ID: 919887368

View in Genome Browser
Species Human (GRCh38)
Location 1:201944681-201944703
Sequence AAGAAGAGGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7449
Summary {0: 1, 1: 10, 2: 117, 3: 1074, 4: 6247}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919887368_919887384 11 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887384 1:201944715-201944737 AAACATAGGTGGTGGGGCGGGGG 0: 1
1: 0
2: 0
3: 35
4: 346
919887368_919887386 13 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887386 1:201944717-201944739 ACATAGGTGGTGGGGCGGGGGGG 0: 1
1: 0
2: 3
3: 47
4: 594
919887368_919887391 23 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887391 1:201944727-201944749 TGGGGCGGGGGGGGGCGGTAGGG 0: 1
1: 0
2: 17
3: 424
4: 10157
919887368_919887385 12 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887385 1:201944716-201944738 AACATAGGTGGTGGGGCGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 321
919887368_919887379 4 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887379 1:201944708-201944730 AAGGCTTAAACATAGGTGGTGGG No data
919887368_919887390 22 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887390 1:201944726-201944748 GTGGGGCGGGGGGGGGCGGTAGG 0: 1
1: 3
2: 54
3: 757
4: 12434
919887368_919887376 -3 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887376 1:201944701-201944723 CTTGGCAAAGGCTTAAACATAGG 0: 1
1: 0
2: 0
3: 12
4: 132
919887368_919887383 10 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887383 1:201944714-201944736 TAAACATAGGTGGTGGGGCGGGG 0: 1
1: 0
2: 2
3: 10
4: 234
919887368_919887387 14 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887387 1:201944718-201944740 CATAGGTGGTGGGGCGGGGGGGG 0: 1
1: 1
2: 5
3: 85
4: 871
919887368_919887382 9 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887382 1:201944713-201944735 TTAAACATAGGTGGTGGGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 207
919887368_919887380 5 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887380 1:201944709-201944731 AGGCTTAAACATAGGTGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 119
919887368_919887381 8 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887381 1:201944712-201944734 CTTAAACATAGGTGGTGGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 207
919887368_919887389 18 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887389 1:201944722-201944744 GGTGGTGGGGCGGGGGGGGGCGG 0: 1
1: 25
2: 205
3: 3313
4: 19625
919887368_919887377 0 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887377 1:201944704-201944726 GGCAAAGGCTTAAACATAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 149
919887368_919887378 3 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887378 1:201944707-201944729 AAAGGCTTAAACATAGGTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 620
919887368_919887388 15 Left 919887368 1:201944681-201944703 CCTCCCTCCTTCTCCCTCTTCTT 0: 1
1: 10
2: 117
3: 1074
4: 6247
Right 919887388 1:201944719-201944741 ATAGGTGGTGGGGCGGGGGGGGG 0: 1
1: 0
2: 15
3: 163
4: 1694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919887368 Original CRISPR AAGAAGAGGGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr