ID: 919888044

View in Genome Browser
Species Human (GRCh38)
Location 1:201949446-201949468
Sequence TTTTAGTTAGGTATGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919888040_919888044 -7 Left 919888040 1:201949430-201949452 CCATGCTGGAGTGGGCTTTTAGT No data
Right 919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919888044 Original CRISPR TTTTAGTTAGGTATGTTGGG TGG Intergenic
No off target data available for this crispr