ID: 919896991

View in Genome Browser
Species Human (GRCh38)
Location 1:202015182-202015204
Sequence GTGAAGAGAAGGATGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 381}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919896991_919897000 12 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919897000 1:202015217-202015239 ACAAACGGGAGATCCTGGAACGG 0: 1
1: 0
2: 0
3: 12
4: 121
919896991_919897002 16 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919897002 1:202015221-202015243 ACGGGAGATCCTGGAACGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 67
919896991_919897003 20 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919897003 1:202015225-202015247 GAGATCCTGGAACGGGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 165
919896991_919896999 7 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919896999 1:202015212-202015234 CTACTACAAACGGGAGATCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
919896991_919896995 -3 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919896995 1:202015202-202015224 CACCCAGGTACTACTACAAACGG 0: 1
1: 0
2: 0
3: 6
4: 104
919896991_919897001 13 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919897001 1:202015218-202015240 CAAACGGGAGATCCTGGAACGGG 0: 1
1: 0
2: 0
3: 7
4: 107
919896991_919896996 -2 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919896996 1:202015203-202015225 ACCCAGGTACTACTACAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 62
919896991_919897004 24 Left 919896991 1:202015182-202015204 CCTCTGACCATCCTTCTCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 381
Right 919897004 1:202015229-202015251 TCCTGGAACGGGTGGATGGCCGG 0: 1
1: 0
2: 3
3: 65
4: 1383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919896991 Original CRISPR GTGAAGAGAAGGATGGTCAG AGG (reversed) Intronic
900422229 1:2560599-2560621 GAGAAGAGAGGGACGGACAGAGG - Intronic
900886351 1:5418208-5418230 GTGCAGAGAAGGGTTCTCAGAGG + Intergenic
902688839 1:18096960-18096982 GTAAAGAGATGGATGCTGAGGGG - Intergenic
903861138 1:26365089-26365111 GAGAGGAGAAGGCTGGGCAGGGG + Exonic
904943007 1:34177847-34177869 GAGAGGAGGAGGATGGCCAGCGG + Exonic
905365011 1:37446159-37446181 GTAAAGAGAAGGAGAGGCAGAGG - Intergenic
906975161 1:50562057-50562079 GGCAAGAGAAGGATGGGGAGAGG + Intronic
907387499 1:54135714-54135736 GAGAAGAGAAGGAGGGTAGGGGG - Intronic
907979919 1:59471487-59471509 GGGAAGAGAAGGATAATAAGAGG - Intronic
908578247 1:65484854-65484876 TTGAAGAAAAGGATGGTTAAAGG + Intronic
909163179 1:72181058-72181080 ATGAAGAGGAGGAAGGACAGTGG + Intronic
910192029 1:84604550-84604572 GTGGAGAGAGGGATGTTCATTGG - Intergenic
910662735 1:89690792-89690814 GTGCTGAGAAGGCTGGTCAGCGG - Intronic
913294188 1:117303040-117303062 GTGAAGACTAGAATAGTCAGAGG + Intergenic
913575270 1:120166642-120166664 GAGAAGGGGAGGATGGGCAGAGG + Intronic
914557576 1:148782282-148782304 GAGAAGGGGAGGATGGGCAGAGG + Intergenic
914615258 1:149347948-149347970 GAGAAGGGGAGGATGGGCAGAGG - Intergenic
915569651 1:156737617-156737639 GTGAGGGGCAGGAAGGTCAGGGG - Intronic
916459393 1:165007636-165007658 GTGAGGAGAAGTATGATGAGAGG - Intergenic
916559365 1:165919991-165920013 GTGAGAAGAAGGCAGGTCAGTGG - Intergenic
919896991 1:202015182-202015204 GTGAAGAGAAGGATGGTCAGAGG - Intronic
919923369 1:202179132-202179154 GGGAAGAGCAGGGTGGGCAGTGG - Intergenic
919960489 1:202462777-202462799 GTTTAGAGAAGGACAGTCAGAGG + Intronic
920033201 1:203049460-203049482 GTGAGTGGAAGGATGGGCAGGGG - Intronic
920300046 1:204983008-204983030 GTGAGGAGTGGGATGGACAGAGG - Intronic
921460846 1:215424905-215424927 GTAAAGAAAAGCAGGGTCAGGGG - Intergenic
922438224 1:225627607-225627629 CTGAATAGAAGGAGGGTCAGGGG - Intronic
922724649 1:227917299-227917321 GTGCAGGGCAGGGTGGTCAGGGG - Intergenic
923821470 1:237447932-237447954 GTGAAGAGCAGAATGGGGAGAGG - Intronic
924063175 1:240197298-240197320 ATGAAGAGATGGATGGGGAGAGG - Intronic
1063118786 10:3089840-3089862 GTGTAAAGAAGGATGGTTAATGG - Intronic
1064563330 10:16614333-16614355 GAGAGGAGAAGGATGGTGACCGG + Intronic
1066299179 10:34081800-34081822 CTGAAGTGAAGGCTGGTCAAAGG + Intergenic
1066415821 10:35220603-35220625 GTGAAGAGCAGAATGAACAGTGG + Intergenic
1067803801 10:49379709-49379731 ATGAGGGGAAGGATGTTCAGGGG - Intronic
1068597108 10:58914532-58914554 TGGTAGGGAAGGATGGTCAGGGG - Intergenic
1070114644 10:73516799-73516821 GGCAAGAGAAGAATGTTCAGTGG + Exonic
1070554098 10:77514826-77514848 GTGAAGAGGCAGAAGGTCAGAGG - Intronic
1071964217 10:90835745-90835767 GAGTAGAGAAGGAAGCTCAGGGG + Intronic
1072306870 10:94116107-94116129 TTGAAGAAAAGGATGGAGAGAGG - Intronic
1073068721 10:100780066-100780088 GAGAAGAGAGGGAAGGGCAGAGG - Intronic
1073431928 10:103492812-103492834 GTGAAGACATGGGTGGGCAGGGG - Intergenic
1073472554 10:103731858-103731880 GTGCAGAGGGGGAGGGTCAGGGG + Intronic
1073485535 10:103815968-103815990 GAGAAGAGAAGGGTGGTGACAGG + Intronic
1073633522 10:105173771-105173793 AAGAACAGAAAGATGGTCAGTGG - Intronic
1074162409 10:110845598-110845620 GGGAAGGGAAGGATGGGTAGGGG - Intergenic
1075247257 10:120833772-120833794 GGGAGGAGCAGGATGTTCAGGGG + Intergenic
1075431399 10:122385119-122385141 GTGAAGGGAAGGACTGTAAGTGG - Intronic
1075638036 10:124043679-124043701 GAGCAGAGAGGGATGGGCAGTGG + Intronic
1075798692 10:125138838-125138860 GTGAAGAGACGGACGGGCACAGG - Intronic
1076378525 10:130009371-130009393 GGGTAGAGCAGCATGGTCAGGGG + Intergenic
1078514497 11:12010020-12010042 GTGAAGGCAGGGATGGCCAGAGG + Intergenic
1080244488 11:30164066-30164088 GTGAAGGGCAGGATGGTTTGGGG + Intergenic
1080443422 11:32315680-32315702 GTGAATAGCAGGAGGGACAGGGG - Intergenic
1081371613 11:42311355-42311377 GTGAAGAGAAAGAAAGTGAGAGG - Intergenic
1081527906 11:43939519-43939541 GAGAAGAGAAGGGTGGGGAGGGG - Intronic
1081957365 11:47105074-47105096 GTGTAGTGAAGGATGGTTTGAGG + Intronic
1085257058 11:75181038-75181060 GGGAAAAGAAGCATGGCCAGTGG + Intronic
1085817580 11:79756569-79756591 GGGAAGAAAAGGATTTTCAGAGG - Intergenic
1087367998 11:97246368-97246390 GTAAAGAAAATGATGGTCAGAGG - Intergenic
1088984403 11:114892812-114892834 CTCAAGAGAAGGATGGAGAGTGG - Intergenic
1089197536 11:116703457-116703479 GTGAGGAGAAGCAGGCTCAGAGG + Intergenic
1089392560 11:118111974-118111996 GTGAAGAGAAGGACGGTGCCAGG - Intronic
1090028134 11:123185087-123185109 GTGAAGAGGTGGCTGGTCACAGG + Intronic
1091196201 11:133732785-133732807 GTGAAGACAAGGAGGGACAAGGG + Intergenic
1091305639 11:134534374-134534396 GTGAAGAGGAGATTGGTTAGAGG + Intergenic
1092403026 12:8193920-8193942 GAGAAGACATGGATTGTCAGTGG - Intergenic
1092915542 12:13186010-13186032 GTGCACAGAAGGATGGACACAGG + Intergenic
1093561033 12:20540197-20540219 TGAAAGAGAAAGATGGTCAGTGG - Intronic
1094165409 12:27437969-27437991 GTGAAGAGGAGGGTGGTCACTGG - Intergenic
1094479023 12:30865680-30865702 ATGAAGAAAAAGAGGGTCAGTGG + Intergenic
1095265952 12:40157963-40157985 GTGAGGAGAAGGAAGGTTAGTGG - Intergenic
1095508238 12:42921286-42921308 GTGAAGAGAAGGAGAGTCTGAGG + Intergenic
1097865179 12:64554137-64554159 GAGAAGAGAAAGATAGTCATAGG - Intergenic
1097911563 12:64975497-64975519 GGCAAGAGAAGGATAGACAGAGG + Intergenic
1098145150 12:67490094-67490116 GTGAGGAGAAGTAGGATCAGGGG - Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1099322378 12:81166574-81166596 GTGACGAGAAGGTTTTTCAGAGG + Intronic
1099444282 12:82733698-82733720 GTGAAGAGAAGTAAGGTACGTGG + Intronic
1099767810 12:87011900-87011922 GTGAAGAGAAGAAAGGCCTGAGG - Intergenic
1100794201 12:98163326-98163348 GTAAAGATAAGGAAGGTCATGGG - Intergenic
1101420061 12:104543549-104543571 GGGACGAGAAGGATGGGAAGGGG - Intronic
1101751353 12:107585161-107585183 GTTAAAATAAAGATGGTCAGGGG + Intronic
1101837819 12:108307417-108307439 GAGAAGAGAAGCAAGGGCAGAGG - Intronic
1102926173 12:116828131-116828153 GTGAAGGAAAAGATGGTCACTGG - Intronic
1103499343 12:121388824-121388846 GGGAAGAGACGGATTGGCAGAGG + Intronic
1103645140 12:122385839-122385861 GTGAAGAGCAGTATCTTCAGAGG + Intronic
1104119028 12:125780241-125780263 ATGAAGAAAAGGATGCTTAGAGG - Intergenic
1104540128 12:129656283-129656305 GGGAAGAGAAGGAAGGAGAGAGG + Intronic
1105335648 13:19465457-19465479 CTGATGAGAAGGCTGGTAAGTGG - Exonic
1105523409 13:21152387-21152409 GTGAAGGGAGGGATGGCCTGTGG - Intergenic
1106582224 13:31028164-31028186 GTTTAGGAAAGGATGGTCAGAGG - Intergenic
1106873024 13:34042404-34042426 GAGAAGAGAAATATGATCAGTGG - Intergenic
1108474004 13:50795434-50795456 ATGAAGAGAACCAAGGTCAGGGG - Intronic
1108586793 13:51876876-51876898 CTGGAGAGCAGGATGGTGAGAGG + Intergenic
1110837827 13:80105335-80105357 ATGGAGAGAATGATGGTCAAAGG - Intergenic
1110880678 13:80568519-80568541 GTGAATCGAAGGATGGGAAGAGG + Intergenic
1111510224 13:89251384-89251406 GTGAAGATAGAGATGCTCAGTGG - Intergenic
1113373188 13:109741038-109741060 GTGCAGAGAAGGCTGGTGGGAGG + Intergenic
1114051268 14:18921102-18921124 GGGAAAAGAAGAATGGTCACTGG - Intergenic
1114111294 14:19480823-19480845 GGGAAAAGAAGAATGGTCACTGG + Intergenic
1114876010 14:26718956-26718978 GTGAAGATAATCATGGTGAGTGG - Intergenic
1115226964 14:31113003-31113025 GGGAAGGGAAAGATGGTGAGAGG + Intronic
1115906920 14:38210850-38210872 GAAAATAGAAGGAGGGTCAGAGG - Exonic
1116342541 14:43743258-43743280 GAGAAGAGAAGGAGGGGGAGAGG - Intergenic
1116629132 14:47306700-47306722 GTGGAGAGAAGGATGTTCACTGG + Intronic
1118188795 14:63561305-63561327 TTGAAGAAAAGGAAGGTAAGTGG + Intergenic
1119270506 14:73299934-73299956 ATGAAGAGATGGAAGCTCAGTGG - Intronic
1119344439 14:73910886-73910908 GTGAAGATAAGGAGGGAAAGGGG + Intronic
1119643972 14:76335272-76335294 ATGAACAGAGGGTTGGTCAGAGG - Intronic
1119672463 14:76530042-76530064 GTGAAGAGGAGGAAGGACGGGGG - Intergenic
1119969969 14:78959159-78959181 GTGTAGAGAAGGATAGCCTGTGG + Intronic
1121620563 14:95345023-95345045 GAGAAGAGAATGATGGGGAGAGG + Intergenic
1122374541 14:101249184-101249206 GGACAGAGATGGATGGTCAGTGG - Intergenic
1122403079 14:101478979-101479001 GTGAAGAGCAGGTTGTCCAGAGG - Intergenic
1122534886 14:102455192-102455214 GTGAACAGAGGGATGGCCTGGGG + Intronic
1122796045 14:104206783-104206805 GTGAAGGGAAGCAGGGTGAGGGG + Intergenic
1124691150 15:31824282-31824304 GTGAAGTGATGGAGGGTCGGGGG - Intronic
1125124617 15:36205660-36205682 GTGAAGGAAAGGGTGATCAGTGG + Intergenic
1125756958 15:42070889-42070911 GGGAATCGCAGGATGGTCAGAGG + Intronic
1128171261 15:65515737-65515759 GAGAAGAGCAGGATGAGCAGAGG - Exonic
1128502031 15:68233328-68233350 GTGAAGAGAAGCAGGGTCCCAGG + Intronic
1128749627 15:70139794-70139816 TTGTAGACAAGGAAGGTCAGTGG + Intergenic
1129866082 15:78909863-78909885 ATGAAGAGAAGGGTGATCAAGGG - Intergenic
1130836059 15:87651271-87651293 GACAAGAGCAGGATGGTCTGGGG + Intergenic
1131938495 15:97534399-97534421 GTGAAGATAATGAAGGGCAGAGG + Intergenic
1132374605 15:101320707-101320729 CTGAAGAGATGGAGGGCCAGAGG + Intronic
1132465283 16:74617-74639 GTCATCAGAAGGATGATCAGAGG + Intronic
1132559595 16:587358-587380 GTGAAGGGAGGGATGGACAGAGG - Intergenic
1132720571 16:1313715-1313737 GTGAGGAGACAGATGTTCAGAGG - Intronic
1134451669 16:14367734-14367756 GGGAAGGGAAGGAAAGTCAGGGG - Intergenic
1134816285 16:17208315-17208337 GAGAAGTGCAGGATGTTCAGAGG - Intronic
1135917028 16:26614474-26614496 GTGCAGAGAGGCAAGGTCAGTGG - Intergenic
1136482031 16:30548060-30548082 ATGGAGAGATGGATGGTCAAGGG + Intronic
1136674228 16:31885633-31885655 GTGAGGAGAGTGATGGACAGTGG + Intronic
1137002990 16:35247460-35247482 TTGGAAAGAAGGCTGGTCAGTGG + Intergenic
1137026355 16:35479368-35479390 TTGGAAAGAAGGCTGGTCAGTGG + Intergenic
1137346079 16:47661278-47661300 GTGAAGAGATGGATGATAGGAGG - Intronic
1139324113 16:66138706-66138728 GTCAAAAGAAGAATGATCAGTGG + Intergenic
1141427992 16:83956015-83956037 GTGAGGAGAAGGAGGCTCCGAGG - Intronic
1141482452 16:84315631-84315653 GTGCACTGTAGGATGGTCAGCGG + Intronic
1142886082 17:2912758-2912780 GTCAAGAGAACAATGGGCAGTGG - Intronic
1143186531 17:5013624-5013646 GGGGAGAGAAAGGTGGTCAGGGG - Intronic
1143597092 17:7921720-7921742 GTAAAGTGAAGAATGGTCTGAGG - Intergenic
1143779878 17:9223840-9223862 GTGCAGGGAAGGATGGGGAGAGG - Intronic
1144392852 17:14812265-14812287 TTGAAGAAAAGAAGGGTCAGGGG - Intergenic
1145956173 17:28856402-28856424 GTAAAGGGTAGGATGGTCAAGGG - Intronic
1147169822 17:38611436-38611458 GTGAAGAGATGGAGGGTGAGGGG + Intergenic
1149060935 17:52420960-52420982 GTGAAGACCAGAATGGTTAGAGG + Intergenic
1150683723 17:67303613-67303635 GTGAAAAGAAGGATGATGAGGGG + Intergenic
1151180150 17:72321382-72321404 GTCAAGATAAGGAAGATCAGAGG + Intergenic
1152013718 17:77735983-77736005 GGGAGGAGAAGGATGGGAAGAGG + Intergenic
1152055181 17:78019081-78019103 GTGAAAGGAAGGAAGGTCGGGGG + Intronic
1152679271 17:81657289-81657311 GGTAAGAGAAGGGTGGTCAGAGG - Intronic
1155247928 18:23927872-23927894 GTTAACAGAAGAATGGCCAGTGG - Intronic
1156261205 18:35446320-35446342 AAGAAGAGAAGAATGGGCAGTGG + Intronic
1156941387 18:42770817-42770839 AAGAAGAGAAGGATGGAGAGAGG + Intronic
1158509135 18:58074975-58074997 GTGAAGAGTTGGATGGACAGTGG + Intronic
1160509955 18:79447858-79447880 GTGCAGAGAAGGAGGGTGAGAGG + Intronic
1160778760 19:868639-868661 GGGAGGAGAAGCATGGGCAGAGG - Intronic
1160783053 19:886363-886385 ATGAGGAGACGGAGGGTCAGAGG - Intronic
1161773056 19:6241746-6241768 GGGAACAGAAGGATGCTCTGGGG + Intronic
1162534349 19:11254055-11254077 GGGAACAGCAGGATGGACAGAGG - Intronic
1162558479 19:11402207-11402229 GAGAAGAGGAGGAAGGTGAGTGG - Exonic
1162559016 19:11405239-11405261 GACAGGAGAAGGGTGGTCAGGGG + Intronic
1163034959 19:14564867-14564889 GGGGAGGGAAGGATGGTCTGAGG - Intronic
1163308377 19:16496647-16496669 GAGAAGAGCAGGATGGTCTCAGG + Intronic
1164249791 19:23466663-23466685 GAGAAGAGAAGGAGGAGCAGTGG - Intergenic
1164535769 19:29085414-29085436 GAGGAGAGAAGGACAGTCAGAGG + Intergenic
1164793679 19:31009055-31009077 GTGAATTGTAGTATGGTCAGTGG - Intergenic
1164804741 19:31108127-31108149 GTCAAGAGAGGGCTGGTTAGGGG + Intergenic
1165648386 19:37464998-37465020 GAGAAGAGAAGAAAGGTAAGTGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166990842 19:46691815-46691837 GTGAAGACAGGGCAGGTCAGGGG + Intronic
1167412585 19:49353730-49353752 TGGAAGAGAAGGAAGGTCACTGG - Intronic
925345806 2:3171121-3171143 GTGGCAAGAAGGATGGTGAGGGG - Intergenic
925445213 2:3921251-3921273 GTGAGGAGAGGGAAGGACAGAGG - Intergenic
925722239 2:6840639-6840661 GTGGAGAGAAGGATGGTATAAGG + Intronic
926422674 2:12715529-12715551 GTGGGGAGTAGGATGGTGAGAGG + Intergenic
926972518 2:18481072-18481094 GTGAAGAGAGAGAGGGACAGAGG - Intergenic
927961063 2:27241020-27241042 GGGCAGAAAAGGCTGGTCAGAGG - Intronic
928043850 2:27907216-27907238 GTCAAGAGAAGCAAGGTCAGTGG - Intronic
928263937 2:29793678-29793700 GTGATGAGGAGCATGGTCAATGG + Intronic
928436405 2:31257319-31257341 GGGAAGGGAAGGATGGACAGAGG + Intronic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930305171 2:49667246-49667268 GTAAGGAAAAGTATGGTCAGGGG + Intergenic
930944395 2:57055204-57055226 GAGAATAGGAGGATGGTCACAGG - Intergenic
931895625 2:66726612-66726634 GGGGAGAGAAAGATGGTGAGTGG - Intergenic
933310136 2:80650723-80650745 GTGAAGACAAGTGTAGTCAGAGG + Intergenic
933321258 2:80778272-80778294 GAGAAGGGGAGGATGGCCAGAGG - Intergenic
933648658 2:84831765-84831787 GTGAAGGGAAGGTTGCCCAGGGG - Intronic
935098578 2:99970666-99970688 GGGAGGAGAAGGAGGGTTAGAGG - Intronic
935138638 2:100331558-100331580 TGGAAGAGAGGGATGTTCAGTGG + Intergenic
935914506 2:107934996-107935018 AAGGAGAGAAGGAAGGTCAGTGG + Intergenic
936018697 2:108978665-108978687 GTGCAGTGAAGTTTGGTCAGAGG + Intronic
936491468 2:112976382-112976404 GTCAAGAAGAGGATGCTCAGAGG - Intronic
938927308 2:136055756-136055778 GGGGAGGGAAGGATGGCCAGAGG + Intergenic
939705215 2:145444347-145444369 GTGAAGTATAGGATGCTCAGAGG - Intergenic
939733913 2:145819520-145819542 GTGAAGGGAAGGAGGGAGAGAGG - Intergenic
940730413 2:157383276-157383298 GTCAAGAGAAGAGTGATCAGAGG + Intergenic
942181933 2:173388479-173388501 GTGAACTGAAGGAAGGTCAGAGG + Intergenic
943953744 2:194160754-194160776 ATGAAGACTAGTATGGTCAGGGG - Intergenic
944687213 2:202128108-202128130 GGGAAGGGAAGGAGGGTGAGGGG - Intronic
946255456 2:218438559-218438581 ATGAAAAGAAGGCTGGTCTGGGG - Intronic
947344704 2:229178876-229178898 GTCAAGAGAAGGAAGGACGGAGG + Intronic
947828901 2:233125226-233125248 GAGGAGAGAAGGAAGGACAGAGG + Intronic
948459515 2:238122438-238122460 GTGAAGAAATGGAGGCTCAGGGG + Intronic
948459996 2:238124405-238124427 GTGAGGAGAGGGAAGGGCAGTGG - Intronic
1168875893 20:1171929-1171951 GTGAAGAGAGGGATGGCCCAGGG + Intronic
1168973171 20:1944914-1944936 GTGATGAGAAGGAGGATGAGAGG + Intergenic
1169112680 20:3044017-3044039 GAGGATAGATGGATGGTCAGGGG - Intronic
1169453973 20:5736046-5736068 GGGAAGAGAAGGAAGGGGAGAGG + Intergenic
1169541960 20:6609400-6609422 GAGACTAGAAGGATGGTCACCGG + Intergenic
1169763509 20:9123153-9123175 GTGAGGAGAAGGATGGAAATTGG + Intronic
1169808809 20:9587717-9587739 GTGATGAGGATGATGGTCGGAGG + Intronic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1170522272 20:17198889-17198911 GTGAAGACTAGGATGGTAACAGG + Intergenic
1170527772 20:17258222-17258244 ATGAAGAAGAGGATGGTCATAGG + Intronic
1172499926 20:35418467-35418489 GTGAAGAGAAAGATGGGCAGAGG - Intergenic
1172816928 20:37694411-37694433 GTGAAAAAAAGGATAGTCTGGGG - Intronic
1175781110 20:61682545-61682567 GTGGAGGGATGGATGGACAGAGG + Intronic
1175815303 20:61880490-61880512 GAGAAGAGAGGGAAGGACAGCGG + Intronic
1177220945 21:18192106-18192128 GTGTTGAGAAGGAGGGACAGGGG - Intronic
1177393777 21:20507991-20508013 GTGAGGAGCAGCAAGGTCAGGGG + Intergenic
1179213548 21:39348479-39348501 GAGAAGAGAAGGCAGGCCAGCGG + Intronic
1179432279 21:41330617-41330639 GCAAAGAGCAGGATGGTGAGAGG - Intronic
1179983826 21:44910434-44910456 GAGTAGAGCAGGAAGGTCAGAGG + Intronic
1180469743 22:15643477-15643499 GGGAAAAGAAGAATGGTCACTGG - Intergenic
1181710213 22:24679764-24679786 GTGGGGAGAAGGGTGGTGAGCGG + Intergenic
1181814844 22:25430111-25430133 GTGAAGAAAATGAGGGGCAGGGG + Intergenic
1181860308 22:25812995-25813017 GGGAAGAGAAGGATGAAGAGAGG - Intronic
1182043464 22:27256471-27256493 GTGGAGAGATGGAGGCTCAGAGG - Intergenic
1183985687 22:41568988-41569010 GGGAAGAGGAGGATGGAGAGGGG - Intronic
1184163475 22:42713450-42713472 GGGAAGAGAAGGATTGTCTTTGG + Intronic
1184173418 22:42772602-42772624 GAGAAGAGAAGGAAGGGGAGAGG - Intergenic
1184881698 22:47309106-47309128 GTTAAGACAAGGCTGGCCAGGGG - Intergenic
950474230 3:13205631-13205653 GTGAAGAGATGGATGGATGGAGG - Intergenic
950934710 3:16826492-16826514 GTAAAGATAAGGATGATCAAAGG + Intronic
951802465 3:26611614-26611636 GTGAAGAAGATGATGGTCATTGG + Intergenic
952196058 3:31076262-31076284 GTGAAAAGCAGGATGGTGGGTGG + Intergenic
953607004 3:44418847-44418869 ATGAGGAGATGGAGGGTCAGAGG - Intergenic
956097720 3:65734867-65734889 GTGAAGAGATGGGAGGTGAGGGG + Intronic
956382695 3:68682745-68682767 GAGAAGAGATGGATGCACAGAGG - Intergenic
957019502 3:75109238-75109260 GTGAAGAGAAGGATGCCAACTGG + Intergenic
958436339 3:94100472-94100494 GTGAAGGGAAGGATGGGGAAAGG + Intronic
958881431 3:99675633-99675655 ATGAAGAGGATGATGTTCAGTGG - Intronic
959062602 3:101629449-101629471 GTAAAGAGGAGGAAGGACAGGGG + Intergenic
959636498 3:108578330-108578352 ATGAAGAGAAGGCAGGTCATGGG + Intronic
959994905 3:112669867-112669889 AAAAAGAGAAGGATGGTCAATGG - Intergenic
960417697 3:117405434-117405456 CTGAAAGGAAGGATTGTCAGAGG + Intergenic
960833481 3:121878541-121878563 GTGAAGACAAGGATAAACAGAGG - Intronic
960913254 3:122670320-122670342 CTGAACGGAAGGCTGGTCAGTGG - Intergenic
961140250 3:124550027-124550049 GTTATGAGAAGAATGGACAGTGG + Intronic
962321279 3:134392663-134392685 GTGTGGAGAAGGAGGATCAGTGG + Intergenic
962442878 3:135439133-135439155 TTAAAGAAAAGAATGGTCAGGGG + Intergenic
962500496 3:135986351-135986373 CTGAAGTGAAAGAGGGTCAGAGG - Intronic
962935957 3:140080989-140081011 GTGGAGTGAAGGATATTCAGAGG - Intronic
963060575 3:141221632-141221654 ATGAGGAGAATGATGCTCAGAGG - Intergenic
963766004 3:149336511-149336533 ATGAAGAGAGGGATGGGCAAAGG + Intergenic
964211580 3:154234239-154234261 GTGAAAGGAAGGATGGTGATGGG - Intronic
964466662 3:157000144-157000166 GTGAAGAGAAGAATACTGAGGGG - Intronic
964942591 3:162177505-162177527 CAGATGAGAAGGATGGTCAAGGG + Intergenic
966239918 3:177744708-177744730 GTGAAGAGAGGGCTGGTATGAGG + Intergenic
966451731 3:180071005-180071027 GTGAAGAAAAGGGTGGAAAGCGG - Intergenic
967104986 3:186248455-186248477 GAGCAGAGAAGAATGGTCAAAGG - Intronic
967494775 3:190130378-190130400 GTTAAGAGAATGATGATCACTGG - Intergenic
967690365 3:192466727-192466749 GACAAGAGAAAGAAGGTCAGGGG + Intronic
968982463 4:3857669-3857691 GTGAAGAGTAGGAGGGACATGGG - Intergenic
969762995 4:9203750-9203772 GAGAAGACATGGATTGTCAGTGG + Intergenic
969923238 4:10560306-10560328 ATAAATAGAAGGATGGGCAGTGG + Intronic
970030228 4:11665922-11665944 GTGAAGAGGAGAATGGTAAGAGG + Intergenic
971302705 4:25455167-25455189 GTGTAGAGAGGGATGGAGAGAGG + Intergenic
971737628 4:30476418-30476440 ATGAAGAAAATAATGGTCAGAGG - Intergenic
972131263 4:35836845-35836867 CTGAAGAAAATGATTGTCAGGGG + Intergenic
973107290 4:46356100-46356122 GTGAAGATTAACATGGTCAGGGG - Intronic
974932278 4:68372999-68373021 GGAAAGAGAAGGAAGGTGAGAGG - Intergenic
975464913 4:74698284-74698306 AGGAAGAGAAGGATGGGCATAGG + Intergenic
977842163 4:101721065-101721087 GTAAAGAGAAGTTTGGTGAGAGG + Intronic
978717358 4:111861926-111861948 CTGAAGGGAAGCATGTTCAGAGG - Intergenic
979127828 4:116998608-116998630 GTGAAGACAAGGTGGGTGAGTGG - Intergenic
979548124 4:121960274-121960296 GTGAAGGGAAGGTTGGTGGGAGG + Intergenic
979717181 4:123853975-123853997 CTGATGAGAAGGATCGCCAGTGG - Intergenic
982228850 4:153189896-153189918 GTGTAGAGAATGATGGTATGAGG + Intronic
983423615 4:167553366-167553388 GTGAAGAGAAGAGGGATCAGAGG - Intergenic
985375637 4:189334592-189334614 GTGAAGAGAAGGATGGGGAGAGG - Intergenic
987431413 5:17838638-17838660 GTCAACAGAAGCAAGGTCAGAGG + Intergenic
987502256 5:18728275-18728297 GTGAAGGGAAGAAAGGACAGTGG + Intergenic
990731285 5:58811843-58811865 GAGGAGTGAAGGCTGGTCAGGGG - Intronic
992683097 5:79172462-79172484 GTGAAGAGAAATCTGGCCAGTGG - Intronic
994077062 5:95665345-95665367 GAAAAGGGAAGGATGGTGAGAGG - Intronic
994089215 5:95794038-95794060 GGGAAGAGAAGGAGGCTCACCGG + Exonic
994130375 5:96220139-96220161 GTGAGGAGAAGTTTGCTCAGAGG + Intergenic
995882846 5:116862157-116862179 GTGAAGAGCACGGTGTTCAGGGG - Intergenic
996112848 5:119585334-119585356 GAGAAGAAAAGAATAGTCAGTGG + Intronic
999232079 5:150067625-150067647 ATGAAGAGGATGATGGTCACAGG + Intronic
999234992 5:150085325-150085347 GGCCAGAGAAGGATGGTCAGTGG + Intronic
999370612 5:151052816-151052838 GTGAACAAGAGGATGGTTAGGGG - Intronic
999429990 5:151517648-151517670 GTGAATAGAAGAATGGCCTGTGG + Exonic
999641396 5:153676884-153676906 GTGATGAGAAGGGTGTGCAGTGG - Intronic
1000868838 5:166549729-166549751 GTGAAGAAGAGGAGGCTCAGAGG + Intergenic
1001656575 5:173355338-173355360 GGGTAGAGAGGGATGGTCAGAGG + Intergenic
1002450754 5:179317185-179317207 CTGAGGAAAAGGATGCTCAGAGG - Intronic
1002601504 5:180356453-180356475 GTGGAGAGCAGGATGGGCAGTGG - Intergenic
1003107612 6:3227944-3227966 GTGAAGAAAAGGAGGGTGAGAGG + Intronic
1003440562 6:6137458-6137480 GTGGAGATAAGGATGGTGAAAGG + Intergenic
1003766132 6:9238978-9239000 GGGAAGAGAAGGGTTGTCATTGG + Intergenic
1004124780 6:12862549-12862571 GACAAGAGAAGAATGATCAGTGG + Intronic
1004792312 6:19040385-19040407 GTGAAGAGAAGAATGGAGAAGGG + Intergenic
1007298636 6:40848738-40848760 GTGAAGAGGTGGAGGGTGAGAGG - Intergenic
1007820288 6:44555847-44555869 GTGGAGTGAGGGATGCTCAGGGG + Intergenic
1008923128 6:56863572-56863594 GTGAAGGGGAGGAAGGTCAGGGG - Intronic
1009266938 6:61567710-61567732 GGGAAGAGAAGGAGGGAGAGAGG - Intergenic
1009453209 6:63825371-63825393 GTGTGGAGAGGGATGGGCAGTGG - Intronic
1009472833 6:64049306-64049328 GTGAAGAGATGGATGAATAGAGG - Intronic
1010634030 6:78234476-78234498 CTGAATAGAAGGATGGGAAGTGG - Intergenic
1012612640 6:101234663-101234685 GGGAAGAGAAAGATGGTAAAGGG + Intergenic
1012645557 6:101675157-101675179 GGGAAGAGAGGGATGGAGAGGGG - Intronic
1014338717 6:120174780-120174802 GGGTAGAGAAGCATGGTGAGTGG + Intergenic
1014662440 6:124189959-124189981 GTGAAAACAATGAAGGTCAGAGG + Intronic
1014787735 6:125637710-125637732 CTGTGGAGATGGATGGTCAGGGG - Intergenic
1015471270 6:133609556-133609578 TTGAAGAGAAGGAAGATCAATGG + Intergenic
1018383285 6:163280262-163280284 GTGCAGAGCAGGACGTTCAGAGG - Intronic
1018383429 6:163281216-163281238 GTGCAGAGCAGGACGTTCAGAGG + Intronic
1018973603 6:168546603-168546625 GTGGAGAGAGGGAGGGCCAGAGG + Intronic
1021752094 7:23811984-23812006 ATGATGAGAAGGATAGTCTGTGG + Intronic
1023314403 7:38920478-38920500 GTGAAAAGAAGGATGGGGAAAGG + Intronic
1024204037 7:47138747-47138769 CAGAACAGAAGGATGGTTAGCGG - Intergenic
1024213693 7:47228677-47228699 GAGCAGGGAAGGATGGTCTGAGG - Intergenic
1029434718 7:100556556-100556578 GAGAAGAGAAGGGTGGGTAGAGG - Intronic
1029897513 7:104000077-104000099 GGGAGGAGAAGGATGGAGAGTGG - Intergenic
1029941400 7:104484357-104484379 GTGAAGGGAAGGAGGGAAAGGGG - Intronic
1031359531 7:120831646-120831668 GTGAAGAGGAGGAGGGTGAAAGG + Intronic
1031745480 7:125491241-125491263 GACAAGAGAAGGGTGGTAAGGGG + Intergenic
1032443711 7:131962130-131962152 GTGGAGGGACGGATGCTCAGTGG - Intergenic
1033821194 7:145135916-145135938 GAGAATAGAAGGATGGTTACCGG - Intergenic
1033928058 7:146488538-146488560 ATGAAGAGAAGGAAGGTAGGAGG - Intronic
1034296141 7:149973913-149973935 GGGAGGAGGAGGATGGGCAGAGG + Intergenic
1034809891 7:154122896-154122918 GGGAGGAGGAGGATGGGCAGAGG - Intronic
1035569517 8:662857-662879 GGGAAGAGAAGGGAGGGCAGGGG + Intronic
1035673644 8:1439277-1439299 GGGAAGGGAAGGAGGGACAGAGG + Intergenic
1036273139 8:7325676-7325698 GAGAAGACATGGATTGTCAGTGG + Intergenic
1036348209 8:7984672-7984694 GAGAAGACATGGATTGTCAGTGG - Intergenic
1036519640 8:9479239-9479261 GTGAGGAGAAGGAGGGTCTGAGG - Intergenic
1036843489 8:12145140-12145162 GAGAAGACATGGATTGTCAGTGG - Intergenic
1036864860 8:12387459-12387481 GAGAAGACATGGATTGTCAGTGG - Intergenic
1037490117 8:19389951-19389973 GTGCAGAGAGGGCAGGTCAGAGG + Intronic
1037675933 8:21050751-21050773 GGGAAGAGGAGGATGGGCAGAGG - Intergenic
1038278600 8:26142517-26142539 GAGTAGAGAAGGATGGAGAGTGG + Intergenic
1038849131 8:31257136-31257158 GTGGAGAGAAGAATGTGCAGTGG + Intergenic
1039384497 8:37121478-37121500 GTGAAAAGAAGTGTGGTGAGAGG - Intergenic
1039889137 8:41672515-41672537 TTGAACAGGAGGAAGGTCAGAGG - Exonic
1040425501 8:47280930-47280952 GTGAAGAGTAGTATGCTCAATGG - Intronic
1040577974 8:48670913-48670935 CTGAAGAGAAGGAGAGGCAGGGG + Intergenic
1042654213 8:71077777-71077799 GTGAGGAGAAGGAGGGTCTAGGG + Intergenic
1042810605 8:72821812-72821834 GTGAAGGGAAGGATGGAGGGAGG + Intronic
1043368962 8:79568843-79568865 GGGAAGAGAAGGAAGGGGAGGGG + Intergenic
1043373552 8:79621656-79621678 TTTAAGGGAAGGATGGTAAGTGG + Intronic
1043824553 8:84910037-84910059 GTTCAGAAAAGGATGGACAGAGG + Intronic
1044092215 8:88015952-88015974 ATGAAGAGAAGTACGGCCAGAGG - Intergenic
1044224242 8:89701384-89701406 ATGAAGAAAATGATGGACAGTGG - Intergenic
1044777015 8:95700672-95700694 GTGAAGAGAAGGAAGTGAAGAGG + Intergenic
1046965968 8:120166033-120166055 CTGCAGAGAATGAGGGTCAGTGG + Intronic
1047184323 8:122618295-122618317 GTGGAGAGAACTATGGTTAGAGG - Intergenic
1047206571 8:122807043-122807065 GTGTGGAGAAGGGTGGACAGTGG + Intronic
1047753511 8:127900409-127900431 ATGAAGAGAAGGATGGGGAATGG - Intergenic
1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG + Intergenic
1047980201 8:130173312-130173334 GAGAAGAGAATGAAGCTCAGAGG - Intronic
1048021853 8:130546766-130546788 GTGAAGAGAAGACTGGCTAGAGG + Intergenic
1048104196 8:131389405-131389427 TTGATGGGAAGGATTGTCAGTGG - Intergenic
1049151846 8:141040259-141040281 GAGCAGAGAAGGATGGGCTGTGG - Intergenic
1050148986 9:2600235-2600257 GAGAAGAGAAGTATAGTCAATGG + Intergenic
1051065865 9:13102284-13102306 GTAAAGAGGAGGAGGGTGAGGGG + Intergenic
1051842766 9:21416953-21416975 GAGAAGAAAAGGATCTTCAGTGG + Intronic
1052034413 9:23663621-23663643 GTGAAGAGAATTATAGTCAACGG - Intergenic
1052716160 9:32119969-32119991 GTGAAGAAAGGGTTGGTGAGGGG + Intergenic
1053579686 9:39391599-39391621 GTCAAGAGAAGGAGGGTGAAGGG + Intergenic
1053844204 9:42219679-42219701 GTCAAGAGAAGGAGGGTGAAGGG + Intergenic
1054101273 9:60950408-60950430 GTCAAGAGAAGGAGGGTGAAGGG + Intergenic
1054122646 9:61225771-61225793 GTCAAGAGAAGGAGGGTGAAGGG + Intergenic
1054585078 9:66956473-66956495 GTCAAGAGAAGGAGGGTGAAGGG - Intergenic
1054748340 9:68878878-68878900 GAAAAGAGATGGATGCTCAGGGG + Intronic
1054907692 9:70425091-70425113 GAGAAGAGAAGCAAGGTCAAGGG - Intergenic
1054977460 9:71164521-71164543 GTGTAGAGAATGAGGGGCAGAGG + Intronic
1057292779 9:93818098-93818120 GTGAAGGGAAGGAGGGAAAGAGG + Intergenic
1058476774 9:105342639-105342661 GTGAAGTGAAGGGTGGTCTATGG - Intronic
1059526020 9:114991825-114991847 GTGAAGAGCTGGGTGCTCAGGGG - Intergenic
1059701045 9:116775652-116775674 GGGAAGGGAAGGAGGGTGAGAGG + Intronic
1059931217 9:119263079-119263101 CTGAAGGGCAGGATGGTGAGGGG - Intronic
1060067452 9:120515251-120515273 GTAAAGAAAAGGCTGGCCAGAGG - Intronic
1060417300 9:123440494-123440516 GTAGGGAGAAGGATAGTCAGCGG + Intronic
1060824633 9:126680931-126680953 ATGCAGGGAAGGATGGTCAGAGG + Intronic
1061256379 9:129456005-129456027 GGGAGGAGAAGGAAGGGCAGGGG - Intergenic
1061832337 9:133303978-133304000 GTAAAGAGAAGGAAGAGCAGAGG - Intergenic
1186566319 X:10666702-10666724 GTGAAGAAAAGGGAGCTCAGAGG + Intronic
1187988355 X:24839942-24839964 TTAAAGCTAAGGATGGTCAGAGG - Intronic
1188822642 X:34794404-34794426 GGGAAGAAGAGGGTGGTCAGAGG + Intergenic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1190044392 X:47100639-47100661 GAGAAGAGAGGGATTGACAGAGG + Intergenic
1190723439 X:53170979-53171001 GTGATGAGAAGGATGGGAAGGGG - Intergenic
1192033979 X:67544427-67544449 GTGGGGAGAAGGGTGGTGAGGGG - Intronic
1193698693 X:84739190-84739212 GTGGAGAGATGGATGGTCAAGGG - Intergenic
1193732988 X:85123919-85123941 CTGAAGAGTAGGATGGTGGGAGG + Intergenic
1194921219 X:99767661-99767683 GTGAGTAGAAGGATGGTCACTGG + Intergenic
1194990092 X:100537887-100537909 GTGAAGAGAAGAAAGGTCCAAGG + Intergenic
1195029110 X:100909192-100909214 GTGAGGAGAAGGATGGTAGAGGG - Intergenic
1195282755 X:103352696-103352718 TTGAAGGGAGGGATAGTCAGAGG + Intergenic
1196679697 X:118458217-118458239 GTGAAGAGTGGGGTGGGCAGAGG + Intergenic
1200076996 X:153556250-153556272 GTGAGGAGAAGGGGGGTCTGGGG - Intronic
1200174373 X:154102438-154102460 GGGGAGAGGAGGATGGGCAGAGG + Intergenic
1201540060 Y:15096470-15096492 GGAAAGAGAAGGAAGGACAGAGG - Intergenic
1201759029 Y:17518258-17518280 GAGAATAGGAGGATGTTCAGGGG + Intergenic
1201842526 Y:18387732-18387754 GAGAATAGGAGGATGTTCAGGGG - Intergenic
1202575240 Y:26317157-26317179 GTTTAGAGAAGGACAGTCAGAGG - Intergenic