ID: 919884500

View in Genome Browser
Species Human (GRCh38)
Location 1:201923276-201923298
Sequence CTGTGTGTCAAATTCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919884500_919884503 27 Left 919884500 1:201923276-201923298 CCATCCTGGAATTTGACACACAG 0: 1
1: 0
2: 1
3: 14
4: 217
Right 919884503 1:201923326-201923348 AGATGCATCTCCCATTCAGATGG 0: 1
1: 0
2: 0
3: 21
4: 168
919884500_919884504 30 Left 919884500 1:201923276-201923298 CCATCCTGGAATTTGACACACAG 0: 1
1: 0
2: 1
3: 14
4: 217
Right 919884504 1:201923329-201923351 TGCATCTCCCATTCAGATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919884500 Original CRISPR CTGTGTGTCAAATTCCAGGA TGG (reversed) Intronic
900977186 1:6025269-6025291 CCGTGTGTGTGATTCCAGGAGGG - Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
901429409 1:9203799-9203821 CTGTGTGCCAAAGTCCTCGAGGG - Intergenic
901964282 1:12853336-12853358 TTGTGTGTCCATTTTCAGGATGG - Intronic
902767821 1:18629001-18629023 CTGTGTGTCAAGGTGCAGGTGGG - Intergenic
905480890 1:38261265-38261287 CTGTGTGCCAGATCCCAGAATGG - Intergenic
905853434 1:41291007-41291029 CTGAGTGACAAGGTCCAGGAAGG - Intergenic
906493323 1:46285287-46285309 CTGTGTGCCTAATTCTAGGGAGG - Intronic
907329000 1:53659229-53659251 CTTGCTGTCACATTCCAGGAGGG + Intronic
908139987 1:61174242-61174264 ATGTGTTTCAAAATCAAGGAAGG - Intronic
908657965 1:66407633-66407655 CTGATTGTCAGATTACAGGATGG + Intergenic
908723941 1:67155517-67155539 CTGTGTGTCTTATTTCAGCAAGG + Intronic
911052929 1:93686994-93687016 GGCTGTGACAAATTCCAGGAAGG - Intronic
911867156 1:103043320-103043342 ATGTGTGTCACATGTCAGGAAGG + Intronic
911952090 1:104186213-104186235 CTGTGAGTCAGACTCCAAGAAGG - Intergenic
914293190 1:146293886-146293908 CTGTGGGCCAAAGTGCAGGAGGG - Intergenic
914554234 1:148744669-148744691 CTGTGGGCCAAAGTGCAGGAGGG - Intergenic
916636408 1:166674104-166674126 CTGGGTGATAAGTTCCAGGATGG - Intergenic
917457112 1:175194374-175194396 CTGTGTGTAAACCTCCAGGCAGG - Intergenic
919884500 1:201923276-201923298 CTGTGTGTCAAATTCCAGGATGG - Intronic
923165006 1:231352297-231352319 CTTTATGTGTAATTCCAGGAGGG - Intronic
924632335 1:245752710-245752732 CTGTGGCTCTAATTCCAGAATGG - Intronic
1064180587 10:13111217-13111239 CTGTGTCTAAAATTCCAGAAAGG - Intronic
1064206999 10:13332944-13332966 CTAAGTGACAAAATCCAGGATGG + Intronic
1070215751 10:74378796-74378818 GTGTGTTTCAAAATCCAGTAGGG + Intronic
1070393372 10:75990248-75990270 CTGCGTGTCAGATTCCAGGATGG + Intronic
1071045256 10:81366137-81366159 CTGTGGGTGAAATTTCAGGCTGG + Intergenic
1071417727 10:85456817-85456839 GTGTGTGTAAAGGTCCAGGAAGG + Intergenic
1072223202 10:93345132-93345154 CTGTATGTCAATTGCCAGGGTGG - Intronic
1072742318 10:97916855-97916877 CTGTTTTTCTAATTCCAGCACGG - Intronic
1074020671 10:109579436-109579458 CTGTCTGGCAAAGACCAGGAAGG - Intergenic
1075601715 10:123774127-123774149 CAGTGTGTTAAAGACCAGGAAGG + Intronic
1076076984 10:127541596-127541618 AAGTCTGGCAAATTCCAGGATGG + Intergenic
1080452239 11:32387619-32387641 CTCTCTGTCAAACTTCAGGAGGG - Intergenic
1084341192 11:68502871-68502893 CTGTGTTTGAAATGCCATGATGG + Intronic
1086443038 11:86847583-86847605 CTGTGTTTAAAATTCCAGATGGG + Intronic
1093896475 12:24580343-24580365 CTGGGTATAGAATTCCAGGATGG - Intergenic
1096409696 12:51368251-51368273 CTGTGTGTGAGATCCCGGGAGGG + Intronic
1097464038 12:59900800-59900822 CTGTGTTTCACATTGCAGGTTGG - Intergenic
1097875508 12:64639386-64639408 CTGTAAGTCAAATTACAGGTGGG - Intronic
1098277677 12:68829988-68830010 CTGTGGGCCATATGCCAGGATGG + Intronic
1098956690 12:76695953-76695975 CTGTGTTTAAAATTCCAGACGGG - Intergenic
1101745588 12:107538996-107539018 TTGTGTGTCCAACTCCAGGTTGG + Intronic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1103761602 12:123254209-123254231 CTGTCTGCCAAATTCAAGGATGG - Intronic
1103861203 12:124015805-124015827 CTGTGTGTGAAAATCGAGGTTGG - Intronic
1104391441 12:128393903-128393925 CTGTGTGCCAATATCCAGGCCGG - Intronic
1106302274 13:28479559-28479581 CTGAGAGTCAAATTTCTGGAAGG + Intronic
1106449538 13:29867628-29867650 CGGTTTGTCTTATTCCAGGAAGG + Intergenic
1106564678 13:30874013-30874035 TTCTGTGTCAAATTCCATAATGG + Intergenic
1107835451 13:44409437-44409459 CTGTGTGCCACAGTCCAGGCAGG + Intergenic
1108058564 13:46509689-46509711 CAGTGTGTCACATGGCAGGATGG - Intergenic
1109259548 13:60127706-60127728 GTGTTTGTCAAAAGCCAGGATGG + Intronic
1109272033 13:60266628-60266650 CTGTGTTTAAAATTCCAGATGGG - Intergenic
1109874593 13:68383943-68383965 GTGTGTGTCAGATTTCAGCAGGG + Intergenic
1116323863 14:43505347-43505369 CTGTGTGTCAAGAGCCAGCAAGG + Intergenic
1116326348 14:43536632-43536654 CTGTGTTTAAAATTCCAGATGGG + Intergenic
1116986445 14:51224753-51224775 CTGTGTGCCAGCTTCCAGGAAGG + Intergenic
1117223515 14:53631828-53631850 CTGAATTTAAAATTCCAGGATGG - Intergenic
1117535973 14:56703850-56703872 TTGCATGTCAAATTCCAGCATGG - Intronic
1118308835 14:64677761-64677783 CTGTATGTCAAATTATAAGAAGG - Intergenic
1119659058 14:76437708-76437730 CTGTGGGTCACATTCCAGCCAGG - Intronic
1121523773 14:94604211-94604233 GTCTGTGTCAACCTCCAGGAAGG - Intronic
1121614747 14:95305916-95305938 CTGGGCATCAAATTCCAGGTTGG - Intronic
1126141481 15:45442977-45442999 CTGTGAGTCAGAATCCTGGAAGG + Intronic
1126307995 15:47283112-47283134 CTGTGTCTCAAATGACAGAAAGG - Intronic
1128105598 15:65042429-65042451 CTGTGTGACAAGTGCCATGAAGG - Intergenic
1131830917 15:96354126-96354148 GTGTGTGTCCTCTTCCAGGAGGG - Intergenic
1131858123 15:96621358-96621380 CTGTCTGTCATATGCCTGGATGG + Intergenic
1132004687 15:98216352-98216374 GTGTGATTCAAATTACAGGATGG - Intergenic
1134610394 16:15603873-15603895 GTGTTTGTCCCATTCCAGGATGG - Intronic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1136136100 16:28257878-28257900 CTGTGTGTCCATGTCCAGCATGG + Intergenic
1136748016 16:32609188-32609210 CTGTGTGGGAGATTCCAGCAGGG - Intergenic
1137751181 16:50862300-50862322 GTGTGCATAAAATTCCAGGACGG + Intergenic
1138809033 16:60127396-60127418 CTGTGTGGGAAATTGCAAGAAGG + Intergenic
1140202837 16:72908194-72908216 CTGTGTGTCAATCCCCAGGGAGG - Intronic
1140879851 16:79188123-79188145 TTCTGTGGCACATTCCAGGAAGG - Intronic
1141387050 16:83631435-83631457 CTGTGTTTGAAATCACAGGATGG - Intronic
1142023220 16:87797186-87797208 CTGTGGCTCAAATGCCAGGAGGG + Intergenic
1142408523 16:89904376-89904398 CTGTGTGGAAAAGTCCAGGTGGG + Intronic
1203050153 16_KI270728v1_random:868395-868417 CTGTGTGGGAGATTCCAGCAGGG - Intergenic
1144064465 17:11612196-11612218 CTGTGTGACCAACTCCAGGGTGG + Intronic
1144553493 17:16261678-16261700 CCCTGTCTCAAATTCCAGGCGGG - Intronic
1152506776 17:80754668-80754690 ATGTGTGTGATATTCCAAGATGG + Intronic
1152867588 17:82733640-82733662 CTGGGTATCAAATTCCAGCTTGG - Intergenic
1153332071 18:3883696-3883718 CTGTGTGGCAAAGGCCAGGCTGG + Intronic
1153772757 18:8428795-8428817 CTGTGTGTCACTGCCCAGGAAGG + Intergenic
1154347193 18:13551939-13551961 CAGTGTGTCACATGGCAGGATGG + Intronic
1157130591 18:45003807-45003829 CTCTCTTTTAAATTCCAGGAAGG + Intronic
1157850256 18:51042113-51042135 CTGTCTCTCACATTGCAGGATGG - Intronic
1159181356 18:64909892-64909914 CTTTGTGTCAGATTCCAGAGTGG + Intergenic
1160197729 18:76770572-76770594 GTGTGTGTTAAATTCAGGGACGG + Intergenic
1161023554 19:2023691-2023713 CTGTGTGTGAAAAGCCATGAAGG + Intronic
1161911453 19:7197592-7197614 GTGTGTGTCAGATTCCAGAGTGG + Intronic
1164411927 19:28013518-28013540 CTGTGTGTCTGCTTCCAGAAGGG - Intergenic
1166186283 19:41141246-41141268 CTGGGTGTCATAGTCAAGGAAGG - Intergenic
1166268265 19:41698029-41698051 ATCTGTGTCAAATTCCAGCATGG + Intronic
1167719933 19:51172341-51172363 CTGAGGGCCAAATGCCAGGATGG + Intergenic
1168579898 19:57546498-57546520 AGGTGGGTCAAATTCCAGCATGG + Exonic
925559462 2:5174281-5174303 CTGTTAGTCACATTCCACGAAGG - Intergenic
928312979 2:30225549-30225571 CTGTTTGTCTAATTCAGGGAAGG + Intergenic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
931845961 2:66204051-66204073 CTGTGAGTCAAATTGGTGGAAGG + Intergenic
931891249 2:66675011-66675033 CAGTTTTTCAAATTCCATGATGG + Intergenic
931983376 2:67718320-67718342 TTGTGTGTCAGACTCCATGATGG - Intergenic
935664313 2:105496867-105496889 CTGGGTGTCAAAGGACAGGATGG - Intergenic
940583037 2:155605347-155605369 CTGTGAGACAAATCCCTGGAAGG - Intergenic
941857409 2:170245153-170245175 CTTTCTGTCACATTCAAGGAAGG + Intronic
943534825 2:189134688-189134710 CTGACCCTCAAATTCCAGGAAGG - Intronic
944172703 2:196797352-196797374 CTGTGTGTGAAGTTCCATGAGGG + Intronic
944702278 2:202256880-202256902 ATTTGTGTCAAATTTGAGGAAGG + Intergenic
945609548 2:211982473-211982495 TTGGGAGTCAAATTCCAGAATGG + Intronic
948281130 2:236748750-236748772 TTTTATGTCCAATTCCAGGACGG + Intergenic
948840587 2:240646994-240647016 CTGTGTGTCCCAACCCAGGAGGG + Intergenic
1170818858 20:19739226-19739248 CTCTGTGTCTATTTCCAGGGTGG + Intergenic
1172153213 20:32805161-32805183 CTGTGTGCCAAAGCCAAGGATGG - Intronic
1173060629 20:39656608-39656630 ACATGTGCCAAATTCCAGGACGG + Intergenic
1173638638 20:44583258-44583280 CTGTGTGGAAAACTCCAAGATGG + Intronic
1175401703 20:58703720-58703742 CTTTGTGTTAATTTCCAGGCCGG - Intronic
1175671272 20:60904694-60904716 CTGTGATTCAGATTCCAGGCAGG - Intergenic
1176359904 21:5986352-5986374 CTGCCTGTCAAATTCCACAAAGG + Intergenic
1177812051 21:25935103-25935125 CTGTGTGTCAAATGCCTGGCGGG + Intronic
1178263788 21:31124120-31124142 CCGTGTGTCACATTTCAGCAAGG - Intronic
1179478963 21:41665885-41665907 CTGTGTGCCAAGTTCCAACAGGG - Intergenic
1179763614 21:43552198-43552220 CTGCCTGTCAAATTCCACAAAGG - Intronic
1180124891 21:45784286-45784308 CTGTGTAGAAAATTCCTGGATGG + Intronic
1181120503 22:20664723-20664745 CAATGTGTCCACTTCCAGGAGGG - Intergenic
1181153865 22:20904812-20904834 CTGATTGCCTAATTCCAGGAGGG + Intergenic
1181969380 22:26678713-26678735 CTGTGTGTCAAATACAATGCTGG + Intergenic
949466055 3:4344948-4344970 CTGTGTGTCTTATTTCAGTAAGG - Intronic
952704372 3:36362308-36362330 CTGTGTGGGAAATCCCAGGGTGG + Intergenic
954633147 3:52057541-52057563 CTGTGTGTCGATTTGCAGGCAGG + Intergenic
955027160 3:55179685-55179707 CTGTTTGTTAAATTCCAAAAAGG - Intergenic
955476678 3:59343449-59343471 CTGGGTGTCAAATGGCAGGAAGG - Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956250340 3:67228767-67228789 CTCTGTGACACATTGCAGGAGGG + Intergenic
956904174 3:73748834-73748856 CAATGTGACAAATGCCAGGATGG - Intergenic
957916606 3:86694953-86694975 CTGTGTTTAAAATTCCAGATAGG - Intergenic
958850551 3:99319667-99319689 CTGAGAGCCAAATTCCAAGAGGG - Intergenic
961646696 3:128396549-128396571 CTGTGTGTCCAACTCCTGCATGG - Intronic
963062897 3:141239689-141239711 CTGTGTGCCAAATGCCCGAAGGG + Intronic
964194819 3:154050834-154050856 TTCTGTGTGAAAATCCAGGATGG + Intergenic
965132200 3:164715405-164715427 CTGTGTATCATTTTTCAGGAGGG - Intergenic
966627394 3:182033147-182033169 CTGTGTTTCCAATCCCAGGTTGG + Intergenic
967200370 3:187067470-187067492 CCATGTGTAAAGTTCCAGGAGGG + Intronic
967875066 3:194263020-194263042 CTGAGGGTCAAGTTCCAGGTTGG - Intergenic
968204569 3:196787827-196787849 CTGTGTTTCAGCTTCCAGGTAGG - Intronic
968955820 4:3718621-3718643 CTGGGTATAGAATTCCAGGAGGG + Intergenic
969843155 4:9898623-9898645 CTCTGTGTCCAACTCCAGGCCGG + Intronic
970106208 4:12587976-12587998 CAGTGTGTCACATCCCAGAAGGG + Intergenic
970340740 4:15103936-15103958 CTGTGCGAGAACTTCCAGGAAGG - Intergenic
974495298 4:62617774-62617796 CTGTATTTCAGATTCCTGGAAGG - Intergenic
974968930 4:68801971-68801993 CGGTGTGTAAAATTCCAGATGGG + Intergenic
975000967 4:69223285-69223307 CTGTGTTTAAAATTCCAGATGGG - Intergenic
975004473 4:69268983-69269005 CTGTGTTTAAAATTCCAGATGGG + Intergenic
975012889 4:69377949-69377971 CTGTGTTTAAAATTCCAGATGGG + Intronic
975286037 4:72621552-72621574 CTGTTTGTCAATTTTTAGGAAGG + Intergenic
976081294 4:81357982-81358004 GTCTGTGGCAAAATCCAGGAAGG - Intergenic
979230678 4:118346024-118346046 CTGTGGGGGAAATTCCAGAAAGG + Intronic
979756795 4:124350693-124350715 CTTTGAGTCAAAGTCTAGGATGG - Intergenic
983338313 4:166423989-166424011 CTGTGTGGTTAATTTCAGGATGG - Intergenic
984583271 4:181534676-181534698 CTGTGTGGTAAATGCCATGAAGG - Intergenic
985357356 4:189135797-189135819 TTGTGTGTCAATTTCAGGGATGG - Intergenic
989263893 5:39449849-39449871 CTGTGTGACAAAATCCGGCAGGG + Intronic
992940733 5:81758794-81758816 TTGTGTGTCAGATTCCTGAAAGG - Intergenic
992991530 5:82288571-82288593 CTCTTTGTAAAATTCCTGGAAGG + Intronic
993097744 5:83499787-83499809 CTTGGTGTCAGAGTCCAGGATGG + Intronic
996155231 5:120090989-120091011 AAGTGTGACAAATGCCAGGAAGG + Intergenic
997385419 5:133468338-133468360 CTGGGTGCCACAGTCCAGGATGG + Intronic
997715522 5:136039838-136039860 CTGTGTTTCCAAGACCAGGAGGG + Intronic
999938163 5:156510962-156510984 CTGTCTGTCAATTTCCAGAGAGG - Intronic
1000203400 5:159034065-159034087 CTTTGAGTCAAATTTCAAGATGG - Intronic
1001776346 5:174331857-174331879 CTGTGTGTCTAATTCCATCTTGG - Intergenic
1002385517 5:178862896-178862918 CTGTGTGTAAAATTCAGTGAAGG + Intronic
1002655834 5:180745939-180745961 CTGTGTCTCATAACCCAGGAGGG + Intergenic
1003333000 6:5145118-5145140 GTGTGTGTGAAATGCCAGGTTGG - Intronic
1003716609 6:8653246-8653268 CCTTGTGTTAAATTCCAGCAAGG - Intergenic
1005345069 6:24881313-24881335 TTGTGTGTTAAATCCCAGAAAGG + Intronic
1005445982 6:25923695-25923717 CTTTGTATCAAATTCCTTGATGG + Exonic
1006069729 6:31489635-31489657 GTGGATGTCAAATTCCAGCAAGG - Intergenic
1009366783 6:62862645-62862667 CGGTTTGTAATATTCCAGGAGGG - Intergenic
1009909643 6:69909988-69910010 CTGTGTGTCAGGTACCACGAGGG - Intronic
1012676899 6:102126205-102126227 GTGTGTCTCAAATTCCTGGCAGG + Intergenic
1013378337 6:109540907-109540929 ATGTGTGTATAATTCCAGAAGGG - Intronic
1014202114 6:118619144-118619166 CTGTGTTTAAAATTCCAGTTGGG + Intronic
1014817105 6:125948074-125948096 CTGTGTGCCAGATACCAGGCTGG + Intergenic
1014884735 6:126765722-126765744 CTCTGTGTCAGGTTCCTGGAAGG + Intergenic
1015794045 6:136993087-136993109 CTGTGTGTCCCATTCAAGGATGG + Intergenic
1018785621 6:167105646-167105668 CTGTGTGTCCACTTCCAGCTCGG + Intergenic
1021577843 7:22120641-22120663 CTGTGGGCCACATTCCATGACGG + Exonic
1021737428 7:23653572-23653594 CTGTGTGTCAAGAAACAGGATGG + Intergenic
1022162116 7:27721549-27721571 CTGTGGGTCCAGCTCCAGGAGGG + Intergenic
1023362319 7:39429547-39429569 CACTGTGTCAAATGCCATGAAGG - Intronic
1029709251 7:102290598-102290620 CTGTGTGTCAGACGCCAGGTGGG - Intronic
1031197631 7:118637215-118637237 CTGTTTGTCAATTTACAGCAGGG - Intergenic
1032205917 7:129865288-129865310 CTCTGTGTCCAGTCCCAGGAAGG + Intronic
1034068632 7:148161151-148161173 CTGTGTCTCCAATATCAGGAAGG + Intronic
1034990342 7:155544050-155544072 CAGTGTGTCTAATCCCAGAATGG - Intergenic
1035933765 8:3814067-3814089 ATGTGTTTCAAATTCCCTGAAGG + Intronic
1037379594 8:18270483-18270505 CTGTTTGTTGAATTCCATGATGG - Intergenic
1037863673 8:22425772-22425794 CAGTGGGTCAGATTCCAAGATGG + Intronic
1038116903 8:24566662-24566684 CTGGGTGTAAAATTCTAGGTTGG + Intergenic
1041794495 8:61732201-61732223 CTGTTTGCCAAATTCCACGTAGG - Intergenic
1042084872 8:65096013-65096035 CTTTGGGGAAAATTCCAGGATGG - Intergenic
1042127281 8:65550827-65550849 CTGTAAGTCAAAGTCCAGCATGG - Intergenic
1042219388 8:66458644-66458666 CTGTTAGACAAATTCCAGGCTGG + Intronic
1047683302 8:127277159-127277181 CTGTGTGTCAACTTCCAGTGTGG - Intergenic
1048202273 8:132384394-132384416 CAATTTTTCAAATTCCAGGACGG + Intronic
1048780181 8:137991103-137991125 CTGTGTTTAAAATTCCAGATGGG + Intergenic
1048798052 8:138170117-138170139 CTGTGCATCAAATTTAAGGATGG - Intronic
1049700108 8:144006978-144007000 CTGGGAGTCAAAGACCAGGAAGG - Intronic
1049847514 8:144810296-144810318 TGGTGTGTCAAACTCCATGATGG + Intronic
1049956537 9:698262-698284 CTGTGTTTGAAACTCTAGGATGG - Intronic
1050833509 9:10046061-10046083 CTGTATATCAAATTAAAGGAAGG - Intronic
1055173204 9:73286030-73286052 CTGTTTGTTAAATGCCTGGAAGG + Intergenic
1057083211 9:92188133-92188155 CTGTGAGTCAGACTCCAGGCAGG - Intergenic
1057186859 9:93061971-93061993 CTGTGTGGCGAATCCCAGGAGGG + Intronic
1059855424 9:118392123-118392145 GTGTGTGACAGATTCCAGGGAGG - Intergenic
1060539273 9:124418929-124418951 CTGTGTGCCAACTGCCAGGCGGG + Intergenic
1060947114 9:127576330-127576352 CTGCTTGTAAACTTCCAGGAAGG + Intronic
1061649637 9:132036853-132036875 CTTTGTGTCAAATGCCACAAAGG + Intronic
1190167049 X:48081911-48081933 CTGTGCGTGAAACTCCAGGGTGG + Intergenic
1190565915 X:51730325-51730347 CTGCTTCTCAAATTTCAGGATGG + Intergenic
1195107966 X:101618176-101618198 ATGTTTCTCTAATTCCAGGAAGG + Intergenic
1198017065 X:132622031-132622053 CTGTGTGTCCCATTCCCCGAGGG + Intergenic
1199664348 X:150084551-150084573 CTTTGAGACAAATTCCAGGTGGG + Intergenic
1201440598 Y:14004267-14004289 CTGAGTGACAAAGACCAGGAGGG + Intergenic
1201443973 Y:14038441-14038463 CTGAGTGACAAAGACCAGGAGGG - Intergenic
1201627765 Y:16033871-16033893 ATGTGTATCAAGTTCCAGAAGGG + Intergenic
1201640372 Y:16171069-16171091 CTGTGTGTAAAATTCCAGATGGG - Intergenic
1201662442 Y:16414256-16414278 CTGTGTGTAAAATTCCAGATGGG + Intergenic
1201750069 Y:17422478-17422500 CTGTGTTTAAAATTCCAGATGGG - Intergenic