ID: 919895158

View in Genome Browser
Species Human (GRCh38)
Location 1:202005039-202005061
Sequence CAGAATATCCCCGAACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919895158_919895165 15 Left 919895158 1:202005039-202005061 CCTGCCTGTTCGGGGATATTCTG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 919895165 1:202005077-202005099 TCCTCAAGGCTCTGGATTTTAGG 0: 1
1: 0
2: 1
3: 18
4: 183
919895158_919895160 -10 Left 919895158 1:202005039-202005061 CCTGCCTGTTCGGGGATATTCTG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 919895160 1:202005052-202005074 GGATATTCTGAGCCCTTTGATGG 0: 1
1: 0
2: 9
3: 305
4: 3054
919895158_919895161 1 Left 919895158 1:202005039-202005061 CCTGCCTGTTCGGGGATATTCTG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 919895161 1:202005063-202005085 GCCCTTTGATGGCTTCCTCAAGG 0: 1
1: 0
2: 3
3: 13
4: 153
919895158_919895164 7 Left 919895158 1:202005039-202005061 CCTGCCTGTTCGGGGATATTCTG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 919895164 1:202005069-202005091 TGATGGCTTCCTCAAGGCTCTGG 0: 1
1: 0
2: 3
3: 26
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919895158 Original CRISPR CAGAATATCCCCGAACAGGC AGG (reversed) Intronic
914834638 1:151197156-151197178 TAGAATATCCCCATGCAGGCCGG - Intergenic
915245236 1:154551720-154551742 CAGACAATCCCCGCCCAGGCCGG + Intronic
917617258 1:176758818-176758840 CAGAAAACCCATGAACAGGCAGG - Intronic
919895158 1:202005039-202005061 CAGAATATCCCCGAACAGGCAGG - Intronic
920355729 1:205370924-205370946 CAGAATATGCCAGCATAGGCAGG - Intergenic
921334509 1:214072818-214072840 CAGATTCTCCCAGAACAGGAGGG - Intergenic
1063764158 10:9118283-9118305 TAGAATATCACAGAAGAGGCAGG + Intergenic
1066498448 10:35965649-35965671 CAGAATATCCAAGAACAGTGGGG + Intergenic
1071612438 10:87043817-87043839 CAAAAAAACCCCAAACAGGCCGG + Intergenic
1076014317 10:127015479-127015501 AAGAAGAGCCCCGAAGAGGCAGG - Intronic
1076042229 10:127260009-127260031 CAGAATATCCCAGGAGAAGCTGG - Intronic
1076176728 10:128373949-128373971 CAGAAGCTCCCCGTGCAGGCTGG + Intergenic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1080370863 11:31640977-31640999 CAGAAGCTCCCAGAACAGGAGGG - Intronic
1080555321 11:33410909-33410931 CAGTATTTCCCAGAGCAGGCTGG - Intergenic
1080755210 11:35190806-35190828 GAGAACATTCCCCAACAGGCTGG - Intronic
1081498452 11:43640072-43640094 CAGAATATGCCCGCAAATGCTGG + Intronic
1084524421 11:69686850-69686872 CAGAAGCACCCAGAACAGGCAGG - Intergenic
1084605226 11:70168339-70168361 CAGAATGTCCCCCAACAGAGGGG + Intronic
1088134630 11:106539610-106539632 CAGAATATTCATGAAGAGGCAGG - Intergenic
1091948123 12:4567628-4567650 CATAATATCCCCTTACAGGATGG - Intronic
1095685554 12:45029566-45029588 CAGAATGACCCAGAATAGGCTGG + Intronic
1097167392 12:57093157-57093179 CAGACTCTCCCCAGACAGGCTGG - Exonic
1099072239 12:78059581-78059603 AAAAATATCCCCAAATAGGCGGG - Intronic
1105642878 13:22284388-22284410 CAGTGTATCCCCGAACAGAAAGG - Intergenic
1109891969 13:68626568-68626590 CAGAATGTTCCTGAATAGGCAGG + Intergenic
1122056179 14:99099675-99099697 CAGAACATCCCAGAACAGAGGGG + Intergenic
1132212337 15:100033727-100033749 GAGAAGATCCCCGAATTGGCTGG - Intronic
1132384028 15:101387213-101387235 CAGAATCTCCCCTAACAGTGAGG - Intronic
1142097587 16:88250853-88250875 CGGAAAAACCCCGAACAGGTAGG - Intergenic
1144841377 17:18188448-18188470 CAGACTATCCCAGAACTGACAGG - Intronic
1151348065 17:73515498-73515520 CAGAATATCCCAGAAGAGACTGG + Intronic
1153122781 18:1750541-1750563 CAGAATATCCAAGAACTGTCAGG + Intergenic
1158398545 18:57099059-57099081 CAGAATATACCCAAAGAGTCTGG - Intergenic
1158690481 18:59655720-59655742 CAGAACATCCCACAAAAGGCAGG + Intronic
1160604465 18:80039016-80039038 AAGAATATCCCAGATGAGGCTGG + Intronic
1160809022 19:1005042-1005064 CAGCAGGTCCCCGACCAGGCCGG - Exonic
1161713990 19:5865317-5865339 CAGAATATTCCAGAACATTCTGG - Intergenic
1162949377 19:14061704-14061726 CGGAAAATCCCCGAAGAGGAAGG + Intergenic
1163801542 19:19368691-19368713 CAAAAAATCCCAGCACAGGCCGG + Intergenic
931788776 2:65645039-65645061 CAGACTATCCACCACCAGGCAGG - Intergenic
933577520 2:84086631-84086653 CAAAATATCCCCCAAGAAGCAGG + Intergenic
936797403 2:116224065-116224087 CAGACTGCCCCAGAACAGGCTGG + Intergenic
1175459797 20:59143821-59143843 AAGAAAATCCCCAACCAGGCTGG + Intergenic
1184384463 22:44166455-44166477 CAGGATATCCTCTGACAGGCCGG + Intronic
954329842 3:49884056-49884078 CAGAATATTCCCTGAAAGGCTGG + Intergenic
954417657 3:50401574-50401596 CAGAATTTCCCAGAACATCCTGG + Intronic
957286476 3:78223329-78223351 CAAAAGATCCCCAACCAGGCCGG + Intergenic
962267084 3:133951557-133951579 CAGAAAATCCCCGGGCAGGAGGG + Intronic
972429562 4:38967622-38967644 CAGAATATCCCCGGGCAAGTTGG - Exonic
972719368 4:41680840-41680862 CAGAATATGTTCGAACAAGCAGG - Intronic
983877713 4:172896545-172896567 CAGCAGATCCCTGCACAGGCAGG + Intronic
985229259 4:187797550-187797572 AAGAATAACACAGAACAGGCCGG - Intergenic
998269871 5:140696980-140697002 CAGACTATCCCAGAACAAGCAGG + Exonic
999774041 5:154797527-154797549 TAGAAAATACCAGAACAGGCCGG - Intronic
1003315893 6:5011538-5011560 CTGGATATCCCCTCACAGGCGGG + Intergenic
1015804524 6:137095098-137095120 CAGATTCTCCCCAAACAGGAAGG - Intergenic
1019177693 6:170168706-170168728 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177698 6:170168726-170168748 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177716 6:170168826-170168848 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177793 6:170169260-170169282 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177830 6:170169460-170169482 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177914 6:170169917-170169939 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019177943 6:170170077-170170099 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019178005 6:170170437-170170459 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019178010 6:170170457-170170479 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019178030 6:170170577-170170599 GGGAACAACCCCGAACAGGCAGG - Intergenic
1019178084 6:170170815-170170837 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019178089 6:170170835-170170857 AGGAACAACCCCGAACAGGCAGG - Intergenic
1019314070 7:376524-376546 AGGAATATCCCAGAACAGTCAGG - Intergenic
1019558582 7:1644825-1644847 CAGGATCTCCTCAAACAGGCGGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042267738 8:66925847-66925869 CAGAATATGCCCTAAAAGGCCGG + Intergenic
1046624426 8:116561690-116561712 TAGTATGTCCCCGACCAGGCAGG + Intergenic
1048314513 8:133352256-133352278 CAGTTTATCCCATAACAGGCAGG + Intergenic
1048573481 8:135673271-135673293 CAGAACAACCCAGAACACGCTGG + Intergenic
1048977876 8:139683141-139683163 CAGAATCTTCCCGTACAGGCAGG - Intronic
1050613625 9:7379153-7379175 CACAATATCTCCGGAAAGGCAGG + Intergenic
1058643050 9:107105744-107105766 CAGAGAATCCCCAAACAGGTAGG + Intergenic
1058693547 9:107539623-107539645 AAGAATGTCCCCAAACTGGCCGG + Intergenic
1061356489 9:130109465-130109487 AAGAATATCCCCAAAGAGGCTGG - Intronic
1185518435 X:718395-718417 CAGAATATACCCCACCAGGAGGG + Intergenic
1194217217 X:91145710-91145732 CAGAATATCCAGAAACAGCCCGG - Intergenic
1197784523 X:130187002-130187024 CAGAATCTCCCCCAAAGGGCTGG + Intergenic