ID: 919887101

View in Genome Browser
Species Human (GRCh38)
Location 1:201942509-201942531
Sequence CCTTGGAGGGAGACCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919887101 Original CRISPR CCTTGGAGGGAGACCCTGGA GGG Intronic
900396659 1:2455805-2455827 CCGGGGAGGGAGGCCCTGCAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901919793 1:12527922-12527944 CCATGGTTGGAGATCCTGGAGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904808285 1:33146846-33146868 GGCTGGAGGGAGACACTGGAAGG + Exonic
904891074 1:33780047-33780069 GGTTGGAGGGAGACCCTGAAGGG + Intronic
904974779 1:34447670-34447692 CCTTGGAAGAAAACCTTGGAGGG + Intergenic
905226685 1:36483227-36483249 ACTTGGAGGCAGGCCCTGGCTGG + Exonic
905815901 1:40950626-40950648 CCTTTGAGGGGGTTCCTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907412380 1:54291928-54291950 CCTTGTCTGGAGCCCCTGGAAGG + Intronic
908319676 1:62967362-62967384 CCTTGGAAGGCTACCCTGGAAGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910262533 1:85306124-85306146 CCTTGGGGGGAAAGCCAGGAAGG - Intergenic
911196715 1:95002242-95002264 CCTGGGGGGGGGAACCTGGAAGG + Intronic
911941288 1:104051251-104051273 CCTGGGAGGGACCCCATGGAAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915735274 1:158080683-158080705 CCCGGGAGGAAGATCCTGGATGG - Intronic
915735474 1:158081938-158081960 CCCAGGAGGAAGATCCTGGATGG - Intronic
917589739 1:176463773-176463795 CTGTGCAGGGAGACCATGGAGGG + Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920017690 1:202926993-202927015 CCTTGCAGGGAGACCAAGGATGG + Intronic
920060526 1:203223930-203223952 GCTTGGAGGAAGCCTCTGGAGGG - Intronic
920435760 1:205946021-205946043 CATTGGTGGGAGGCCCAGGAAGG + Intergenic
921698943 1:218245339-218245361 CCTTGGTGGCAGCCCCGGGAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923486210 1:234433824-234433846 CCTATGAGGGAGACCTTAGATGG + Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063505628 10:6595767-6595789 CCTTTGAAGGAGACACTGTAAGG + Intergenic
1063934426 10:11062539-11062561 CATTGGAGGAAGTCCCTGTATGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066546701 10:36507909-36507931 CCTTGGAGTGACACCATGGCTGG - Intergenic
1066573691 10:36802307-36802329 CTTTGGATGGAAACCCTGGGAGG - Intergenic
1068417623 10:56744771-56744793 GCTTGGAAGGTGACCCTAGAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074818815 10:117163988-117164010 CCTTGGTGCGAGACCCCGGGCGG + Intergenic
1075230450 10:120671732-120671754 CCTGGGACTGAGCCCCTGGAGGG + Intergenic
1076344852 10:129773257-129773279 CCTTGGAGGGACACCCCAGTAGG - Intergenic
1076344861 10:129773285-129773307 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344870 10:129773313-129773335 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344879 10:129773341-129773363 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344896 10:129773397-129773419 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344905 10:129773425-129773447 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344914 10:129773453-129773475 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344923 10:129773481-129773503 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076344932 10:129773509-129773531 CCTTGGAGGGACACCCCAGCAGG - Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077549405 11:3193405-3193427 CCTGGGAGGGAGACCCTCTCTGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079648912 11:22901893-22901915 TCTTGGAGGGAGACCACGAAAGG + Intergenic
1082816798 11:57514716-57514738 ACGTGGAGGGAGACCCAGGACGG + Intronic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1084220586 11:67675140-67675162 CTTTGCAGAGAGACCCTTGATGG + Intronic
1084312945 11:68327157-68327179 CTTTGGAGGGGGAGCCTGGGAGG - Intronic
1084541883 11:69792166-69792188 CCTTGGTGGGAGACCTCTGAGGG + Intergenic
1084962017 11:72721787-72721809 CGTAGGAGGGAGGCCCTGGGAGG - Intronic
1085013231 11:73155879-73155901 ACTTGGAGGGTGCCTCTGGAAGG + Intergenic
1085245817 11:75099598-75099620 CAATGGAGTGAGACCCAGGAAGG + Intergenic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085559877 11:77461919-77461941 CATTGGACTGAGACCCTTGAAGG - Intronic
1087158563 11:94927415-94927437 CCTTGGAGGCAGACAGTGCAGGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087718545 11:101636448-101636470 CCTGGGATAGAGCCCCTGGAGGG + Intronic
1089348004 11:117803962-117803984 CCCTGCAGAGAGACCGTGGAAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1102645725 12:114402580-114402602 ACTTGTAGAGAGAGCCTGGAAGG - Intronic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1103509451 12:121464652-121464674 CGTCGGAGGGAGGCCCTGGTGGG - Intronic
1104051569 12:125198006-125198028 CCTTGTAGGGAGGCTGTGGAGGG + Intronic
1104914254 12:132256639-132256661 CGCTGGAGGGGGACACTGGAGGG + Intronic
1104929918 12:132333267-132333289 TCTCTGAGGGAGGCCCTGGAAGG - Intergenic
1109650203 13:65314200-65314222 CATTGGAGGGAGCCCCCTGAGGG + Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113425848 13:110207888-110207910 CCGAGGAGGGAGACTCTTGATGG - Intronic
1113571595 13:111361985-111362007 TCCTGGAGGGAGGTCCTGGAGGG - Intergenic
1113763902 13:112869029-112869051 TGTTGGAGGGAGAGCCTGGTGGG - Intronic
1113964792 13:114146756-114146778 TCTGCGAGGGAGCCCCTGGAGGG + Intergenic
1114080481 14:19198774-19198796 CCCTGCAGGCAGACCCAGGAAGG + Intergenic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115640498 14:35332734-35332756 CATTGCAGGGAGACCTGGGAAGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116467705 14:45253034-45253056 CCTTGGATGAAGAGCCTGGCAGG + Exonic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1119226692 14:72949967-72949989 TCCTGGAGGGAGACCCATGAGGG + Intronic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121722422 14:96119103-96119125 CCAGTGAGGGAGCCCCTGGAAGG - Intergenic
1122257119 14:100486618-100486640 CCCAGGCGGGAGTCCCTGGAGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125380229 15:39079468-39079490 CATTGAAGGGAGATCCTGGAAGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126956264 15:53936377-53936399 CCTAGGATGGAGCCCCTGGGAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128154921 15:65386045-65386067 CCTGGGAGGGATTCCCTGGAAGG + Exonic
1128340795 15:66821365-66821387 ACCTGGAGGGAGGACCTGGAAGG - Intergenic
1128714067 15:69894133-69894155 CAGTGGATGGACACCCTGGAAGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1130879038 15:88039311-88039333 CTTTGGAGAGAGACCCTCAAGGG + Intronic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134863215 16:17579501-17579523 CCAGGAAGGGAGACCATGGAGGG + Intergenic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137822708 16:51461089-51461111 CGTTGGAGGTAGACCCTGCTGGG - Intergenic
1137893833 16:52189942-52189964 TGTTGGAGGTAGAGCCTGGAGGG + Intergenic
1138029462 16:53548499-53548521 TCTAGGAGGTTGACCCTGGATGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139969095 16:70762765-70762787 CCTTCTAGGGAAACCCTGGCCGG - Intronic
1140044127 16:71429186-71429208 AAGTGGAAGGAGACCCTGGAGGG + Intergenic
1140182682 16:72736209-72736231 CCTGGGATGGAGCCCCTGGGAGG - Intergenic
1140483191 16:75273739-75273761 ACTTTGAGGTAGACCCTGGGAGG - Intergenic
1141915547 16:87094063-87094085 TCTGGCAGGGAGACCCGGGATGG + Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143028215 17:3953284-3953306 CCCTGGAGGGAGAGCCAGGCTGG - Intronic
1144613999 17:16751888-16751910 CCCTGGGGGCAGACACTGGAGGG - Intronic
1144898713 17:18563783-18563805 CCCTGGGGGCAGACACTGGAGGG + Intergenic
1145133662 17:20381940-20381962 CCCTGGGGGCAGACACTGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148122259 17:45220387-45220409 ATCTGGAGGAAGACCCTGGAAGG - Intergenic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1151319523 17:73344044-73344066 CCCTGCAGAGAGACCCTGGCTGG - Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151412235 17:73938695-73938717 CCTTGGAGGTGGATGCTGGAAGG + Intergenic
1151707024 17:75774510-75774532 CCTTGGAGGAGGATGCTGGAAGG + Intergenic
1151869245 17:76825438-76825460 ACTTGTAGAGAGCCCCTGGAGGG - Intergenic
1151933592 17:77248067-77248089 CCTTGGAGGGGCACCCCAGAGGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1152895410 17:82908017-82908039 CCTTGGAGGGTTGCCCTGGGAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153007811 18:513006-513028 CCGTGGAAGGAGACCGTGGGGGG + Intergenic
1154322343 18:13365179-13365201 CCTTGGAAGGAGCTCCTGTATGG + Intronic
1155464642 18:26120956-26120978 CCTGGGATGGAGTGCCTGGAGGG + Intergenic
1156115059 18:33777794-33777816 CGTGGTAGGGAGACACTGGAGGG + Intergenic
1160772574 19:839655-839677 ACTTGGAGGGAGCTCCTGGCAGG - Intergenic
1160908027 19:1460882-1460904 CCTATCAGGGACACCCTGGAAGG - Intronic
1160930000 19:1566157-1566179 CCTTGGTGGGACCCCCTGGCAGG - Intronic
1161028666 19:2048124-2048146 CCCTGGAGGGAGCCCCTGGTGGG + Intronic
1161673215 19:5625940-5625962 GCGTGGAGGGAGTCCCTGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163261482 19:16193142-16193164 TTGTGGAGGGAGATCCTGGAGGG - Intergenic
1163315190 19:16536444-16536466 CCTTGGAGTGGGGCTCTGGAGGG - Intronic
1163515257 19:17759014-17759036 CCTGGGAGGGTGAACCTGGTAGG + Intronic
1163520315 19:17788033-17788055 CCTTGGAGGACGTCCTTGGAAGG + Intronic
1163664243 19:18595548-18595570 CCTTGCAGTGAAACCCTGGGGGG + Intronic
1165318519 19:35072313-35072335 CCTCGGAGGTGGACCTTGGACGG - Intergenic
1165834437 19:38745550-38745572 CCAGGGAGGCTGACCCTGGAGGG + Intronic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166346858 19:42171826-42171848 TCTGTGAGGGAGACCCTGAATGG + Intronic
1166808609 19:45501683-45501705 CCTTAGGAGGAGACCCTGAAAGG - Intronic
1166883287 19:45941906-45941928 GCTTGGAGTGAGATCCTGGAGGG - Intronic
1167220552 19:48195927-48195949 TCTTGAAGGAAGCCCCTGGAGGG + Intronic
1167399366 19:49254818-49254840 CCCTGGAGGGAGACGCCGGGTGG + Intergenic
1167730315 19:51249413-51249435 CCATGGAGTAAGGCCCTGGAGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
1168516322 19:57013060-57013082 CCGTGGATGGTGCCCCTGGATGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925403802 2:3592233-3592255 CCGTGGAAGGAGACCATGGAGGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928462208 2:31485457-31485479 CCTGGGAGGGAGATCCCAGACGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
933650540 2:84846769-84846791 CCTTGGAGAAAGACCCAAGACGG + Intronic
933730216 2:85450635-85450657 ACTTGGCAGGAGACCATGGATGG - Intergenic
933864017 2:86499832-86499854 TCTTGGAGGTAGAGCCTGGTGGG - Intergenic
935171612 2:100614733-100614755 CCCAGCAGGGAGGCCCTGGAGGG + Intergenic
935498995 2:103815367-103815389 CAATGGAGGGAGCTCCTGGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935808375 2:106771348-106771370 CCTTGAAGGGAGACTTTAGATGG - Intergenic
935834568 2:107036799-107036821 CCTGGGATGGAGACCCCAGAGGG + Intergenic
937266199 2:120616060-120616082 CCTGAGAAGGGGACCCTGGAGGG - Intergenic
938368950 2:130756679-130756701 CCTTGGAGGGCGCCTCTGGGCGG - Intronic
938405626 2:131031736-131031758 CCTTGGGGGTAGGCCCTAGAGGG - Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944884059 2:204044428-204044450 ACTTGGTGGGAGACCCTTTATGG - Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946351426 2:219157098-219157120 TCTTTGAGGTAGACCCTGGATGG - Intronic
947140766 2:227017576-227017598 CCTTTGAGGGCCGCCCTGGAAGG + Intronic
948827794 2:240581840-240581862 CCATGGAGGGGACCCCTGGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1171429276 20:25070521-25070543 CCATGTAGGGAGCCCTTGGAGGG - Intergenic
1172055596 20:32152300-32152322 CCATCGAGGGAAATCCTGGAGGG - Intronic
1172446248 20:34994971-34994993 TCCTGGAGGCAGTCCCTGGAAGG - Intronic
1172579672 20:36036950-36036972 CCTTGGGGACAGACACTGGAGGG + Intergenic
1172768049 20:37361513-37361535 CCCTGGAGGGAGATACTGCATGG + Intronic
1172830310 20:37828478-37828500 CCTAGCTGTGAGACCCTGGAAGG + Intronic
1173400134 20:42718716-42718738 ACTTGGAGTGAGACCGAGGAGGG + Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174170234 20:48613108-48613130 CCTTGTAAGGAGACACGGGAGGG + Intergenic
1175304816 20:57968671-57968693 CCTTGGAGGGAGCCCTTGAAGGG + Intergenic
1175761821 20:61566505-61566527 CCATGGAAGGAGACACTTGAAGG - Intronic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1177519842 21:22205808-22205830 CTTTGGAGAGAGACCTTGGTTGG + Intergenic
1177774411 21:25551891-25551913 CCTTGGAGGTAGGGCCTGGTGGG - Intergenic
1178509003 21:33186580-33186602 CCTTTGGGGGACACACTGGAAGG - Intergenic
1179383606 21:40921484-40921506 CCTTGCTGGGACACCCCGGAAGG + Intergenic
1180069005 21:45426821-45426843 TCTGGGAGGGAGGCCTTGGAGGG + Intronic
1180155410 21:45975014-45975036 CCTGGGAGGGAGTCGCCGGACGG + Intergenic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1180500298 22:15923910-15923932 CCCTGCAGGCAGACCCAGGAAGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181808613 22:25390370-25390392 CTTTGGAGGGGGAGCCTGGGAGG + Intronic
1182384672 22:29927731-29927753 CCTTGGATGGAGACTCTTTAAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1183547603 22:38463199-38463221 TGTTGGAGGGAGTCCCTGGGAGG - Intergenic
1183951771 22:41356534-41356556 CCTGGGAGGGGCAGCCTGGAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184617216 22:45646211-45646233 CATTGGAGGGAGGCCTTGGCAGG + Intergenic
1184980084 22:48089710-48089732 CCTGGGACGGAGACGCTGGGAGG - Intergenic
1185168416 22:49276617-49276639 ACCTGAAGGAAGACCCTGGATGG - Intergenic
1185420566 22:50732122-50732144 CCTTGGGGAGAGACCCTGTGAGG - Intergenic
949837138 3:8281230-8281252 GCTTAGAGAGAGACCCTGGGTGG + Intergenic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
950696580 3:14705357-14705379 CCTTGGAGGGTGAGCCCTGAGGG + Intronic
953612041 3:44455120-44455142 CCTTGATGGGACATCCTGGAGGG - Exonic
953915915 3:46921233-46921255 CCTAGGACAGAGACCCTGCATGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954924170 3:54217702-54217724 CTTTGGAGGGAGCCTTTGGAAGG + Intronic
955092084 3:55762493-55762515 CCTGGGTGGGAGATCCTTGAAGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960277210 3:115742073-115742095 CCTGGGATGGAGGCCCTGCAGGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961051315 3:123749458-123749480 CCTTGGTCTGAGCCCCTGGAAGG - Intronic
961211698 3:125130744-125130766 GCCTGGAGGGAGAAGCTGGAGGG + Intronic
961809603 3:129514303-129514325 CCTTGGAGTGAGCCCCAGGCTGG - Intronic
963519270 3:146345072-146345094 CCTTGGATGGAGCACCTGAAGGG - Intergenic
963669881 3:148237455-148237477 CAATGGAGGGAGAACCTGGGAGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964075160 3:152684332-152684354 CAGTGGAGGGAGACCCAGAATGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967066948 3:185926650-185926672 CCTTGGAGCGAGACCTTGCAGGG + Exonic
967397506 3:189024133-189024155 CCTGGGATGGAGTGCCTGGAGGG - Intronic
967907966 3:194517339-194517361 CCTTGGATGGTCACCCTGCATGG - Intergenic
967982832 3:195076004-195076026 TGTTGGAGGGAGGGCCTGGAGGG - Intronic
968091258 3:195899791-195899813 CCCTGAAGGGAGAACCTGGCAGG + Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
969470522 4:7384992-7385014 CTTTGGAGGGAGAGCCTTCAGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971918800 4:32910020-32910042 CCTGGGAGGGAGCTCCTGAAGGG + Intergenic
972277558 4:37571309-37571331 CCATGGAGAGAGATCTTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974539755 4:63218975-63218997 CCTGGGACAGAGACCCTGGCGGG - Intergenic
975489871 4:74976452-74976474 TCTGGGATGGAGACCCTGGGAGG + Intronic
975685414 4:76916090-76916112 CCGTGGAAGGAGACTGTGGAGGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977506711 4:97911690-97911712 CCTGGGAGGGAGCCCCTGGTGGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979152754 4:117341412-117341434 CCTTGGAAGGAGACCCTAGAGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979620986 4:122798371-122798393 CTCTGCAGGGAGGCCCTGGATGG - Intergenic
979742426 4:124168000-124168022 CCTGGGATGGAGCCCCTGGGGGG + Intergenic
981505522 4:145495117-145495139 AATTGGAGGGAGACGCTGGAGGG + Intronic
981740080 4:147992150-147992172 TCTTTGAGAGTGACCCTGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982371943 4:154643127-154643149 CCCTGGAGGGATATGCTGGAGGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985645731 5:1083942-1083964 CCCAGGAGGCAGACCCTGGGCGG + Exonic
985682887 5:1265644-1265666 CCCTGGAGGGTGGACCTGGAGGG + Intronic
986860337 5:11920115-11920137 CCTAGAAGGAAGACCATGGAAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990524590 5:56612434-56612456 ACCTGGATGGAGACCCTTGATGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
998382352 5:141734920-141734942 CCTTGGAGGTGGAGCCAGGATGG + Intergenic
999066669 5:148694114-148694136 CCTTGGAGGGATGTCTTGGAGGG + Intergenic
1001955503 5:175845850-175845872 ACTTTGAGGGAAACCCAGGATGG + Intronic
1002098826 5:176847363-176847385 CATAGAAGGGAGGCCCTGGAGGG - Intronic
1002665433 5:180820393-180820415 CTTTGGAAGGAGGCCCTGCAAGG + Intergenic
1003319633 6:5038862-5038884 CCGCGGAAGGAGACCGTGGAGGG + Intergenic
1005445693 6:25920226-25920248 CCTAGGAGTGAGAAGCTGGATGG + Intronic
1006712183 6:36083705-36083727 CCTGGGATGGAGCCCCTGGTGGG + Intronic
1006878829 6:37321599-37321621 ACTTGGAGGGAGAGCATGAAAGG - Intronic
1007301562 6:40871739-40871761 CCTTGGAGAGAGGTGCTGGAGGG - Intergenic
1007336733 6:41159940-41159962 CCTTGGCGGGAGAACCTTTATGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010999201 6:82568660-82568682 CCCTGGTGGGAGACCCTGGTGGG - Intergenic
1010999205 6:82568673-82568695 CACTGGTGGGAGACCCTGGTGGG - Intergenic
1012931520 6:105322194-105322216 GCCTGGAGGGAGATCCTGTAGGG - Intronic
1017891433 6:158643031-158643053 CCTGGGATGGAGGCCCTGGGAGG - Intronic
1018848014 6:167568547-167568569 CCTTGGAGGCAGCCCTTGGTGGG - Intergenic
1018899346 6:168043423-168043445 CCTGGGAGGGCCACCCTGGGAGG + Intronic
1019089865 6:169519631-169519653 CATTGGAGGGAGGGCCTGGTGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019466700 7:1193619-1193641 CCTAGGACGGAGACCCAGGTGGG - Intergenic
1019524147 7:1473207-1473229 CCTGGGAGGAAGACGCTGGCAGG + Intronic
1019605492 7:1907997-1908019 CCTTGCAGGGTGGCCCTGGCCGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019789417 7:3001262-3001284 CCTTGCAAGGACACCCTGGCGGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022611138 7:31874590-31874612 TCCAGGAGGGAGACCCTTGATGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1029580714 7:101435356-101435378 CCCTGGAGGAAGCCCCTGGCTGG + Intronic
1031968906 7:128049408-128049430 CCTTGTCGGGAGGCCTTGGAGGG - Intronic
1033221896 7:139532451-139532473 CGGTGTGGGGAGACCCTGGATGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033355704 7:140597766-140597788 CCTTGGAGGAAGAGCCAGAAGGG + Intronic
1034495194 7:151416632-151416654 CCCTGGTGAGAGACCCAGGAAGG - Intergenic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035060768 7:156067538-156067560 GCTGGGAGGGCCACCCTGGATGG + Intergenic
1035198015 7:157239429-157239451 CCTGGGAGGGTAACACTGGAAGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1038043410 8:23746033-23746055 CCTTCAAGGGAGTCCCTTGAAGG + Intergenic
1038239760 8:25797691-25797713 GCTTCGAGGGAGACACAGGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038610938 8:29059818-29059840 CCAGGGAGGAAGACTCTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041517408 8:58715694-58715716 CCTTGGAGGTAGACTGTAGACGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045490346 8:102663446-102663468 CCTTGGAGAAAGCCCCAGGAAGG + Intergenic
1045732944 8:105263250-105263272 CCTGGGATGGAGCCCCTGGGAGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048272465 8:133040516-133040538 CATTTGCGGGAAACCCTGGAAGG - Intronic
1048831850 8:138485348-138485370 CCTTGAATGGAAACTCTGGATGG - Intronic
1048857494 8:138697155-138697177 CCTTCCAGGGGGCCCCTGGAGGG - Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614224 8:143569196-143569218 CCTGGGAGGGAGAGACTGTAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049693321 8:143972227-143972249 CCTTAGAGGGAGCACCCGGAGGG - Intronic
1049872329 8:144990424-144990446 CCTGGGACAGAGCCCCTGGAGGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053352947 9:37425162-37425184 CCTTGGCGGGGGACCCTAGGAGG + Intronic
1053382495 9:37660296-37660318 CCTTGCAGGGAGATCTAGGAGGG + Intronic
1055343309 9:75308611-75308633 CCTGGGATGGAGCCCCTGGAGGG - Intergenic
1055343538 9:75310519-75310541 CCTGGGATGGAGCCTCTGGAGGG - Intergenic
1056568616 9:87796835-87796857 GCCTGGAGGGAGATCCTGCAGGG - Intergenic
1057792864 9:98135437-98135459 CTTTGGAGGTGCACCCTGGATGG + Intronic
1057842856 9:98500410-98500432 CCTGGAAGGGAGCCCCAGGAGGG + Intronic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1061176256 9:128999203-128999225 CCCTTGACGGAGATCCTGGAGGG + Exonic
1061591907 9:131603246-131603268 CCTTGAAGGGAGGCCCATGAGGG - Intronic
1061748214 9:132755487-132755509 CCTGGGAGAGGGACCATGGAGGG + Intronic
1062361202 9:136189137-136189159 CCGTGTAGGAAAACCCTGGAAGG + Intergenic
1062388613 9:136325148-136325170 TCCAGAAGGGAGACCCTGGAGGG - Intergenic
1186913374 X:14193467-14193489 CCTGGGATGGAGCCCCTGGGGGG - Intergenic
1186962467 X:14751472-14751494 CCTTGGAGGGAGATATTGCAAGG + Intergenic
1187825637 X:23332509-23332531 CCTGGGAGGGACACATTGGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1190170433 X:48108042-48108064 TCTTGAAGGGACACCCTAGATGG + Intergenic
1190679269 X:52811145-52811167 CCTTAGTGGGGGACCTTGGAAGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191123192 X:56926967-56926989 CCTGGGAGGGAGCTCCTAGAAGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193176500 X:78400795-78400817 CCTGGGATGGAGCCCCTGGGAGG + Intergenic
1193647678 X:84089026-84089048 CCTAGGATGGAGCCCCTGGTGGG - Intronic
1194435878 X:93868221-93868243 CCCTGGATGGAGCCCCTGGAGGG + Intergenic
1194635544 X:96342126-96342148 CTGTGGATGGAGACCCCGGATGG + Intergenic
1198315486 X:135461719-135461741 TATTGGAGGTAGAGCCTGGAAGG - Intergenic
1198636720 X:138710363-138710385 CCTTGGAGGTGGAAGCTGGAGGG + Intronic
1199978068 X:152905877-152905899 CCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1200052823 X:153443955-153443977 GCTGTGAGGGTGACCCTGGAAGG - Intergenic