAAATTAAGGCAGG + Intergenic
966833517 3:184031348-184031370 AAAGAAAGAAAGATGACAGCAGG + Intergenic
967303573 3:188039640-188039662 CCAGCCAGAAAGAGAAAAGCTGG - Intergenic
967552865 3:190819466-190819488 TCAGCAAGAAAGATTGGAGTAGG - Intergenic
967649667 3:191971300-191971322 AGAGAAAAAAAGATGAAAGCAGG - Intergenic
969189123 4:5502753-5502775 AAAGGAAGAAAGAGTAAAGGGGG + Intergenic
971163257 4:24155963-24155985 ACAGGAAGAAAGAAAACAGCTGG - Intergenic
971768336 4:30863504-30863526 AAAGCAATAAACATTAAATCAGG - Intronic
972261465 4:37412680-37412702 TGGGCAAGAAAGAATAAAGCTGG + Intronic
974086694 4:57268840-57268862 ACAGAAACAAAGATTGCAGCTGG - Intergenic
974178495 4:58356721-58356743 AAAGAAAGAAAGATTAAAGTAGG - Intergenic
974337840 4:60574126-60574148 ACAGAAAGAAATATTCAATCAGG + Intergenic
974632342 4:64509808-64509830 AAAGCAAGAAAGAATAATGAGGG - Intergenic
974855026 4:67451303-67451325 ACAGCATAAAAGATTAAAAATGG + Intergenic
975950121 4:79760378-79760400 ACAGACTGAAACATTAAAGCTGG - Intergenic
977570432 4:98623350-98623372 AAATCAACAACGATTAAAGCAGG + Intronic
977737574 4:100435577-100435599 TCAGCAAAAAAGAACAAAGCTGG + Intronic
980814867 4:137932078-137932100 ACAGCAAGAAACATGAAACATGG - Intergenic
980958228 4:139449930-139449952 ACAGTAAGAAAGGTTAAAAATGG - Intergenic
983260118 4:165447099-165447121 ACAGCATGAAAGATTAAAAATGG + Intronic
985339002 4:188927720-188927742 ACAGTAAGAAACAATAAAACTGG + Intergenic
986495657 5:8339308-8339330 ACAGCAAGCAAGATAGAATCAGG + Intergenic
986585170 5:9308910-9308932 ACAGCAACAAAAATAATAGCAGG - Intronic
986802611 5:11277829-11277851 ACAGCATAAAAGCCTAAAGCAGG - Intronic
987736500 5:21850761-21850783 ACAGCAAGAAATATCAGAACAGG + Intronic
989823630 5:45827000-45827022 AAAGAAAGAAAGAATAAAGATGG + Intergenic
990086418 5:51983637-51983659 ACAGCAAGAAAGGAAAAAGAAGG - Intergenic
990123826 5:52489379-52489401 TCAGGAAGAAAGAATAAAGGAGG - Intergenic
990411991 5:55550477-55550499 ACAGCAAGAATTATTCAAGGTGG + Intergenic
990720559 5:58690782-58690804 AAGGCATGAAAGATGAAAGCAGG + Intronic
990745426 5:58954514-58954536 TAAGCAAAAAAAATTAAAGCTGG - Intergenic
990862924 5:60347962-60347984 TCAGCCCAAAAGATTAAAGCTGG + Intronic
990871243 5:60432629-60432651 TAAGCAAAAAAGAATAAAGCTGG + Intronic
991402482 5:66267630-66267652 CCAGTAATAAAGATTAAATCAGG - Intergenic
991962144 5:72055636-72055658 ATTTCAAGAAAGATTTAAGCAGG - Intergenic
991988318 5:72312501-72312523 ACAGTAAGAAACAATGAAGCAGG - Intronic
992428728 5:76686484-76686506 ACAACAAGAAAGAATGAAGGTGG - Intronic
992479875 5:77140124-77140146 ATACCAAGAAACATTAGAGCTGG - Intergenic
993052462 5:82941253-82941275 ACTTCAAGAAAGATTAAGGGAGG - Intergenic
994856651 5:105130280-105130302 ACAGCAAGAAAGATTGGGGGTGG + Intergenic
995364312 5:111338903-111338925 AAAGCAAAAAAGAATAAAGCCGG - Intronic
996243357 5:121229297-121229319 ACAACAAGAAAAAAAAAAGCTGG + Intergenic
996280873 5:121727527-121727549 ACAGGTAGAATGATTAAATCAGG - Intergenic
997486804 5:134237878-134237900 AAAGCAAGAAAAAATTAAGCTGG - Intergenic
997645161 5:135477166-135477188 AAAGAAAGAAAGATTAATCCAGG - Intergenic
998520703 5:142797997-142798019 ACATCAAGAAAGAGAAAGGCTGG - Intronic
1000050508 5:157559042-157559064 ATAGGAAGAAAGATTAAAGTTGG + Intronic
1000105590 5:158055990-158056012 ACACCATAAAATATTAAAGCAGG + Intergenic
1000991118 5:167912966-167912988 GCAGCAAGAAAGGTTCAGGCAGG + Intronic
1001759669 5:174196977-174196999 ACAGACAGGAAAATTAAAGCTGG - Intronic
1002651637 5:180700895-180700917 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1003261345 6:4519026-4519048 ACAGCAAGAAAAAGTACACCTGG + Intergenic
1004407700 6:15349744-15349766 ACAGAAGGAAAGATGAAGGCTGG + Intronic
1006640602 6:35487764-35487786 ACAACAAAAAACACTAAAGCAGG + Intronic
1006958090 6:37894666-37894688 ACCACAAGAAATATTAAAGCCGG - Intronic
1008240798 6:49108837-49108859 ACAGGAAGAATGATTAAACATGG - Intergenic
1009756042 6:67941461-67941483 TAAGCAAAAAAGAATAAAGCTGG + Intergenic
1010305015 6:74309922-74309944 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1011762933 6:90587379-90587401 CCAGCGGGAAAGATAAAAGCTGG + Intergenic
1013630302 6:111979990-111980012 CCAGCAAGAGAGAGTAAAGTTGG + Intergenic
1013790293 6:113828845-113828867 ATTGCAGGAAAAATTAAAGCTGG - Intergenic
1014946857 6:127509102-127509124 ACAGCAAGAAAGCATAGTGCTGG + Intronic
1015611725 6:135028842-135028864 ACAACAACAAAAATTATAGCTGG + Intronic
1016440920 6:144082605-144082627 ACAGCAAGAAAGAGATAAGTGGG + Intergenic
1016477764 6:144446672-144446694 ACAGCAATTATGATTAAAGGAGG - Intronic
1016541549 6:145171095-145171117 ACAGAAAGAGAGATTCCAGCTGG + Intergenic
1016672530 6:146725746-146725768 ACAACAAGAAAAACTCAAGCAGG - Intronic
1017292114 6:152750323-152750345 ATTTCAAGAAAGATTAAATCTGG + Intergenic
1017561903 6:155636980-155637002 ACAGCAAGAAATCTGATAGCTGG - Intergenic
1021016922 7:15547288-15547310 TCTGGAAGAAAGATTAAAACAGG + Intronic
1022306597 7:29152423-29152445 AAAGCAAGAAAGATTTAGCCAGG - Intronic
1024255161 7:47535328-47535350 ACAGCTAGAAAACTTAAAGAGGG + Intronic
1026410499 7:70116592-70116614 ACAATAAGAAACATTAGAGCTGG - Intronic
1027620328 7:80477234-80477256 AGAGAAAGATAGATTAAAGTGGG - Intronic
1028921176 7:96312102-96312124 ATAGCAAGATAAATTAAAGAGGG + Intronic
1030476850 7:110045356-110045378 ACAGCCAGAATAATTAAGGCAGG - Intergenic
1030868490 7:114728777-114728799 AAAGAAAGAAAGATTAAAACAGG - Intergenic
1031502353 7:122534730-122534752 ACATGAAGAAAGATTTAAACAGG + Intronic
1031735143 7:125350194-125350216 AAAGCAATAACGATAAAAGCTGG - Intergenic
1032926390 7:136610380-136610402 AAAGAAAAAAAGAATAAAGCTGG - Intergenic
1033630760 7:143155238-143155260 TCAGCAACAGAGATTAAGGCTGG - Intergenic
1033719014 7:144037133-144037155 ACAGCAAGGAAGACAAAAACAGG - Intergenic
1033738111 7:144244794-144244816 ACAGCAAGTCAAATGAAAGCAGG + Intergenic
1033744944 7:144306163-144306185 ACAGCAAGTCAAATGAAAGCAGG - Intergenic
1033861834 7:145637915-145637937 GCAGCAAGTAAGATTTAAGGAGG - Intergenic
1034570842 7:151955174-151955196 ACAGCGAGACAGATTTGAGCTGG - Intergenic
1038049684 8:23796966-23796988 ACAGGAAGAAAGATTTGAGCTGG - Intergenic
1038296847 8:26300553-26300575 ACAGAAAGAAAAGTAAAAGCTGG + Intronic
1038375455 8:27035937-27035959 ACAGCAAGAAAGATTATGGAGGG - Intergenic
1040812692 8:51473930-51473952 GGAGCAAGAAAAATGAAAGCTGG + Intronic
1040837679 8:51749515-51749537 ACAGCATAAAAGATTAAAAACGG + Intronic
1041003797 8:53480108-53480130 AAAGAAAGAAAGAAAAAAGCAGG - Intergenic
1041134411 8:54741362-54741384 AGAGCATGAAAGATTAAAAATGG - Intergenic
1041834221 8:62193753-62193775 ACAGCAAGAAAGAATGTAGAGGG + Intergenic
1042356435 8:67833608-67833630 ACTGAAAGATAAATTAAAGCAGG + Intergenic
1043135385 8:76517036-76517058 ACGGCAAGAGATGTTAAAGCTGG + Intergenic
1043640812 8:82447912-82447934 TAAGCAAGAAAGAACAAAGCTGG - Intergenic
1043872179 8:85445979-85446001 TCAGAAATAAAGATCAAAGCAGG - Intronic
1044086231 8:87945413-87945435 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1044285540 8:90408484-90408506 ACAGCAAGAGAGAGAAAAGAAGG + Intergenic
1045148634 8:99377697-99377719 AAAGAGAGAAATATTAAAGCTGG + Intronic
1045156190 8:99475199-99475221 ACAGCGAGAGAGAATAAAGAGGG + Intronic
1045715733 8:105042370-105042392 ACAGCAAAAAGCATTTAAGCTGG + Intronic
1046342717 8:112879651-112879673 AAAGCGAGAAATTTTAAAGCTGG - Intronic
1046406753 8:113782789-113782811 GCAACAATAAAGATTATAGCAGG + Intergenic
1048767109 8:137856920-137856942 AAAGCAAGAAATATTAAACAAGG - Intergenic
1049839088 8:144759195-144759217 ACAACAACAAAAATTTAAGCGGG + Intergenic
1050364294 9:4859896-4859918 ACAGCAAGATAAATTAAACTGGG - Intronic
1051701583 9:19829942-19829964 AAAGAAAGAAAGATTGAAACTGG - Intergenic
1052309652 9:27052069-27052091 ACAGAAAGATAGCTTAAAGGGGG - Intronic
1054995136 9:71378597-71378619 AATGCAAGAAAGAATAAAGTTGG - Intronic
1055115045 9:72597240-72597262 ACAGAAAGAAAGAATGATGCAGG + Intronic
1055495230 9:76847706-76847728 ACAGGCAGAAAGAATAAAGTTGG - Intronic
1055680821 9:78713173-78713195 AAAGCCAGAAAGGTTAAAGATGG - Intergenic
1056308388 9:85314609-85314631 ACAGAAAGAAAGATGATATCTGG + Intergenic
1057805189 9:98214926-98214948 ACAGCGAGGGAGATGAAAGCAGG - Intronic
1057867397 9:98692388-98692410 ACTTCAAGAAAGACTAAAGGTGG - Intronic
1058980961 9:110170105-110170127 AATGACAGAAAGATTAAAGCTGG - Exonic
1059248801 9:112869811-112869833 ACAGGAGGAAATATTAAAGTAGG - Exonic
1062170117 9:135130099-135130121 AAAGCAACAAAGAATGAAGCAGG + Intergenic
1185653287 X:1664881-1664903 ACAGCTATTAACATTAAAGCTGG + Intergenic
1185766845 X:2732526-2732548 AAAGGAAGAAAGAGAAAAGCAGG - Intronic
1185977602 X:4739020-4739042 ACAGCAGGAGAGGGTAAAGCTGG + Intergenic
1186413385 X:9362835-9362857 AGAGGAAGGAATATTAAAGCTGG + Intergenic
1186436831 X:9550225-9550247 AGAGGAAGACAGATGAAAGCAGG + Intronic
1186594050 X:10961319-10961341 AAAGCAAGAAAGATTCACCCTGG + Intergenic
1187341774 X:18426851-18426873 ACAGCAAGAAAGAAACAAGCTGG - Intronic
1187800681 X:23059426-23059448 TCAGAAAGAAAGATGGAAGCAGG - Intergenic
1188664861 X:32806256-32806278 AAAGCAAAAAAAATAAAAGCAGG + Intronic
1188925464 X:36037326-36037348 ACAACAACAAAGAGTAAAGTTGG - Intronic
1189440098 X:41028086-41028108 TTTGCAAGAATGATTAAAGCAGG + Intergenic
1189506962 X:41621404-41621426 CCAGCACGAAAGATAAAAGAGGG - Intronic
1190305235 X:49078219-49078241 ACTGCAAAAAAGATAAAAACAGG + Intronic
1190397551 X:50000169-50000191 AGAGAAAGAAAGAGAAAAGCAGG - Intronic
1191067104 X:56360388-56360410 TGAGCAAGAAAAATCAAAGCTGG + Intergenic
1191161111 X:57330701-57330723 AAAGAAAGAAATTTTAAAGCTGG - Intronic
1191900096 X:66032062-66032084 ACAGCAAGGAAGTATAAATCTGG - Intronic
1191972068 X:66827647-66827669 AAAGAGAGAAAGTTTAAAGCTGG + Intergenic
1193439413 X:81519924-81519946 CAAGAAAGAAAGATAAAAGCAGG - Intergenic
1193609359 X:83610409-83610431 TAAGCAAGAAAGAACAAAGCTGG - Intergenic
1193617415 X:83706848-83706870 AAAACAACAAAGATTAGAGCAGG - Intergenic
1193999087 X:88404799-88404821 ACCCCAAGCAAGAATAAAGCTGG - Intergenic
1194309273 X:92284444-92284466 AAAGCAAGAAACTTTACAGCAGG - Intronic
1194444542 X:93971923-93971945 ATAGCAAAAAAGAACAAAGCTGG - Intergenic
1194619541 X:96152692-96152714 AAAGAAAAAAAGATGAAAGCAGG + Intergenic
1195132628 X:101869113-101869135 AGAGCTAGAAAGAACAAAGCTGG + Intergenic
1195494523 X:105514944-105514966 ACAACAAAAAACATTAAAACAGG + Intronic
1195567083 X:106353120-106353142 AGAAAAAGAAAGATTAATGCTGG - Intergenic
1195697110 X:107675228-107675250 ATAGGAAGAAAGATGAAAGATGG + Intergenic
1197166404 X:123382343-123382365 ACAGCAGCACAGATTAAACCAGG - Intronic
1197424566 X:126279613-126279635 ACAGCAAGAAAGAATAAATTTGG + Intergenic
1198025090 X:132697375-132697397 AGAGAAAGAAAAATTAAGGCCGG + Intronic
1198178426 X:134180097-134180119 TCAGCAGGAAAGAGAAAAGCAGG - Intergenic
1198994765 X:142561548-142561570 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1200370131 X:155716155-155716177 TCAGAGAAAAAGATTAAAGCAGG - Intergenic
1200617571 Y:5398689-5398711 AAAGCAAGAAATTTTACAGCAGG - Intronic
1200759018 Y:7019168-7019190 ACAGCAAGAAAGTTTACATATGG - Intronic
1201320265 Y:12690908-12690930 GGAGCAAGAAAGAGTGAAGCGGG + Intergenic
1201772400 Y:17628127-17628149 ACAGCAAGAAAAATAAAATTAGG - Intergenic
1201829155 Y:18277859-18277881 ACAGCAAGAAAAATAAAATTAGG + Intergenic