ID: 919878398

View in Genome Browser
Species Human (GRCh38)
Location 1:201887031-201887053
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902106088 1:14037322-14037344 AGAGGCAAACACTTTGAGTAAGG - Intergenic
905378456 1:37541730-37541752 AGGGGGATACATTTTAAGTATGG + Intronic
909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG + Intronic
910617546 1:89216190-89216212 AGGGGAAGAAACTTAGAGGATGG - Intergenic
912900926 1:113647417-113647439 AGGTGTATGCAATTTGAGGGAGG + Intronic
915449776 1:155996557-155996579 GAGGTTATACACTTGGAGGAAGG - Intronic
917062939 1:171059893-171059915 AGGGGAAGAAACTTAGAGGATGG + Intronic
919227273 1:194721842-194721864 AGGGGTAGCCAATTTCAGGAAGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
923029517 1:230236292-230236314 AGGGGTATAAACTTTTAGCCTGG - Intronic
923322361 1:232847401-232847423 AGTGGTACACACTTGGAAGAGGG + Intergenic
924211954 1:241778185-241778207 AGGGACATACACATTAAGGATGG + Intronic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957093 10:1547552-1547574 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957135 10:1547771-1547793 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG + Intronic
1070339309 10:75482111-75482133 AGGAGTATACACTCTGAGGGAGG - Intronic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1081363140 11:42204558-42204580 AGAGGTACACACTTTGAGCTGGG - Intergenic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089880097 11:121765408-121765430 AGGGGGACACACTTGCAGGAGGG - Intergenic
1094335345 12:29344337-29344359 AGTGGCATAATCTTTGAGGAAGG - Intronic
1097312790 12:58139495-58139517 TAGGGTATACACCTGGAGGAAGG - Intergenic
1101545152 12:105705479-105705501 TGGGGTTTACAATTGGAGGAAGG + Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG + Intronic
1104406439 12:128521193-128521215 AGAGATAATCACTTTGAGGATGG - Intronic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1104880531 12:132067719-132067741 GGGGGTATAGTCTGTGAGGATGG + Intronic
1106780757 13:33056971-33056993 AGTGGAATCCACTCTGAGGAGGG - Intronic
1107104647 13:36630301-36630323 AGGGGTTTGCTCTCTGAGGAGGG + Intergenic
1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG + Intergenic
1109156759 13:58921089-58921111 AAGGATATATACTTTGGGGAAGG + Intergenic
1115439485 14:33415788-33415810 AAGGGTATACACTGTCAAGAAGG - Intronic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1122308576 14:100780657-100780679 AGGGGTAAAGACTTTGAGGTTGG - Intergenic
1127411027 15:58707067-58707089 AGGGCTATAAACTTTGGGGGGGG + Intronic
1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG + Intronic
1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG + Intergenic
1131842474 15:96452149-96452171 AGGGTTATATACTAGGAGGATGG - Intergenic
1133935977 16:10269710-10269732 AGGGCAATACATTCTGAGGATGG - Intergenic
1135564271 16:23499807-23499829 AGGTTTCTACACTGTGAGGAAGG - Intronic
1138623546 16:58231130-58231152 AGAGTTATCCACTTTGATGAAGG - Intergenic
1143924461 17:10357566-10357588 ATTGTGATACACTTTGAGGAAGG - Intronic
1147385285 17:40077496-40077518 AGGGATATACCCTGGGAGGAAGG - Exonic
1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG + Intronic
1158941534 18:62409646-62409668 TGGAGGATGCACTTTGAGGATGG + Intergenic
1158965298 18:62617074-62617096 TGCGGAATATACTTTGAGGAGGG + Intergenic
1161437788 19:4273875-4273897 AGGGGTTCCCACTCTGAGGAAGG - Intergenic
1164820175 19:31243868-31243890 TGTGGAATACACTTGGAGGAGGG + Intergenic
1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG + Intronic
1168141230 19:54388667-54388689 AGGGGGAGAAACTTGGAGGAGGG - Intergenic
926366693 2:12139888-12139910 AGAGATATTCACTTTGAGAAGGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
931105769 2:59053573-59053595 AGGGATATCCACTTAAAGGAGGG + Intergenic
931350054 2:61479552-61479574 AGGTGTATATACTTAGGGGATGG - Intronic
940427624 2:153548763-153548785 ATGGGTATACACTTGGAAGTGGG - Intergenic
944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG + Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
947448399 2:230182519-230182541 AGGGGGATTCACTTTGGGGTTGG + Intronic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1175893791 20:62327191-62327213 TGGGGGAGGCACTTTGAGGATGG - Intronic
1180639448 22:17286676-17286698 AGAGGCAGAGACTTTGAGGACGG + Intergenic
1182321571 22:29481265-29481287 AGGGGCATGCACTTTGCAGAGGG - Intronic
951895998 3:27610224-27610246 AGTGGTAAACACATTGACGATGG - Intergenic
954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG + Intronic
954467653 3:50665897-50665919 TGGGGTATGAACTGTGAGGAGGG - Intergenic
960748799 3:120922428-120922450 AGGGGTATCCAATTGGAAGAAGG - Intronic
961405482 3:126676804-126676826 AAGGGGATGCACCTTGAGGAAGG + Intergenic
966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG + Intronic
966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977415454 4:96727195-96727217 AGGCCCATACACATTGAGGAGGG - Intergenic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
981606799 4:146548209-146548231 AGGGGCATAGAGTTTGATGAAGG + Intergenic
982988855 4:162244953-162244975 AGGGAAATACACTTGGAAGAGGG - Intergenic
984216383 4:176917326-176917348 AGGGGAAGAAACTTAGAGGACGG + Intergenic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
987485759 5:18523616-18523638 AGGCATCTACACTTTGAGAAGGG - Intergenic
989737045 5:44720233-44720255 AAGGCTAGACACTTTGAGTAAGG - Intergenic
992139669 5:73783083-73783105 AGGGGCTTACAGTTTGAGGTTGG + Intronic
994587823 5:101733454-101733476 AGGTGTATACACTGTGTTGAAGG + Intergenic
996169142 5:120267047-120267069 AGGGGTTTACACTTTTACTAAGG + Intergenic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG + Intronic
998882287 5:146656186-146656208 AGAGGTATGCTCTTTGAGGTGGG + Intronic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG + Intergenic
1006844935 6:37055679-37055701 AGGGGTGCACAGTTTGGGGAGGG - Intergenic
1010157149 6:72808283-72808305 AGGAGTATTCACTTTGGGAATGG + Intronic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1016889114 6:148988177-148988199 TGGGGTATAAAGTTTGAGGCAGG + Intronic
1022356294 7:29617734-29617756 AGGGGAATTGAGTTTGAGGATGG - Intergenic
1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG + Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG + Intronic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1032148732 7:129408855-129408877 AGGGGTATAGAGTTTTAAGAAGG + Intronic
1037315800 8:17598363-17598385 AGGGGTTTATTCTTTCAGGAGGG - Intronic
1037510619 8:19578165-19578187 AGGGGGATAGAATTTGATGATGG - Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1041945076 8:63431888-63431910 AGAGGTATCCATTTTGGGGAAGG - Intergenic
1044337145 8:90999821-90999843 AGCTATATACAATTTGAGGAAGG - Intronic
1044382583 8:91551787-91551809 AGTGGTCCACAGTTTGAGGAAGG - Intergenic
1044999682 8:97868976-97868998 AGGGGTGTCCTCTTTGGGGATGG - Intronic
1051790117 9:20792454-20792476 ATGGGGATACGTTTTGAGGAAGG - Intronic
1056179178 9:84065028-84065050 AGGGGAATCCACCTTGAGGCAGG + Intergenic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1190836316 X:54104241-54104263 AGGTTGATACAGTTTGAGGAGGG - Intronic
1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG + Intergenic
1193648714 X:84102698-84102720 AGGAGTACACACTTTGTTGAAGG + Intronic
1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG + Intergenic