ID: 919894367

View in Genome Browser
Species Human (GRCh38)
Location 1:201999794-201999816
Sequence CTGTTCTTCTTGAGGCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919894362_919894367 17 Left 919894362 1:201999754-201999776 CCCCAGGAGGGTAATGTTATTAA 0: 1
1: 0
2: 3
3: 13
4: 131
Right 919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 195
919894361_919894367 24 Left 919894361 1:201999747-201999769 CCTGGGTCCCCAGGAGGGTAATG 0: 1
1: 0
2: 1
3: 10
4: 245
Right 919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 195
919894363_919894367 16 Left 919894363 1:201999755-201999777 CCCAGGAGGGTAATGTTATTAAG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 195
919894364_919894367 15 Left 919894364 1:201999756-201999778 CCAGGAGGGTAATGTTATTAAGC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 195
919894360_919894367 25 Left 919894360 1:201999746-201999768 CCCTGGGTCCCCAGGAGGGTAAT 0: 1
1: 0
2: 1
3: 12
4: 117
Right 919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919894367 Original CRISPR CTGTTCTTCTTGAGGCCACA AGG Intronic
901298484 1:8180393-8180415 CCATTCTTCTTAAGGACACATGG - Intergenic
901468549 1:9439674-9439696 CTCCTCCTGTTGAGGCCACAGGG - Intergenic
901752467 1:11419164-11419186 CTGTTCTTCCTGAGGCTTCTAGG + Intergenic
903382316 1:22905867-22905889 CAGTTCTTATGGGGGCCACATGG + Intronic
903837530 1:26215259-26215281 CTGTTTTTCTTTAGCCCACTTGG - Intergenic
904132123 1:28282819-28282841 CTGACGTTGTTGAGGCCACATGG + Intergenic
905262931 1:36731923-36731945 CTGGTCTACTTGTGGCCACCAGG + Intergenic
905975473 1:42170954-42170976 CTCTTCCTGGTGAGGCCACAGGG - Intergenic
909133071 1:71763979-71764001 CTGTTCTTCTTTATACTACATGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
916370330 1:164086903-164086925 CTGGACTTCTTGCAGCCACATGG - Intergenic
919200920 1:194354309-194354331 CTGTCCTTCTTCAGGCTGCAAGG + Intergenic
919506845 1:198409665-198409687 ATGTTCTACTTCAGGCCAAAAGG + Intergenic
919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG + Intronic
920540710 1:206775922-206775944 GTGAGCTTCTTGAGGCCAAAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923533189 1:234827853-234827875 CTGATCTTCTTGGGGCCCCATGG - Intergenic
924715879 1:246573644-246573666 CTGTTCTCTTTGAGGCTTCAGGG - Intronic
1065746170 10:28844540-28844562 GTGTTCTGTTTTAGGCCACAAGG + Intergenic
1065949472 10:30638887-30638909 AGGTTCTTCTTGAGGGCACGGGG + Intergenic
1070006061 10:72425403-72425425 CTGTTCTTCATAGGGGCACAAGG + Intronic
1070052334 10:72901524-72901546 CTGTTCTTCTTGGGGGACCAGGG - Intronic
1070278231 10:75028774-75028796 GTTTTCCTCTTGAGGCAACAGGG - Exonic
1070394684 10:76001944-76001966 CAGTTCTTCTTGAGCCCTCAGGG - Intronic
1070657792 10:78283119-78283141 CTGTCCTTCTTGTGCCAACAGGG - Intergenic
1070961095 10:80500743-80500765 CTGTTCTTCTCAAGGCCCCCAGG - Intronic
1071415362 10:85436240-85436262 CTTGTCTTCTAGGGGCCACATGG - Intergenic
1071825618 10:89322659-89322681 CTGGTCTTCTTGGGGGCACAAGG - Intronic
1071996945 10:91158796-91158818 CTGTTATTCTTCAGCCTACAGGG - Intergenic
1075602535 10:123780987-123781009 TAGTTCTTCTTGAGGTCAGATGG - Intronic
1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG + Intronic
1076002695 10:126924637-126924659 CTGTTCTTCTGGAGGCAACACGG - Intronic
1076338351 10:129725719-129725741 GTGCTCCTCTTGAGGGCACAGGG - Intronic
1076487992 10:130836465-130836487 CTTTTCTTCTTATGGCCACGTGG + Intergenic
1077028979 11:455085-455107 ATCTTCTTCCTGAGCCCACATGG + Intronic
1078151061 11:8759999-8760021 CTGTTCTTCCTGAAGCAGCAAGG + Intronic
1080245114 11:30171189-30171211 CTGCTATTCTTCAGGCTACAAGG - Intergenic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1084215304 11:67644228-67644250 CTGCTCTGCTTGCTGCCACAGGG - Intronic
1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG + Intergenic
1087611931 11:100445321-100445343 CTGTTCTTTTTGGTGCCAGAAGG - Intergenic
1088727275 11:112650512-112650534 CTGGTCTTCTAGGGCCCACAAGG + Intergenic
1090809089 11:130221114-130221136 GTGTTTCTCTTGAGACCACAAGG + Intergenic
1091771912 12:3157666-3157688 CTGTCCTGCTGGAGGTCACAAGG + Intronic
1093651508 12:21651032-21651054 ATGTTCTTCTCTAGGCCACAGGG - Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094314748 12:29127290-29127312 ATGTTCTTCTTAAGGTCATATGG - Intergenic
1097435677 12:59549854-59549876 ATGTTATTCCTGAGGTCACAGGG + Intergenic
1097630811 12:62059638-62059660 CTTTTCTTCAGGTGGCCACATGG - Intronic
1099661556 12:85569404-85569426 CTGTTCTACTTGAGGTCACATGG - Intergenic
1100737762 12:97556401-97556423 CTGTTCTCCTTCAGGGAACACGG - Intergenic
1101997416 12:109534918-109534940 CTAAATTTCTTGAGGCCACAAGG - Exonic
1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG + Intronic
1103836110 12:123822382-123822404 CTGCCCTTCTTGAGTCCCCAAGG + Intronic
1104368385 12:128198831-128198853 CTGTCCTCCTTGAGGCCATGGGG - Intergenic
1104649954 12:130524329-130524351 CGGCTCTGCTTGAGGCCACTGGG - Intronic
1108694811 13:52893723-52893745 CTGTTCTTTTTTTGGACACATGG + Intergenic
1108889095 13:55230414-55230436 CTGTTCTCATTTAGTCCACAAGG + Intergenic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1111047907 13:82839523-82839545 ACCTTCTTCTTGAGGTCACATGG - Intergenic
1111708791 13:91785034-91785056 CAGTTCTTCTCGTGGCTACACGG + Intronic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1112588212 13:100738505-100738527 CTTTTCCTCTTTAGGCCAAAGGG + Intergenic
1114717813 14:24845949-24845971 GTGTCCTTCTGGAGGCCCCAGGG - Intronic
1114973496 14:28064330-28064352 ATGTTCTTCTCTAGGACACATGG - Intergenic
1115968063 14:38914261-38914283 ACATTCTTCTTGATGCCACATGG + Intergenic
1116694814 14:48159595-48159617 TTCTTATTCTTTAGGCCACAAGG - Intergenic
1118405518 14:65419770-65419792 CTGAAATTCTTGAGGCCAAAAGG + Intronic
1118695701 14:68382942-68382964 CTGTTCTTCCTGATAACACATGG + Intronic
1118701604 14:68439023-68439045 CTGCTCTACTTGATACCACAGGG + Intronic
1118999284 14:70866704-70866726 CCTTTCTTCTTGAGGTCCCAAGG + Intergenic
1121372501 14:93372862-93372884 ATGTTCTTCTCAAGGTCACAAGG + Intronic
1122790466 14:104182221-104182243 CAGTCCTTCGTGTGGCCACAGGG + Intergenic
1124827433 15:33112752-33112774 CTGTTCTGCTAGAGATCACATGG + Intronic
1125966097 15:43876730-43876752 CTGCTCTTCTTGAGGGGGCATGG + Intronic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1128531295 15:68449924-68449946 ATTTTCTTCTTGATGCCCCAGGG - Intergenic
1129182386 15:73885444-73885466 ATTTTATTCTGGAGGCCACAGGG - Intronic
1129914262 15:79254444-79254466 ATATTCTTCTGGAGGCCCCATGG - Intergenic
1134689045 16:16178964-16178986 CTGTTCCTTTTGTGGCCACAGGG - Exonic
1134905042 16:17972650-17972672 CCGTTCTTCTGGAGGCCGGATGG + Intergenic
1135295209 16:21273644-21273666 CGGGTCCTTTTGAGGCCACATGG - Intronic
1135380687 16:21993912-21993934 CAGTACTTTTGGAGGCCACATGG + Intronic
1140950866 16:79816161-79816183 CAGTTCTTCTCTAGGCCACATGG + Intergenic
1142265875 16:89063780-89063802 CTGTTCTTCTTTGGGCCTCCTGG - Intergenic
1142300170 16:89252969-89252991 CTGTTCTTCTTAAGCCCACCTGG - Intergenic
1142329317 16:89440816-89440838 ATGTTCCTGTTGATGCCACATGG - Intronic
1142696138 17:1634950-1634972 CTGGGCTTCCTGGGGCCACAGGG - Exonic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1147603617 17:41761137-41761159 GTCTTCTTCTTGAGGCTACCTGG - Intronic
1148337236 17:46850266-46850288 TTCTACTTATTGAGGCCACATGG - Intronic
1149099971 17:52893898-52893920 GTGTTCTTCTTGAGGGCACTTGG + Intronic
1152379968 17:79937296-79937318 CAGCTCTTTTGGAGGCCACAGGG - Exonic
1152414426 17:80149923-80149945 CTGTTTTTCTTTAGTCAACAAGG - Intergenic
1155253777 18:23976809-23976831 ATATTCTTCTTGGTGCCACATGG - Intergenic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1166940266 19:46358874-46358896 CTCTTACTCTTGAGTCCACAGGG + Intronic
925639581 2:5974627-5974649 CCCTTCTTCCTGATGCCACATGG - Intergenic
926292599 2:11542562-11542584 TTGTTCTCCCTGGGGCCACAGGG - Intronic
928100884 2:28436882-28436904 CTGTGCTTCCTCATGCCACACGG + Intergenic
929948517 2:46388721-46388743 CTGTTCTTCTGCAGGCCTCCTGG - Intergenic
930590527 2:53321477-53321499 CTTTTCTTATTGAGGCACCAAGG - Intergenic
930702819 2:54476296-54476318 CTCTTCTTTTTGTGGCTACATGG - Intronic
932293722 2:70607204-70607226 ATGCTCTTCTTTATGCCACATGG + Intergenic
935093203 2:99916842-99916864 CTCATCCTCATGAGGCCACAAGG + Intronic
936831009 2:116646999-116647021 ATGTTTGTCTTGAGTCCACAGGG + Intergenic
938598205 2:132811154-132811176 CTGTTCTGGTGGAGGCGACAGGG + Intronic
938722630 2:134079919-134079941 CATTTCTTCTGGAGGCCATAAGG + Intergenic
938758651 2:134403607-134403629 CTCTGCTTCCTGAGCCCACAGGG - Intronic
938772317 2:134511057-134511079 CTGTTCTTGTGGAGCTCACATGG + Intronic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
941383930 2:164830157-164830179 CTGTACTTCTTGGTGCCCCAAGG + Intronic
942086869 2:172451933-172451955 CTGTTCTTTTTGAAATCACATGG + Intronic
945175678 2:207041026-207041048 CTGGTGTTCCTGAGACCACAGGG - Intergenic
945448724 2:209969104-209969126 CTGTTTATTTTGGGGCCACAGGG + Intronic
946951177 2:224877042-224877064 ATGTTCTTATTGCTGCCACAAGG + Intronic
946956148 2:224931900-224931922 CTGTTCTTATTGAGTCCCCAAGG + Intronic
947321498 2:228924564-228924586 CTATTCTGCTTGATGCCTCAAGG + Intronic
1173142132 20:40493787-40493809 CTGCTTTTCTTGATGCCCCAAGG - Intergenic
1174296023 20:49545775-49545797 CTGTTCTTGTTGCTGCCACTAGG - Intronic
1174463733 20:50701209-50701231 CGGTCCTTGTTGAGGCCAGAGGG - Intergenic
1174901509 20:54505744-54505766 CTCTTCTTCATGTGTCCACATGG - Intronic
1175201868 20:57283621-57283643 CTTTTCATCTTGAGGCCTCAGGG + Intergenic
1175257030 20:57653686-57653708 CTGAGCTTGTTGAGGCCCCAGGG - Intronic
1180390732 22:12279946-12279968 CTGTTCTTCTCGAGGCAGCTTGG - Intergenic
1180506466 22:16013270-16013292 CTTTTCTACTATAGGCCACAAGG + Intergenic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182441213 22:30365414-30365436 CTTTTCTTCCACAGGCCACAGGG + Intronic
1182964835 22:34511287-34511309 CTGTTCTGCTTGTCCCCACAGGG + Intergenic
1182966711 22:34528441-34528463 CAGTTCTTTTTCAGGCCACTTGG - Intergenic
1183366388 22:37409304-37409326 CTGGGCTCCTTGGGGCCACAGGG - Intronic
1185298259 22:50064805-50064827 TTGTTTTTCTTGAGCCAACACGG - Intronic
1185355061 22:50363559-50363581 CTCTTCTTCTTGAGGGCATATGG + Intronic
1203332189 22_KI270739v1_random:8498-8520 CTTTTCTACTATAGGCCACAAGG - Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950305338 3:11912146-11912168 ACGCTCTTCTTGAGGCTACAGGG - Intergenic
950325014 3:12099257-12099279 CTATTCTTCTCAAGGGCACATGG + Intronic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950988142 3:17399188-17399210 CCATTCTTCTTCAGGGCACAGGG + Intronic
951294387 3:20916277-20916299 CTCTTCTCCTTTAGGGCACAAGG - Intergenic
951805956 3:26643640-26643662 GTGATCTTCTGGAGGACACAAGG + Intronic
953051921 3:39352217-39352239 CTCTTCTTTTTGAGGCTAAAAGG - Intergenic
953686494 3:45082162-45082184 CTGTTCTTGTGGGGGCTACATGG - Intergenic
954280880 3:49576863-49576885 CCTTTCTTCTTGATGCCAGATGG + Intronic
955096562 3:55804593-55804615 CAGTTCTTCTTAGGGTCACAAGG - Intronic
956389956 3:68760962-68760984 CTCTACTTTTTGAGACCACAGGG - Intronic
956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG + Intergenic
956900939 3:73715419-73715441 CTGCTGCTGTTGAGGCCACAGGG + Intergenic
957142343 3:76376907-76376929 CTGGTCTTCTTGGTTCCACAGGG + Intronic
960085911 3:113591188-113591210 CTGTACTTCTGGAGGCTGCAGGG - Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
963140360 3:141941792-141941814 CTTTTGTTCTTGTAGCCACATGG - Intergenic
965965765 3:174486906-174486928 CAGCTCTTGTTTAGGCCACATGG - Intronic
967220860 3:187246973-187246995 CTGGTCAGCCTGAGGCCACATGG + Intronic
968632109 4:1657085-1657107 CTCTTCTTTTCGTGGCCACAGGG + Intronic
969089822 4:4685385-4685407 CTGTTCTTCCTGACCCCACCAGG - Intergenic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
974009438 4:56593552-56593574 TTGTGCATCTTGAGGCCACCGGG + Intronic
974187057 4:58458975-58458997 GAGTTCTGCTTGTGGCCACAGGG - Intergenic
975373615 4:73616139-73616161 CTCTTATTTCTGAGGCCACAAGG + Intronic
975458672 4:74624509-74624531 CTGTTCTACCTGACGGCACAAGG + Intergenic
978496959 4:109369938-109369960 CTGTACTTCCTAGGGCCACATGG + Intergenic
979611036 4:122688967-122688989 TTTTGCCTCTTGAGGCCACAGGG - Intergenic
982090998 4:151879855-151879877 CTGTTCTTACAGATGCCACAGGG - Intergenic
982158340 4:152542014-152542036 CTCAGCTTCCTGAGGCCACAGGG + Intergenic
983658867 4:170111638-170111660 CTTCTCTTCTAGAGGCTACAGGG + Intergenic
988340167 5:29960506-29960528 CTGTGCTTCTGGTGGCCACAGGG + Intergenic
988369973 5:30355893-30355915 GTTTTCTTCCTGAGGGCACAAGG - Intergenic
988884437 5:35539977-35539999 TAGTTCTCCTGGAGGCCACAGGG + Intergenic
990778637 5:59332889-59332911 CTGTTCCTCTTGATGGCAAATGG - Intronic
990939837 5:61190697-61190719 TTGTTCTCCTTGAAGCCACTGGG - Intergenic
994623006 5:102185752-102185774 CTTTTCTTCTTGGGACCTCAAGG - Intergenic
998566537 5:143220815-143220837 CTGATCTTCTGGAAGCCTCAAGG + Intronic
999248819 5:150169478-150169500 CTGACCTTCTTGAAGCCAGAAGG + Intronic
1002775383 6:323977-323999 CTTTTCTTCTTCAGGGCATAGGG - Intronic
1007424767 6:41739823-41739845 GTGCTCTTCTGCAGGCCACAGGG - Exonic
1008437372 6:51492155-51492177 CTTTTCTTCTTGAGCCCACAGGG + Intergenic
1009298683 6:61987496-61987518 TTTTTCTTCTTGATGCCCCAGGG + Intronic
1014198184 6:118582030-118582052 CAGTTCTTTTAGCGGCCACAGGG + Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1016632255 6:146247106-146247128 CTCTTCTTCTTCAGTCCACAAGG + Intronic
1017377726 6:153790200-153790222 CTGTTCCTCCTGAGGCCTCCGGG - Intergenic
1018470059 6:164087053-164087075 TTTTTCTTTTTGAGGCCAGATGG - Intergenic
1019642151 7:2109250-2109272 GGCTTCTTCTTCAGGCCACATGG + Intronic
1023039359 7:36158935-36158957 CTCTTCTTATGTAGGCCACAGGG - Intronic
1024408607 7:49012473-49012495 ATATTCTTCTTGATGCCACATGG + Intergenic
1033073366 7:138225182-138225204 GTTTTCTTCTTGAGGCAAAATGG - Intergenic
1033718758 7:144034066-144034088 CTGAACTTCATGAGACCACAGGG - Intergenic
1034076808 7:148239909-148239931 CTCTTCTACTTAAAGCCACATGG + Intronic
1034731702 7:153392711-153392733 CTGTTCTTCTTGTCCCCATATGG - Intergenic
1036672271 8:10799360-10799382 CAGTTCTCCTTGAGGCCCCGAGG + Intronic
1038932680 8:32212659-32212681 GTGTTCTTCTTGATGACTCAAGG - Intronic
1041256243 8:55981867-55981889 CTGGTGTTCTTTATGCCACAAGG - Intronic
1041765030 8:61410534-61410556 CTGTTCTGATGGAGGCCAAAAGG - Intronic
1042014694 8:64295496-64295518 CTGTTCTTTGTAAGGCCTCAGGG + Intergenic
1047481548 8:125287996-125288018 CTGTTTTTCTTGTGGAGACAGGG + Intronic
1049469475 8:142769013-142769035 CTGGTTTTGTTGAGGCCTCAGGG + Intronic
1050532708 9:6604729-6604751 TTGTGCATCTTGAGGCCACCTGG - Exonic
1052415330 9:28170662-28170684 CATTCCTTCTTGAGGCCATAGGG + Intronic
1052788048 9:32848171-32848193 CTGCTCTTGTTAAGGCCACCAGG + Intergenic
1056237061 9:84605153-84605175 TTGTTCTTTAGGAGGCCACATGG + Intergenic
1057167867 9:92942504-92942526 GGGTGCTTCTTGAGGCCACCTGG + Intergenic
1057552361 9:96061298-96061320 CTGTTCCTCGTGAGGCCATGAGG - Intergenic
1058740355 9:107936616-107936638 CTTTTCTGCTTGAAGCCACTTGG + Intergenic
1059798497 9:117726139-117726161 CTGTTCTGCCTGATGTCACAAGG + Intergenic
1062053349 9:134458393-134458415 CTGTGCTTGTCGAGGCCCCATGG + Intergenic
1062086806 9:134653360-134653382 GTGTTCTGCCTGGGGCCACAGGG + Intronic
1062110561 9:134779930-134779952 CTGGGCCTCCTGAGGCCACAGGG + Intronic
1062651729 9:137581260-137581282 CTGTTCTTCAGGAGCCCCCAGGG + Intergenic
1186500543 X:10047187-10047209 CAGTCCTTCTTGACTCCACAAGG - Intronic
1187090512 X:16091383-16091405 GTGTTTTTCATCAGGCCACATGG - Intergenic
1189960973 X:46324505-46324527 CCATTATTCTGGAGGCCACAAGG - Intergenic
1200937178 Y:8748598-8748620 CTGCACTTCTTGAGGCTTCATGG + Intergenic
1202598594 Y:26569490-26569512 CTGCTCTTCATGAAACCACAAGG + Intergenic