ID: 919896763

View in Genome Browser
Species Human (GRCh38)
Location 1:202013798-202013820
Sequence GATGGCAAACTGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919896757_919896763 0 Left 919896757 1:202013775-202013797 CCTTGGGTGAGAGGGGACACCTG 0: 1
1: 0
2: 4
3: 24
4: 256
Right 919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919896763 Original CRISPR GATGGCAAACTGATGGAGGC TGG Intronic
902645021 1:17791931-17791953 GATAGCAAAGAGATGGTGGCAGG - Intronic
904657675 1:32061617-32061639 GGTGACAAACTCATCGAGGCTGG - Intergenic
904985619 1:34546113-34546135 AATGGCAAACTCAGGCAGGCAGG - Intergenic
906743812 1:48207710-48207732 GATGGCAAAGTGCTGGTGGCGGG - Intergenic
907445057 1:54502099-54502121 GCTGGTAATGTGATGGAGGCTGG - Intergenic
907841799 1:58165363-58165385 TATGGCAAACAGATGGAGAGAGG - Intronic
908465724 1:64391995-64392017 GATGGTAAGCTCATTGAGGCAGG + Intergenic
911083634 1:93957928-93957950 GAGAGCAAAGTCATGGAGGCTGG - Intergenic
913674063 1:121124977-121124999 GATGGCAAAGAGATGCAGGTTGG - Intergenic
914025847 1:143912298-143912320 GATGGCAAAGAGATGCAGGTTGG - Intergenic
915469974 1:156120012-156120034 CATGTGAAACTGATGGAGGAAGG + Intronic
916686258 1:167150046-167150068 GATGGCTTATTGAAGGAGGCAGG + Intergenic
916983445 1:170165294-170165316 GATGGCAAGGTGGTGGAGGTAGG - Intronic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
920844970 1:209585968-209585990 GAAAGCAAACTGAAGCAGGCAGG + Intronic
922878520 1:228960780-228960802 GATGGGAAACTGAGGATGGCAGG + Intergenic
923523315 1:234752835-234752857 GATGGAGAAATGGTGGAGGCTGG + Intergenic
924612258 1:245583450-245583472 GGTGGGGAACTGATGGTGGCAGG - Intronic
924833995 1:247629582-247629604 GATGTGAAACTGGTAGAGGCAGG + Intergenic
1063663543 10:8049269-8049291 AATGGGAAGATGATGGAGGCGGG - Intergenic
1065866592 10:29920037-29920059 GCTGGCAAAATGAAGGGGGCAGG - Intergenic
1066364457 10:34763411-34763433 GTTGGCAAGCTGATGCAGGTGGG - Intronic
1069160329 10:65084510-65084532 GATGGCATATTGATGGCAGCAGG - Intergenic
1070771860 10:79087255-79087277 GATGGTAAAGTGTTGGAGGAAGG + Intronic
1071298756 10:84241265-84241287 GCTGGCAAAGCAATGGAGGCTGG + Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1074336391 10:112580674-112580696 AATGGCTAACTGTGGGAGGCAGG + Intronic
1074711870 10:116184395-116184417 AATGGGACACTGATGGATGCTGG - Intronic
1078061118 11:8045162-8045184 GATAGCTTAATGATGGAGGCTGG - Intronic
1079865518 11:25729080-25729102 GGTGGCAAAATGATGGAGGAAGG + Intergenic
1080158317 11:29139762-29139784 TATACAAAACTGATGGAGGCAGG - Intergenic
1080200974 11:29669531-29669553 ACTGTCAGACTGATGGAGGCAGG - Intergenic
1080428749 11:32179385-32179407 CATGTCAAAGTGATGGAGACAGG + Intergenic
1084431997 11:69116331-69116353 GATCACAAACTGGTGGGGGCTGG + Intergenic
1084590631 11:70088037-70088059 GAGGGCAACCTCCTGGAGGCGGG + Exonic
1089063915 11:115647638-115647660 GATGTCAAAATGAACGAGGCTGG - Intergenic
1089465014 11:118679487-118679509 GATGGCAATAAGAGGGAGGCTGG - Intronic
1091073683 11:132593303-132593325 GAAGGCGAAGTGGTGGAGGCAGG + Intronic
1092105798 12:5921065-5921087 GAGCACAATCTGATGGAGGCTGG - Exonic
1092683314 12:11013821-11013843 GGTGGGAAACAGATTGAGGCTGG - Intronic
1095719622 12:45386515-45386537 GAAGGCAGACGGATGGATGCAGG - Intronic
1097010840 12:55952624-55952646 GATGACAAACTGGAGAAGGCAGG - Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097375893 12:58841657-58841679 GAAGGCAAGCTGAAGCAGGCTGG - Intergenic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098169401 12:67731492-67731514 CATGGCAAAATGGTGGAGGAGGG - Intergenic
1102889966 12:116551008-116551030 CTTAGCAAACTGATGGAGGCTGG + Intergenic
1103173646 12:118843630-118843652 GATAGCAAATTGATGGTGGCAGG + Intergenic
1103786158 12:123434817-123434839 GAAGGCAAACTGGTGGTGGGGGG - Intronic
1106393281 13:29356317-29356339 GATGGCCAACTTCTGGAGGGTGG - Intronic
1108324053 13:49312935-49312957 GGTGGCACACTGCTGGAGGTGGG - Intronic
1108854437 13:54775582-54775604 GATGGCAGGCTGATGGTGGCGGG - Intergenic
1111595344 13:90403928-90403950 GATGGCAAGTTGATGGAGACAGG + Intergenic
1114860746 14:26517437-26517459 GAATGTAAACTGATAGAGGCAGG + Intronic
1117422227 14:55558086-55558108 TATGGAAAAATGATGCAGGCCGG - Intergenic
1117652787 14:57924300-57924322 GAAGGCAAGCAGATGGATGCTGG - Intronic
1120028453 14:79612461-79612483 GGTGGCAAACTGATGGAAAGTGG + Intronic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1124113398 15:26814884-26814906 AAAGGCAAAATGATGGAGACAGG + Intronic
1126117286 15:45219916-45219938 GATGTAAAACTCATGGAGTCTGG - Intergenic
1127395108 15:58538142-58538164 AATGGCCAAGTGATGGAGGGTGG - Intronic
1127692532 15:61412188-61412210 GGTGGAAAACTGATGGATGAAGG + Intergenic
1128109884 15:65069462-65069484 AATGGACAACTGCTGGAGGCAGG + Intronic
1129265577 15:74391588-74391610 CTTGGCAAAGTCATGGAGGCAGG - Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1132777745 16:1605181-1605203 GCTGGCAAAGCCATGGAGGCCGG + Intronic
1136411056 16:30077456-30077478 TTTGGCTAGCTGATGGAGGCAGG + Intronic
1138434428 16:56989299-56989321 GACGGGAAACTGAGGCAGGCGGG - Intergenic
1139463673 16:67142467-67142489 GATGGCACGCTGATGGTGGTAGG - Intronic
1140226179 16:73079195-73079217 GATATGAAAGTGATGGAGGCAGG - Intergenic
1140888056 16:79261752-79261774 GATGGGAAAATGATGAGGGCAGG + Intergenic
1141286271 16:82675387-82675409 AATGTCAAACTGATGGAAGGAGG + Intronic
1142821897 17:2475750-2475772 TAGAGCAAACTGATGGAGTCTGG + Intronic
1144553298 17:16260196-16260218 GATGGCAGATTGATGGCAGCAGG + Intronic
1147339287 17:39744316-39744338 GATGGTAAACTGGAGGTGGCTGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147902899 17:43801629-43801651 GATGGTAAAATGAGGGAGTCTGG + Exonic
1149932251 17:60768435-60768457 CATGGGAAAATGATGTAGGCTGG - Intronic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151763342 17:76119810-76119832 GAAGGCAAAGTGAAGGAGGTCGG + Intronic
1153129767 18:1841420-1841442 GAAGGCAAAGTGATGCAGGGCGG - Intergenic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1155384847 18:25266595-25266617 GAGGGCAAGCTGATGCAGGGTGG + Intronic
1155819160 18:30352861-30352883 GATGGCATGTTGATGGCGGCAGG + Intergenic
1157871732 18:51235654-51235676 GACTGGAAACTGATGGTGGCAGG + Intergenic
1158424519 18:57327135-57327157 GATGGCAGGTTGATGGAGGGAGG - Intergenic
1158506278 18:58048646-58048668 GGTTGCAAACTGATGGCTGCTGG + Intronic
1158532820 18:58278722-58278744 AATGGCACAATGATGGAGGTAGG - Intronic
1159217746 18:65418271-65418293 AATGTCAAACTCATGGAAGCAGG - Intergenic
1159292418 18:66439860-66439882 GACGGCAGGTTGATGGAGGCAGG + Intergenic
1159853022 18:73549360-73549382 GATGGCAGAATGATAGAGCCCGG - Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1161733214 19:5974933-5974955 GATGGCAAATGGATGGAGGAGGG + Intronic
1162461625 19:10817219-10817241 GATGGCAGACTGATAGGGCCAGG + Intronic
1162725809 19:12689259-12689281 GAGGGCAACCTGGTGGTGGCCGG - Exonic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166126733 19:40719099-40719121 GCTGGCAAGCTGATGGACTCCGG - Intronic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
927075933 2:19577624-19577646 GATGGCAGGATGATGCAGGCTGG + Intergenic
928251186 2:29682157-29682179 GATGGCAAAGAGATTGAGGAGGG + Intronic
929569044 2:43008437-43008459 GATGGCAAACTGAGGGTGCTGGG + Intergenic
929906142 2:46048395-46048417 CATGGGAAATTGATGGGGGCTGG - Intronic
929959540 2:46485928-46485950 TGTGGCAAACTGAATGAGGCTGG + Intergenic
931733967 2:65177590-65177612 GATGGCAGAGTGATGGCAGCAGG - Intergenic
932859509 2:75275116-75275138 GATGGCAAACTACTTGAGACTGG - Intergenic
933420814 2:82043207-82043229 GATGGCACAGGGATGCAGGCAGG + Intergenic
934682985 2:96299007-96299029 GGTGGCAAAGTGATCGAGGCTGG - Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935120416 2:100179249-100179271 TTTGGCAACCTGATGAAGGCAGG + Intergenic
935405374 2:102703612-102703634 GATGGTAAACTGCTCAAGGCAGG + Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936265801 2:111005390-111005412 GATGGAGAATTGGTGGAGGCTGG + Intronic
938042780 2:128090134-128090156 AATGGAACACTGATGGAGGCCGG - Intergenic
942887693 2:180947691-180947713 CTTGGCAAACTGAAGCAGGCAGG + Intergenic
943477201 2:188372196-188372218 AATGGCAAATTGATGAAGACTGG + Intronic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
946414139 2:219530993-219531015 GATGGCAAAATGAGGGTTGCTGG + Intronic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947228637 2:227863620-227863642 AATGGCAGCCTGATGCAGGCTGG + Intergenic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
948433579 2:237936621-237936643 GATGGCAAACAGGTGGGGGCAGG + Intergenic
948434507 2:237944024-237944046 GATGGCACATTGATGGCAGCAGG + Intergenic
949063908 2:241977845-241977867 GATGGCAAACCATGGGAGGCAGG - Intergenic
1169800998 20:9511572-9511594 GTTGACAAACTGATGTAGGGTGG - Intergenic
1170314965 20:15031900-15031922 GATGGCATGCTGATGGCGGGAGG - Intronic
1170439270 20:16361707-16361729 GATGGCAAACTGTTGGACATTGG + Intronic
1170813221 20:19691548-19691570 GGTAGCAAACAGATGGAGGTAGG + Intronic
1172886548 20:38234971-38234993 GATGGCAAAATGAGGGTGGTGGG + Intronic
1173192735 20:40888361-40888383 GCTGCCAGACTGATGGATGCTGG - Intergenic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1177404307 21:20645757-20645779 GATGGCAGGTTGATGGTGGCAGG + Intergenic
1178125303 21:29509595-29509617 GAGGGCAAAGTGAGGTAGGCTGG + Intronic
1179633037 21:42690522-42690544 CATGACAAACTGATCGTGGCTGG + Intronic
1181086044 22:20439830-20439852 GCAGGCAAACTGCTGGAGCCCGG + Intronic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182852057 22:33483735-33483757 TCTGTTAAACTGATGGAGGCAGG + Intronic
1184660109 22:45961718-45961740 GATGGGAAACTGAGGCAGGGAGG - Intronic
1184998443 22:48227322-48227344 GATGGCGCAGTGAAGGAGGCAGG - Intergenic
951258834 3:20482419-20482441 GCTGGCAAAGTGATGTGGGCCGG - Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
951881758 3:27486381-27486403 GCTGGCAAACAGCTGGAGGATGG + Intergenic
952076835 3:29706994-29707016 GATGGCAAATTAATGGAGAGGGG + Intronic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
954498882 3:50990749-50990771 CATGGGAGAATGATGGAGGCTGG + Intronic
955932688 3:64073509-64073531 TTTGGCAAAGTGATGGAGGATGG + Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
964431791 3:156614994-156615016 GCTGGATCACTGATGGAGGCTGG - Intergenic
965505162 3:169507370-169507392 GACGTCAGGCTGATGGAGGCTGG + Intronic
965547728 3:169932983-169933005 GATGCCACACTGATAGAGGGGGG - Intronic
966249937 3:177853550-177853572 GATAGGAGGCTGATGGAGGCAGG + Intergenic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969246716 4:5939341-5939363 GATGGGAAACTAATGGAGAGGGG - Intronic
970101080 4:12523780-12523802 CATGGCCAACTGATGCAGCCAGG + Intergenic
972309673 4:37868369-37868391 ACTGTCAGACTGATGGAGGCAGG + Intergenic
973607019 4:52598014-52598036 GATGGTAAACTGATGGGTCCTGG + Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
979124784 4:116955819-116955841 GGTGGCAAACAAAAGGAGGCTGG - Intergenic
979952827 4:126915873-126915895 GATGGAAAAATAATGGAAGCTGG + Intergenic
981425737 4:144600854-144600876 GTTGACAAACTGATGAAGGCTGG + Intergenic
983666257 4:170188186-170188208 GATGGCAAATTGGTGCAGGTTGG + Intergenic
985059743 4:186065408-186065430 GATTGCATAGTGATGGAGTCAGG - Intergenic
985228608 4:187789729-187789751 GATGGCATGTTGATGGTGGCAGG + Intergenic
985516416 5:347652-347674 GTAGGCAAGGTGATGGAGGCTGG + Intronic
989534950 5:42552447-42552469 GCTAGCAAACTGATGGAGATAGG + Intronic
990509318 5:56476046-56476068 GAGGTCAAACTGGTGCAGGCTGG - Intronic
991230851 5:64331240-64331262 GATGGCAGGTTGATGGTGGCAGG + Intronic
991441863 5:66659102-66659124 GATGGCATGTTGATGGTGGCGGG + Intronic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
995370392 5:111411556-111411578 GATAGGAAATTGCTGGAGGCTGG + Intronic
996144158 5:119953141-119953163 GTTGGCAAGATGAAGGAGGCAGG - Intergenic
996949036 5:129102791-129102813 GAAAGGAAACTGCTGGAGGCAGG - Intronic
998595472 5:143525380-143525402 GACGGCAAACAGATGGTGACTGG - Intergenic
1000712862 5:164602118-164602140 GATAAAAAACTGATAGAGGCTGG + Intergenic
1001052030 5:168421295-168421317 GCTGGGAAAATGGTGGAGGCAGG + Intronic
1003438958 6:6122027-6122049 GATGGCATATTGATGGCAGCAGG + Intergenic
1003885948 6:10521436-10521458 GCTGGGAAACTGGTGGAGGGAGG + Intronic
1005404436 6:25470955-25470977 GATGGCACACTCTTGAAGGCCGG + Intronic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1008209474 6:48703112-48703134 GATGCCAAACTGAAGGTGGGAGG + Intergenic
1009451859 6:63810506-63810528 TATGGCATAGTGATGGAGGGAGG + Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1014227180 6:118861895-118861917 GATGGCATGTTGATGGTGGCAGG - Intronic
1016505007 6:144769449-144769471 TTTGGCAAACAGATGGAGGGAGG - Intronic
1017278220 6:152594685-152594707 GTTGGGAAACTGATGGTAGCTGG - Intronic
1017357440 6:153526081-153526103 GATGGCAGCCAAATGGAGGCTGG + Intergenic
1017662764 6:156690098-156690120 GATGGCAAACTGGAGCAGGTAGG - Intergenic
1018662989 6:166105543-166105565 GATGACAAACTGATGGCCGCTGG + Intergenic
1024222735 7:47301226-47301248 GGTGGCCACCTGGTGGAGGCTGG - Intronic
1025922301 7:65924926-65924948 GATGGAAAACAGCTGGAAGCGGG - Intronic
1026392053 7:69911953-69911975 GATGGCACATTGATGGTGGGAGG - Intronic
1027622915 7:80514174-80514196 GCTGACAAACTGATAGAGGCTGG + Intronic
1028600875 7:92599019-92599041 GATGGGAAACTGCTGGAAGATGG - Intergenic
1029159037 7:98538722-98538744 GACTGCAACCTGATGAAGGCAGG + Intergenic
1029265875 7:99339885-99339907 GATGGCAATCTGATGAGGCCTGG - Intronic
1031467853 7:122135476-122135498 GTTGGAAAACTGGTTGAGGCAGG - Intronic
1032341696 7:131079834-131079856 GACTGCAAACTGAGTGAGGCAGG - Intergenic
1033329313 7:140404927-140404949 GATGGAAACCTCATGGAGGGAGG + Intronic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1036907603 8:12720303-12720325 GATGGCATGTTGATGGTGGCAGG + Intergenic
1039100536 8:33937029-33937051 GATGGCATACTCATGGAGACAGG + Intergenic
1043414587 8:80034010-80034032 GATGGCATGTTGATGGTGGCAGG - Intronic
1043919581 8:85965774-85965796 GATGGGAAACTGATGAAGCTTGG + Intergenic
1045873344 8:106950256-106950278 GATGGCATGTTGATGGTGGCAGG + Intergenic
1046239355 8:111470882-111470904 GATGACATATTGATGGAGGCAGG + Intergenic
1049245961 8:141562653-141562675 CCTGGCACACTGATGGAGCCAGG + Intergenic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1053393065 9:37750166-37750188 TATGGCAAACAGATGGAGTGGGG + Intronic
1053606673 9:39666952-39666974 GATGCCAAACTGCAGGAGGCTGG + Intergenic
1053864592 9:42423579-42423601 GATGCCAAACTGCAGGAGGCTGG + Intergenic
1054246862 9:62675452-62675474 GATGCCAAACTGCAGGAGGCTGG - Intergenic
1054560983 9:66709986-66710008 GATGCCAAACTGCAGGAGGCTGG - Intergenic
1055087024 9:72324504-72324526 GATGAGAAACTGATGTTGGCCGG - Intergenic
1055329373 9:75167580-75167602 GATGGCTAACTGTTGAAGGAAGG - Intergenic
1056544930 9:87605753-87605775 TATGGGAAACTGATTGCGGCAGG + Intronic
1057308959 9:93929615-93929637 GATGTCACACTGATGTAGGGTGG + Intergenic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1058077645 9:100667286-100667308 GATGGCAGGTTGATGGTGGCAGG + Intergenic
1059587063 9:115618344-115618366 GATGGCTAGCTTATGGAGGATGG + Intergenic
1060312733 9:122477330-122477352 GATTGCTAACTGATTGAGGGAGG + Exonic
1061253544 9:129440423-129440445 GCTTGCAAACCGATGGAGGTTGG - Intergenic
1061411095 9:130422170-130422192 GCTGGCACACTGAAGGAGCCAGG - Intronic
1187809999 X:23165443-23165465 AATGGCCAACTGATGAAGGCAGG + Intergenic
1188647844 X:32592111-32592133 GATGGCATGTTGATGGTGGCAGG + Intronic
1188988907 X:36792906-36792928 AATGGCTAACTGAAGGAGGTAGG + Intergenic
1189277042 X:39794295-39794317 GAAGGCACACAGATGGAGGTGGG + Intergenic
1189632464 X:42969583-42969605 TATAGGAAACTGATGAAGGCTGG + Intergenic
1196470385 X:116017492-116017514 GGTGGCAAAATGTTGGAGTCTGG + Intergenic
1197201386 X:123751844-123751866 GAAGTCAAAGTGATGTAGGCTGG + Intergenic
1199612785 X:149631920-149631942 GATGGCAGGGGGATGGAGGCTGG + Intergenic