ID: 919895813

View in Genome Browser
Species Human (GRCh38)
Location 1:202009260-202009282
Sequence CCTTCTTGAGACCCTGAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919895813_919895819 8 Left 919895813 1:202009260-202009282 CCCCATTCAGGGTCTCAAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 919895819 1:202009291-202009313 GACACTATCCATTGTGTTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 127
919895813_919895818 7 Left 919895813 1:202009260-202009282 CCCCATTCAGGGTCTCAAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 919895818 1:202009290-202009312 AGACACTATCCATTGTGTTTCGG 0: 1
1: 0
2: 0
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919895813 Original CRISPR CCTTCTTGAGACCCTGAATG GGG (reversed) Exonic
900468199 1:2835939-2835961 CCTTCAGGAGACCCTGTCTGAGG - Intergenic
900940671 1:5796600-5796622 CCTTCCTGAGTGCCTGAGTGTGG - Intergenic
903051029 1:20601243-20601265 CTCTCTTGAGACACTGAGTGTGG - Intronic
905169443 1:36100452-36100474 ACTTCTTCAGACCCTGCCTGTGG + Intronic
906692327 1:47800716-47800738 CCTTCCTGAGCCCCTGGATAGGG - Intronic
906931207 1:50171221-50171243 CCTTCTTAACACACTGACTGGGG - Intronic
910739965 1:90504329-90504351 CCTTCCTGAGAAACTGAAAGTGG + Intergenic
912691912 1:111810987-111811009 CCTTCCTGAGGCCCTGAAGCTGG - Intronic
913031222 1:114904955-114904977 TCTTCTTTAGACCATTAATGTGG + Intronic
913091334 1:115478703-115478725 CCATCTTGAGAGCCTGATTGAGG - Intergenic
913145429 1:115985108-115985130 CCTGCGTGAGTCACTGAATGAGG - Intronic
917234402 1:172874923-172874945 CCTTCTGTAGACCCTGTAGGGGG - Intergenic
918575533 1:186054763-186054785 CCATCTTGAGACCATGAAGGAGG - Intronic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
920405208 1:205703915-205703937 CCCTTGTGAGACACTGAATGTGG - Intergenic
920606895 1:207397757-207397779 CCTACTGTATACCCTGAATGAGG + Intergenic
922764775 1:228151090-228151112 CCTGCTTGGGACCCTGAGGGAGG + Intronic
1068627639 10:59266434-59266456 CCTTCCTGACAGCCTGACTGTGG - Intronic
1069156334 10:65035156-65035178 CCTTCTTGTCACCCACAATGTGG - Intergenic
1070761856 10:79028848-79028870 CCTACTTTAGACCCTTAATTTGG + Intergenic
1070821168 10:79355492-79355514 CCTTCCTAAGACCCTGACAGGGG - Intergenic
1071166726 10:82816150-82816172 CCTTCTTGTCACCCACAATGTGG + Intronic
1073249362 10:102112464-102112486 CCCTCCTGAGACCCTGAGGGTGG - Intronic
1074475974 10:113774883-113774905 CCTTCCAGAGACCCAGGATGGGG + Exonic
1075055568 10:119215775-119215797 CCTTCTTGAAATTCTTAATGTGG + Intronic
1075125564 10:119696406-119696428 TCCTCTTTAGACCCTGGATGTGG + Intergenic
1077030365 11:462782-462804 CCTTCTGGACACCCTGTGTGGGG - Intronic
1078211219 11:9271058-9271080 CCGTTTTGAAAACCTGAATGAGG + Intergenic
1080191374 11:29553145-29553167 CCTTCCTGAGACTCTGCCTGAGG + Intergenic
1080421457 11:32114720-32114742 CCATCTAGAGATCCAGAATGGGG - Intergenic
1083168886 11:60910286-60910308 CATTCCTGAGGCCATGAATGAGG + Intergenic
1086334315 11:85784159-85784181 CTTTCTAGAGACCCTGACAGAGG + Intronic
1091888603 12:4034522-4034544 CCTTCTTGAGAGCTTGAAGTGGG - Intergenic
1092271966 12:7030701-7030723 CCTTCTTGTCACCCACAATGTGG + Intronic
1093764899 12:22952114-22952136 CCTTCTTGTCACCCGCAATGTGG + Intergenic
1096593643 12:52679847-52679869 CCTTCTTCAGCCCCTCAATGTGG - Exonic
1097495106 12:60322150-60322172 CCTTCTGGAGGCTCTGAAGGTGG - Intergenic
1098301259 12:69056279-69056301 CCTCCTGGAGACCCTGAAGGAGG + Intergenic
1103719343 12:122965208-122965230 CATCCTGGAGACCCTGGATGCGG - Intronic
1106713537 13:32364339-32364361 GCCTCTTGGGACCATGAATGAGG - Intronic
1109176321 13:59161335-59161357 CCATCTTGAGAACCTGGAGGTGG - Intergenic
1110136218 13:72070707-72070729 CCTTCTTGAGTACCTGCCTGAGG - Intergenic
1111172577 13:84547574-84547596 GCTTCTTGAGGGCCTGAAGGAGG - Intergenic
1112038747 13:95524234-95524256 GCTTCTTGAGTCTATGAATGAGG + Intronic
1112889730 13:104214081-104214103 CCTGCTTCAGACACTGATTGAGG + Intergenic
1113089617 13:106603339-106603361 TCTTCTTGAAACCCTGTATCTGG + Intergenic
1118495621 14:66305571-66305593 TTCTCTGGAGACCCTGAATGGGG - Intergenic
1119095703 14:71828734-71828756 CCTTTCTGAGACCCTCAATCTGG - Intergenic
1121775662 14:96588891-96588913 CCTTCCTGAGGCCGTGAATGGGG + Intergenic
1122209762 14:100166513-100166535 CCTTCCTGAGACCCCGGAGGAGG + Intergenic
1123940090 15:25212570-25212592 CCCACCTGTGACCCTGAATGGGG + Intergenic
1123942685 15:25224214-25224236 CCCACCTGTGACCCTGAATGGGG + Intergenic
1124269824 15:28270366-28270388 CCTTCTTCATACTCTGAACGCGG - Intronic
1125718232 15:41831906-41831928 CCTTCTGGACACCCACAATGTGG - Intronic
1126327208 15:47492570-47492592 ACTGCTTGAGAACCTGAATATGG + Intronic
1129187580 15:73919601-73919623 CCTTCTTGTGTCCCTGTAGGAGG - Intergenic
1130001043 15:80047046-80047068 GCTTCATGAGACCCTCAAAGAGG + Intergenic
1132389516 15:101428173-101428195 CCTTCCTGGCATCCTGAATGTGG + Intronic
1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG + Intronic
1132881859 16:2165830-2165852 CCTCCTTGTGTCCCGGAATGAGG + Intronic
1133594505 16:7278318-7278340 CCATCTAGAGACACTGAAGGAGG - Intronic
1134005958 16:10818900-10818922 CCTTCTCCCAACCCTGAATGCGG - Intergenic
1134086682 16:11362185-11362207 CCTTCCTGAAACCCTGAAAGAGG + Intronic
1135683378 16:24478112-24478134 CCATCTTGAGACAGAGAATGAGG - Intergenic
1136079517 16:27842568-27842590 CCTTCCTGAGACCTTGAACTTGG - Intronic
1136704881 16:32179057-32179079 CCTTCTTTATACTCTGAACGTGG - Intergenic
1136763034 16:32750350-32750372 CCTTCTTTATACTCTGAACGTGG + Intergenic
1136805066 16:33120036-33120058 CCTTCTTTATACTCTGAACGTGG - Intergenic
1138388257 16:56651473-56651495 CACTCTTGAGAAGCTGAATGGGG - Intronic
1138802327 16:60048397-60048419 TCTTCTTGAGATCCTCAATATGG + Intergenic
1139506820 16:67402442-67402464 CACTCTTCAGACACTGAATGAGG + Intronic
1140176807 16:72669216-72669238 CCTTTTAGAGACCTTGAAAGAGG + Intergenic
1140877084 16:79162711-79162733 AATTCTTGAGCCTCTGAATGGGG - Intronic
1141791598 16:86239907-86239929 TATTCCTAAGACCCTGAATGAGG + Intergenic
1141827044 16:86487902-86487924 CCTTCTGGAGACTCTGACGGAGG + Intergenic
1142242390 16:88953500-88953522 CACTCTTGGGACCCTGAGTGTGG + Intronic
1142308461 16:89298905-89298927 TTTTCTTGAGTGCCTGAATGTGG + Intronic
1203065185 16_KI270728v1_random:1010672-1010694 CCTTCTTTATACTCTGAACGTGG + Intergenic
1144710752 17:17399965-17399987 ACATCTTGAGGCCCTGACTGGGG - Intergenic
1144778492 17:17796502-17796524 GCTGCTGGAGACCTTGAATGTGG - Exonic
1149830490 17:59867574-59867596 CCTACTTGAGAAACTGAGTGGGG + Intronic
1153170628 18:2312017-2312039 CCTTCTTGACTCCATGACTGTGG - Intergenic
1154464993 18:14635158-14635180 CCTTCTTGAGATAAGGAATGAGG + Intergenic
1157565511 18:48676659-48676681 CCTTCTGGGGACCCTCAATGGGG - Intronic
1159521874 18:69536182-69536204 CCTTCTTGAAACACTTAAGGTGG + Intronic
1161250885 19:3279628-3279650 CCTTCTTGAGCCCCAGAGTCGGG + Intronic
1161729549 19:5951023-5951045 CCTTCTTGTTTCCCTGAATGCGG - Intronic
1162351758 19:10154624-10154646 TCTTCCTGACACCCTGCATGCGG - Exonic
1162382708 19:10340847-10340869 CCTTGTTGAGAGCCTTGATGGGG + Intergenic
1165896231 19:39142816-39142838 CCTTCTTGACAGCCTGATGGTGG + Intronic
1167224725 19:48230193-48230215 CCTTCTTGAGAGCCAGAAAAGGG + Intronic
925595003 2:5546593-5546615 ACTTCTTGAGACCTCCAATGAGG - Intergenic
925650335 2:6082636-6082658 ACTACTTCAGACCCTGAATATGG - Intergenic
926891488 2:17643037-17643059 CCTTCTGGAGAGCCTACATGTGG + Intronic
927186117 2:20483849-20483871 CCAAGCTGAGACCCTGAATGAGG + Intergenic
929715556 2:44305873-44305895 CCTTCTGGAGCCCCCAAATGAGG + Intronic
931005749 2:57849200-57849222 CCTTCTTGTCACCCTCAATGTGG + Intergenic
937550095 2:123077428-123077450 GCTCCTTGAGAAGCTGAATGGGG - Intergenic
939167505 2:138655230-138655252 CCTTGTGGAGAACCTGAGTGTGG + Intergenic
939414693 2:141880200-141880222 CCTTCCTCAGAATCTGAATGAGG - Intronic
939986351 2:148833185-148833207 CTTTCTTGCTACCCAGAATGTGG - Intergenic
942867976 2:180699155-180699177 CCTTCTTATCACCCTCAATGTGG + Intergenic
942898337 2:181085092-181085114 CCTGCTTGAGACCCTGGGAGAGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946362652 2:219228675-219228697 ACTTCTTGAGACCCTGGAGTTGG - Intronic
948961953 2:241346169-241346191 CCTCCTGGAGATCCTGCATGTGG - Exonic
1169060840 20:2659435-2659457 CCCTCTGGGGAACCTGAATGGGG - Intronic
1171819931 20:29825926-29825948 CCTTCTTGTAACCCTAAATATGG - Intergenic
1174205198 20:48833241-48833263 CCATCTTGAGACCCTGAGATAGG + Intergenic
1175643855 20:60654500-60654522 CCTTCTTGAGATACTGACTCTGG + Intergenic
1176118944 20:63445543-63445565 CCCTCTGGAGACCCTGCATCCGG + Intronic
1176809544 21:13523226-13523248 CCTTCTTGAGATAAGGAATGAGG - Intergenic
1180323923 22:11350616-11350638 CCTTCTTGTAACCCTAAATATGG - Intergenic
1182460377 22:30479277-30479299 CCTTCTTGAGTCCCTCAAAGGGG + Intergenic
1185027526 22:48424325-48424347 CTTTCTTGAGCACCTGGATGCGG + Intergenic
1185230983 22:49682085-49682107 CCTTCTTTAGACAGTTAATGTGG + Intergenic
950574365 3:13822917-13822939 CCCTCTTGGTCCCCTGAATGTGG + Intronic
950690243 3:14650420-14650442 CCTTCTGGAGACTCTGGAGGAGG + Intergenic
952279696 3:31911087-31911109 CCTGCTTCAGACCCTGTTTGAGG + Intronic
956767485 3:72496229-72496251 CCTGTTTCAGACCCTGCATGAGG + Intergenic
957680563 3:83428042-83428064 CTTTCTTGAGACACATAATGAGG - Intergenic
960013297 3:112856760-112856782 CCTTCTTGAGCACCCAAATGAGG - Intergenic
963028760 3:140945547-140945569 CCTTCTTGAGACCCTTGTTGTGG + Intronic
966822206 3:183933913-183933935 CCTCCTAGAGACTCTGAATCTGG - Intronic
967295855 3:187964025-187964047 TCTTCTTGATACCCTGTAAGTGG - Intergenic
969150388 4:5164214-5164236 CCTTCTAGAGGCTCTGAAGGTGG + Intronic
969191974 4:5529207-5529229 CCTACTTTACCCCCTGAATGAGG - Intergenic
970871458 4:20821170-20821192 CCTTCTTGACATACTGAGTGGGG - Intronic
973286298 4:48420469-48420491 CATTCTTGAGTGCCTGAAAGTGG + Intronic
978956729 4:114623246-114623268 CTTTCTTCAGACCCTGGATCAGG - Exonic
981008247 4:139897595-139897617 ACATATTGAGACTCTGAATGGGG - Intronic
981291210 4:143078257-143078279 TCTTCTGAAGAACCTGAATGAGG - Intergenic
982586807 4:157251898-157251920 CATTCTTGAGACCCTATACGGGG + Intronic
983001515 4:162419973-162419995 TCACCTTGAGAACCTGAATGAGG + Intergenic
985852251 5:2397398-2397420 CCCTCCTGAAACCATGAATGGGG + Intergenic
986093452 5:4533860-4533882 ACTTCTGGAGACCCTGCAAGGGG - Intergenic
991308808 5:65211862-65211884 CCTTATTGAGCACCTTAATGAGG - Intronic
992437133 5:76765690-76765712 CCTTCCTGAGAACCTGACAGAGG - Intergenic
992906350 5:81349593-81349615 CCTTCAAGAGACCCTGAAGGTGG - Intronic
998000356 5:138620339-138620361 GCCTCTTGAGACCCTGTAGGAGG + Intronic
998010962 5:138695277-138695299 CCTTCTTCAGACTCTGATTAGGG + Intronic
998524088 5:142826659-142826681 CCTTCTTGAGACCCATGAGGTGG + Intronic
999585704 5:153087549-153087571 CCTTCTGGAGTCTCTGAAGGAGG + Intergenic
1004131748 6:12927495-12927517 CCTTCTTGATAGGCTTAATGTGG - Intronic
1004596576 6:17104932-17104954 GCTTCTTGTATCCCTGAATGTGG - Intronic
1006300590 6:33191904-33191926 CACTTTAGAGACCCTGAATGGGG - Intronic
1012168769 6:95991602-95991624 CCTTCCTGAGCCCATGAATGTGG - Intergenic
1016974999 6:149798860-149798882 GCTGCTTGAGACTCTGCATGAGG + Intronic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1020004946 7:4777806-4777828 CCTTCTTGAAACCCTAACAGAGG - Intronic
1021410149 7:20320850-20320872 CCTTCCTAAGACTCTGACTGTGG + Intergenic
1022544637 7:31174536-31174558 CCTTTTTCTGACCCTAAATGGGG - Intergenic
1022685439 7:32591959-32591981 CATTCCTGAGAGCATGAATGTGG - Intergenic
1027575256 7:79922821-79922843 CCTTCTTGTTACCCACAATGTGG - Intergenic
1027943908 7:84722062-84722084 CCTTCCTGAGACCCTGACTAGGG - Intergenic
1028035061 7:85972019-85972041 CCTTCTTGATATCCACAATGTGG + Intergenic
1030243935 7:107360451-107360473 CCTTCTTGTTGCCCAGAATGTGG - Intronic
1038632389 8:29258432-29258454 GCTTCTTGGGACCTTGTATGGGG - Intronic
1039155780 8:34554904-34554926 CCATGCTGACACCCTGAATGTGG + Intergenic
1039845368 8:41321856-41321878 CCCTCTTGAAGCCCTGAATATGG - Intergenic
1044552293 8:93525749-93525771 CATTCTTGAGATCCTTAAGGGGG + Intergenic
1044854593 8:96462079-96462101 GCTTATAGAGATCCTGAATGTGG - Intergenic
1045306815 8:100964766-100964788 CCTTCTTGATGGCCAGAATGTGG + Intergenic
1045318575 8:101064013-101064035 CTTCCCTGAGCCCCTGAATGAGG - Intergenic
1046307304 8:112386134-112386156 CATTCCTGAGACCCTGAAGTGGG + Intronic
1047517092 8:125564423-125564445 CCTTCTTGCTACCTGGAATGTGG - Intergenic
1047743939 8:127829846-127829868 CCCTCCTGACACCCTGAATTTGG - Intergenic
1051249730 9:15147191-15147213 CCCTCTACAGACCCTGAAAGTGG + Intergenic
1051334766 9:16055744-16055766 CCTTCCTGAGCCCCTGAACTTGG - Intronic
1051432989 9:16999417-16999439 CCTCCTTGAGACCCCATATGAGG + Intergenic
1052184629 9:25577251-25577273 CCATCTGGAGACCCTGAAGATGG - Intergenic
1052292501 9:26859159-26859181 CCTCCTTGAGAACCTGAGTGTGG + Intronic
1054725576 9:68646844-68646866 CCATCTTGAGACCTTGAAGGAGG + Intergenic
1055076580 9:72221308-72221330 CCTTCATCAGAGCCTTAATGTGG + Intronic
1056470039 9:86896848-86896870 CCTTCTTGAACCCCTGGAGGGGG + Intergenic
1056617867 9:88184033-88184055 CCTTTCTGACACCCTGTATGTGG + Intergenic
1056994380 9:91442856-91442878 CCTTCTTGTCATCCGGAATGTGG + Intergenic
1060906641 9:127313080-127313102 CCATCTTGTGACCCTGAACAGGG - Intronic
1061595203 9:131624480-131624502 CCCTCTATAGACCCTGCATGAGG + Intronic
1062588871 9:137263990-137264012 CCTTCATGGCACCCTGAGTGTGG - Intronic
1203371599 Un_KI270442v1:311190-311212 CCTTCTTGTAACCCTAAATATGG - Intergenic
1187397676 X:18932238-18932260 GCTTTTTGAGGCCCTGAAGGAGG - Intronic
1188207844 X:27381335-27381357 CCTTCTTGTAACCCTCAATGTGG - Intergenic
1188589868 X:31820674-31820696 CCTTCATCAGTCACTGAATGAGG - Intronic
1189169666 X:38897001-38897023 CCTTCTTGTGTTCCTGAGTGGGG + Intergenic
1192316312 X:70054516-70054538 ACTTCGTGAGCCACTGAATGGGG - Intergenic
1194925687 X:99820360-99820382 CCTACTTGAGACTGTGTATGTGG - Intergenic
1197342288 X:125288230-125288252 CCTTCTTGTCACCCTCAACGTGG - Intergenic