ID: 919891013

View in Genome Browser
Species Human (GRCh38)
Location 1:201974618-201974640
Sequence TTGGCTATAAAAAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919891013_919891023 16 Left 919891013 1:201974618-201974640 CCATGCTGCCTTTTTATAGCCAA No data
Right 919891023 1:201974657-201974679 TTCCAACCCGTGGCAACTACTGG No data
919891013_919891019 6 Left 919891013 1:201974618-201974640 CCATGCTGCCTTTTTATAGCCAA No data
Right 919891019 1:201974647-201974669 TCCCTACTCCTTCCAACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919891013 Original CRISPR TTGGCTATAAAAAGGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr