ID: 919897416

View in Genome Browser
Species Human (GRCh38)
Location 1:202017993-202018015
Sequence TGCCCCCAGCCCTCCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919897416_919897423 29 Left 919897416 1:202017993-202018015 CCTCTTCTGGAGGGCTGGGGGCA 0: 1
1: 0
2: 2
3: 41
4: 311
Right 919897423 1:202018045-202018067 CCTGCCATTTGCAGTTTATGAGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919897416 Original CRISPR TGCCCCCAGCCCTCCAGAAG AGG (reversed) Intergenic
900089953 1:915892-915914 AACCCCCAGCCCTCCAGAAAGGG + Intergenic
900162084 1:1228602-1228624 TGCCCCCAGACCACCTGAACGGG - Exonic
900311472 1:2035511-2035533 TGCCCACAGCCCACCAGCTGGGG + Intergenic
900488483 1:2934813-2934835 AGCCCCCAGCCCTGCGGGAGAGG + Intergenic
900844140 1:5082690-5082712 AGCCTCCAGCCCTCTAGAAGAGG - Intergenic
901232926 1:7651269-7651291 CCCCCACAGCCCTCCAGAAAAGG + Intronic
903828701 1:26162163-26162185 GGCACCCAGCGCGCCAGAAGAGG - Exonic
904617988 1:31760312-31760334 AGCCCCCAGCCCCCTAGAGGAGG - Intronic
905889468 1:41510506-41510528 TCCCCCAAGCCCTCAGGAAGTGG - Exonic
913059822 1:115194579-115194601 AGCCCCTAGCCCTGCAGAGGGGG + Intergenic
914218386 1:145655547-145655569 TGGCAGCAGCCCTACAGAAGAGG - Intronic
914432061 1:147627679-147627701 TGCCCCAAGTTCTCCAGCAGGGG - Intergenic
914470947 1:147978241-147978263 TGGCAGCAGCCCTACAGAAGAGG - Intronic
916213523 1:162377115-162377137 TACCCCCAGCCCTCCAGCCCTGG + Intronic
919283280 1:195519032-195519054 TGGCCCCATCCCCACAGAAGGGG + Intergenic
919437531 1:197580533-197580555 TGCCCCCAGACCTCAGGAAGAGG - Intronic
919756721 1:201070615-201070637 AGCCCACAACCTTCCAGAAGTGG + Intronic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
919916804 1:202144212-202144234 TGCCCCCAGCCGTGCAGTACCGG + Intronic
920041481 1:203100456-203100478 TGGCCGCAGCCCTCCTGAAAGGG - Intronic
920315227 1:205071949-205071971 TGTCCCCAGCTTTCCAGTAGCGG - Exonic
920709468 1:208281232-208281254 TGCAGCCAGTCCTACAGAAGGGG - Intergenic
922569674 1:226626624-226626646 TGCACCCGACCGTCCAGAAGGGG + Intergenic
923783983 1:237050171-237050193 TGCACCCAGCCATCCAGGGGAGG - Intronic
1063096714 10:2915256-2915278 TTCACCCAGCCCACCAGAGGTGG - Intergenic
1063118207 10:3085867-3085889 TGCACACAGACTTCCAGAAGTGG + Intronic
1063449928 10:6144683-6144705 GGCCCGCAGCCCCCCAGACGCGG - Intergenic
1064757045 10:18580715-18580737 TGCCCCCATCTCTGCAGCAGTGG + Intronic
1065118544 10:22505939-22505961 TGCCCCCAGTCCTCCAGTGCTGG + Intergenic
1065857082 10:29839448-29839470 AGCCCCCAGCCCTGCTGCAGGGG - Intergenic
1066013183 10:31212923-31212945 TGCCCTCACCTCTCAAGAAGAGG - Intergenic
1066117503 10:32253588-32253610 TGCTCCCAGCCTTGGAGAAGCGG - Intergenic
1067221112 10:44345087-44345109 TGACCTTAGCCCTCCACAAGAGG + Intergenic
1067729377 10:48799030-48799052 TGGCCACAGCACTTCAGAAGGGG - Intronic
1069028610 10:63571365-63571387 TCCCCTAAACCCTCCAGAAGGGG - Intronic
1069683087 10:70299194-70299216 TGTGCCCAGCCCTCCAGACCCGG - Exonic
1069703368 10:70441779-70441801 TGCCCCCCACCCTCCGGAGGGGG - Intronic
1070325376 10:75385249-75385271 TGCTCCCAGCCACACAGAAGAGG - Intergenic
1070674351 10:78402060-78402082 TGCCAGCAGCCTTCCAGCAGGGG + Intergenic
1071263416 10:83942296-83942318 TGCCCCCAGTCCTCATTAAGTGG + Intergenic
1071507288 10:86240448-86240470 TGCCCCTGGCCCTCCAGCATGGG - Intronic
1072491011 10:95906077-95906099 CGCCCCCCGCCCCCCAGAGGTGG - Intronic
1073327967 10:102653366-102653388 TGTCCCCAGCCCTCCACACATGG - Intronic
1073540245 10:104311921-104311943 TGCCCGCAGGGCTCCAGAAAGGG - Exonic
1075337290 10:121617609-121617631 TGCCCCCAACACCCCAAAAGAGG + Intergenic
1076020097 10:127065533-127065555 TGCTGCCAGTGCTCCAGAAGTGG + Intronic
1076289004 10:129329749-129329771 TCCCCTCAGTGCTCCAGAAGTGG + Intergenic
1076531651 10:131149108-131149130 TGCCCTCAACCCTTCAGATGGGG + Intronic
1076864080 10:133158949-133158971 CGGCCCCAGCCCTGCAGCAGAGG + Intergenic
1077265989 11:1650522-1650544 TGCCCCCATCCCTTCAGGACAGG - Intergenic
1077299466 11:1840386-1840408 TGTCCCCTGCCCTGCAGAAGCGG + Exonic
1077343353 11:2035748-2035770 TGCCCCCAGCCCCACCAAAGCGG + Intergenic
1077365821 11:2161194-2161216 AGCCCTCAGCCCTCCAGGACAGG - Exonic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1077543776 11:3160051-3160073 CCCCACCAGCCCTCCAGAACAGG + Intronic
1077899036 11:6475077-6475099 TTCCTCCAGCCTTCCAGAGGTGG + Intronic
1079313515 11:19387996-19388018 TTCCCCAAGACCTCCAGAATTGG + Intronic
1081862087 11:46339087-46339109 TGCCCCCAGCCCCTCTGCAGGGG - Intronic
1082988327 11:59186458-59186480 TGCTCCCAGCTCCCCAGCAGGGG - Intronic
1083157601 11:60834301-60834323 TGCCCCCTTCCCTCCAGTAGTGG - Intergenic
1084153094 11:67300237-67300259 TGACTCCTGCCCTCCAGGAGTGG - Intronic
1084274320 11:68043913-68043935 TGCCCCCGGCCTTCCGGAGGCGG + Intronic
1084312521 11:68325182-68325204 GGACCCCAGCCCTCCGGGAGAGG - Intronic
1084547385 11:69821226-69821248 TCCTCCCAGTCCTCCAGAGGGGG - Intergenic
1086871889 11:92047865-92047887 TTCCTCCAACCCTCCAGAAATGG - Intergenic
1086958041 11:92954113-92954135 TTCCTACAGGCCTCCAGAAGTGG + Intergenic
1088522098 11:110711750-110711772 TGCCCCTGGGCCTCCCGAAGTGG - Intronic
1088809888 11:113385148-113385170 TGACCCCCACCCACCAGAAGGGG - Intergenic
1089495757 11:118908002-118908024 TCCCACCAGAGCTCCAGAAGGGG - Intronic
1089525185 11:119092538-119092560 AGTCCCCAGCCCTCCACAGGTGG - Intronic
1090280402 11:125451501-125451523 TGGCCCCTTCCCTCCAGAACAGG + Intronic
1090498492 11:127238241-127238263 TGCCCCCAGCTCTCCCATAGGGG + Intergenic
1202826339 11_KI270721v1_random:90937-90959 TGCCCCCAGCCCCACCAAAGCGG + Intergenic
1091488189 12:909787-909809 TGACCCCAGCAGTCCAGCAGTGG + Exonic
1091894764 12:4092266-4092288 AGGTCCCAGCCCTCCAGGAGAGG - Intergenic
1091979813 12:4855825-4855847 TGCGGCCAGCCGTCCAGATGTGG + Intergenic
1092117938 12:6022734-6022756 TGCCCACTGCCCTCCAGGTGAGG - Exonic
1093191157 12:16076850-16076872 TTCCCCCAGCTTTCCAAAAGAGG + Intergenic
1095333554 12:40999477-40999499 TGCACTCAGCCCTGCAGAAATGG - Intronic
1095578087 12:43762294-43762316 TGCACCCAGGCTTCCAGCAGAGG - Intronic
1096184399 12:49568684-49568706 TGGCCCCAGCCGTCCAGGTGGGG - Intronic
1096252501 12:50042015-50042037 TGGTCCCTGCCCTCCCGAAGTGG + Intergenic
1096533678 12:52257489-52257511 TGCCCCACTCCCTCTAGAAGGGG - Intronic
1096977212 12:55706421-55706443 TGCCCCCAGACCGACAGTAGAGG + Intronic
1097154531 12:57003172-57003194 AGCACCCAGCTCTCCAGAAGCGG - Exonic
1097261060 12:57720545-57720567 GGCCCCCAGCCCTCCTGGAGTGG + Intronic
1097727398 12:63090713-63090735 TGTCCCCAGCCCTCAGGATGAGG - Intergenic
1102182594 12:110923674-110923696 TACAGCCAGGCCTCCAGAAGGGG + Intergenic
1103054783 12:117810071-117810093 GGCCCCCAGCCCTCAAGGACTGG + Intronic
1104412966 12:128574604-128574626 TCTCGCCTGCCCTCCAGAAGGGG - Intronic
1104915087 12:132260368-132260390 TGCTCCGAGCCGCCCAGAAGGGG + Intronic
1104994536 12:132645263-132645285 TTCCCCCAGCCCTCCACACAGGG - Intronic
1104994553 12:132645322-132645344 TTCCCCCAGCCCTCCACACAGGG - Intronic
1105015713 12:132785848-132785870 TGCTCAGAGCCCTCCAGAAAGGG + Intronic
1106870793 13:34017408-34017430 TCACCCCAGCCCTCCTGAAATGG + Intergenic
1107457325 13:40566922-40566944 TGCCCCCATCCCTCAAGACTGGG + Intronic
1108397104 13:49999954-49999976 CACCCCCAGCACTCAAGAAGTGG - Intronic
1108811700 13:54233009-54233031 TGCAATCAGCCCTCCACAAGTGG - Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113117834 13:106892551-106892573 TTAGCCCAGACCTCCAGAAGGGG + Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1115628610 14:35220587-35220609 TGCTCCCAACCCTCCTGGAGGGG - Intronic
1116861748 14:50001128-50001150 GCCCACCAGCCCTGCAGAAGTGG + Intronic
1117078274 14:52125859-52125881 TGACCTCAGCCATCCAGAATTGG + Intergenic
1118154491 14:63225326-63225348 TGCCTCCAGCTTTCCAGGAGAGG + Intronic
1119474316 14:74918387-74918409 GGCCCCCACTCCTCCAGAGGAGG - Intronic
1119758485 14:77135180-77135202 TGCCCCCCCCCCACCAGAGGAGG - Intronic
1121010508 14:90517509-90517531 TGCCCCCAGCCCGCCCAGAGCGG + Intergenic
1121634517 14:95444834-95444856 TGGCCACATCCCTCCAGAACTGG + Intronic
1122266282 14:100548429-100548451 TACCCACAGCCCTCGGGAAGAGG + Intronic
1122347291 14:101068414-101068436 TGCCCCCACCCCCCGACAAGTGG - Intergenic
1124202857 15:27693217-27693239 TGCCCGCAGCCCTCCCCAGGCGG - Intergenic
1124209885 15:27753935-27753957 TGTCCCCAGCCATCCTGATGTGG + Intergenic
1124372605 15:29112001-29112023 TGTCCCCGGCCCTGCAGCAGTGG + Intronic
1129566913 15:76633171-76633193 TGGCAGCAGCCCTACAGAAGAGG - Intronic
1129999456 15:80034456-80034478 TGCCCCCTTCCCCCCTGAAGTGG + Intergenic
1130651243 15:85763275-85763297 GGCCAGCAGCCGTCCAGAAGCGG - Intronic
1130953566 15:88611135-88611157 TGCCCATAGGCTTCCAGAAGGGG + Intergenic
1131232722 15:90671394-90671416 ACACCCCGGCCCTCCAGAAGTGG - Intergenic
1131672185 15:94631680-94631702 TGGCCCAAGGCCTCCAGAAAAGG - Intergenic
1132598655 16:764374-764396 TGCCCACGGCGCTCCAGGAGGGG - Intronic
1132674797 16:1117148-1117170 TGCCCCCACCCCTGCCGAGGTGG + Intergenic
1132889267 16:2196156-2196178 TGCCCCCAGCACTGGAGATGGGG - Intronic
1134888429 16:17816344-17816366 TGTCCCCAGCTGACCAGAAGTGG + Intergenic
1136172713 16:28498215-28498237 AGCCCCCAACCCTCCTGAGGAGG + Exonic
1137230740 16:46564256-46564278 TGCCAACGGCCATCCAGAAGTGG - Intergenic
1137569060 16:49552859-49552881 GGCCCCCACCCCTCCAGGAGGGG + Intronic
1137592539 16:49702577-49702599 CACCCCCAGCCCTCAAGGAGAGG + Intronic
1137836128 16:51594266-51594288 TGCCACCACCCCTGCACAAGAGG - Intergenic
1138063926 16:53920845-53920867 TGCCCCCAGGCCTAGAGAACTGG - Intronic
1138295847 16:55884546-55884568 TGTCCCCTGGCCTGCAGAAGAGG + Intronic
1142286134 16:89172241-89172263 GGCCCCCAGCCCCCCAGAGAGGG - Intronic
1143610236 17:8013863-8013885 TCCCCTCATGCCTCCAGAAGTGG + Exonic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1146454444 17:32998012-32998034 TGCCCACAGGCCACCAGAAATGG - Intergenic
1147848772 17:43425115-43425137 CACCCCCAGCCCTCTAGATGTGG + Intergenic
1148028624 17:44605132-44605154 TTCCCAATGCCCTCCAGAAGAGG - Intergenic
1148225293 17:45894828-45894850 TGGCCCCAGCCCCCGAGCAGGGG - Intronic
1148346312 17:46905859-46905881 TGTGCCCAGCCCTCCAGACCAGG + Intergenic
1148566370 17:48635352-48635374 CGGCCCCAGCTCTCCAGAGGTGG + Intergenic
1148688218 17:49512585-49512607 TGGCCCCAGGCCTCCAGATGGGG + Intronic
1150212077 17:63446865-63446887 TGCCCCCAGGGCTCCCGGAGCGG - Intergenic
1150833611 17:68544267-68544289 TGCCCCCAGCCCTCATGATCCGG - Intronic
1151732133 17:75917837-75917859 TGCCCCCAGCACTGCAGGAGCGG - Exonic
1151957166 17:77386228-77386250 TGCCCCCACCCCTCCTGCAGAGG + Intronic
1152223676 17:79082826-79082848 TTCCACAAGCCCGCCAGAAGAGG - Intronic
1152309495 17:79540940-79540962 TCCCCCCAGGCCTCAAGAAGAGG - Intergenic
1152438470 17:80290123-80290145 TGTCCCCAGCACTTCAGAGGTGG + Intronic
1152724049 17:81936672-81936694 AGCCCCCAGCCCTGCAGAAGTGG + Intronic
1152744050 17:82031217-82031239 TGCCCCCAGCCCTGCAGGGAGGG + Intergenic
1154322011 18:13361819-13361841 TGCCCCCAGCCAGCCAGAGCAGG + Intronic
1155295832 18:24383932-24383954 TGGTCCCTGCCCTCCAGAACAGG + Intronic
1157524325 18:48367945-48367967 TGCCCCCAGCCCTCCACTGGAGG + Intronic
1157578417 18:48759100-48759122 TGACCCTAAACCTCCAGAAGAGG + Intronic
1160434293 18:78833568-78833590 TGCTCCGAGCCCTACAGCAGGGG + Intergenic
1160895713 19:1401035-1401057 GGCCCCCCGCTCTCCAGATGGGG - Intronic
1162089016 19:8265995-8266017 TCCCCCCACCCCTCCAGACAGGG - Intronic
1162728840 19:12705727-12705749 TGCCCCCACTGATCCAGAAGTGG - Exonic
1162796279 19:13089225-13089247 TGCCCACCTCTCTCCAGAAGTGG - Intronic
1163096106 19:15058219-15058241 TGTTCCCTGCCCTCCAGAAGTGG - Exonic
1163526230 19:17823179-17823201 TCCCCCCTGCCCCCCAGAAAAGG - Intergenic
1163596864 19:18225610-18225632 TGCCCCCATCCCTCCCCACGAGG + Intronic
1164587516 19:29485301-29485323 AGCCCCCAGCCCACCTGAGGAGG + Intergenic
1165067170 19:33235995-33236017 TGCCCGCTCCCCTCCAGCAGTGG - Intergenic
1165124161 19:33582230-33582252 TCACCCCAGGGCTCCAGAAGAGG + Intergenic
1166531428 19:43545787-43545809 TCCCCCCATCCCTCCTGAAGTGG - Intronic
1168300438 19:55401809-55401831 GACCCCCAGGCCTCCACAAGAGG + Intronic
925742292 2:7016950-7016972 TTGCCCCAGAGCTCCAGAAGGGG - Intronic
926750944 2:16197924-16197946 TGCTCCCAGCCCTCCCTACGAGG - Intergenic
927520483 2:23695373-23695395 TGCAGCCAGCCCTGCAGGAGTGG - Intronic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
927886475 2:26721611-26721633 TGCCCTCTGCCATCCAGCAGGGG + Intronic
928786331 2:34890732-34890754 TGACCCCAGACCTACAGAAGTGG - Intergenic
929778797 2:44944396-44944418 TGCACCCAGGCCTCCCCAAGCGG + Intronic
932366500 2:71156570-71156592 TGCTCCGAGCTCTCCAGAGGGGG + Intergenic
934113231 2:88761629-88761651 TGCCACCATCCATCCAGATGTGG + Intergenic
934520087 2:95014584-95014606 TGCCCCAAACCCTCTCGAAGTGG - Intergenic
934551600 2:95266242-95266264 TGCCCACAGCCCTCCACATTTGG + Intergenic
935100237 2:99987555-99987577 TGCCCCCAGCCAGGCATAAGGGG - Intronic
936169659 2:110157583-110157605 TGCCACCATCCATCCAGATGCGG + Intronic
937434257 2:121867325-121867347 AGCCCACTGCCCTCCATAAGGGG + Intergenic
937636626 2:124163306-124163328 TGCCTCCAGCCCTGGAGAATAGG + Intronic
938162379 2:128997451-128997473 TCCTCCCAGCCCTCCATAACTGG + Intergenic
941601809 2:167551843-167551865 TGCTCCCAGACCTCCAACAGGGG - Intergenic
942431192 2:175913555-175913577 TGCCAGCAGACCTGCAGAAGAGG - Intergenic
942582403 2:177432824-177432846 TGCTTCCAGTCCTGCAGAAGGGG + Intronic
942961149 2:181830946-181830968 TCCCCCCATGCCTCAAGAAGAGG - Intergenic
946311282 2:218883761-218883783 CCCCTCCAGCCGTCCAGAAGCGG + Intronic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
946403457 2:219480869-219480891 TCCCCACACCCCTCCATAAGAGG + Intronic
946448232 2:219757993-219758015 TGCCCACAACCTACCAGAAGAGG + Intergenic
946888419 2:224247821-224247843 TCCCCCCTGCCCTCATGAAGAGG - Intergenic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
948826773 2:240576831-240576853 TGCCCCCTGCGCTGCAGAGGTGG + Exonic
949081016 2:242099789-242099811 TTTCCCCACCCCTCCAGAAAGGG + Intergenic
1170158861 20:13292822-13292844 TGCCCTCAGTTCTCCAGCAGAGG + Intronic
1171518425 20:25757756-25757778 TGCCTCCAGCCCTGCTGAACTGG + Intergenic
1171558430 20:26098450-26098472 TGCCTCCAGCCCTGCTGAACTGG - Intergenic
1172277329 20:33686641-33686663 TGTCCCCACGCCTCCAGCAGGGG - Intergenic
1172359511 20:34302685-34302707 GTCCCCCACCCCTCCAGCAGGGG - Intronic
1172993878 20:39055746-39055768 GTCACCCAGTCCTCCAGAAGAGG - Intergenic
1175217398 20:57398746-57398768 TGGCCCAAGGCTTCCAGAAGAGG - Intronic
1175883356 20:62273223-62273245 TGCCCACCGCCCTCCACAAGAGG + Intronic
1178430727 21:32516597-32516619 TCCACCCAGCCCTCCCCAAGTGG - Intergenic
1178780947 21:35603150-35603172 AGCCCCACGCCCTCCAAAAGGGG + Intronic
1179376284 21:40852686-40852708 TCCTCCCTGCCCTCCAGATGCGG + Intergenic
1179545001 21:42107863-42107885 TGCCCCCATTGCTCCAGGAGAGG + Intronic
1179559888 21:42208936-42208958 TGCCCCAGGCCCTCCTGGAGAGG + Intronic
1179808307 21:43854121-43854143 AACCCCCAGCACTGCAGAAGGGG + Intergenic
1180569373 22:16701148-16701170 TGCCCACTGCCCTCCAGGTGAGG - Intergenic
1180843265 22:18969090-18969112 TGTCCCCTGGCCTCCTGAAGGGG - Intergenic
1180933448 22:19608707-19608729 TGCCTCCTGGCCTCCAGAGGTGG + Intergenic
1181058205 22:20269645-20269667 TGTCCCCTGGCCTCCTGAAGGGG + Intronic
1181514746 22:23404100-23404122 TGCCCCCTGGCCTCCTGAAGGGG + Intergenic
1181809030 22:25392334-25392356 GGACCCCAGTCCTCCAGGAGAGG + Intronic
1182237060 22:28884015-28884037 TGGCCCCGGCCCGCGAGAAGCGG - Exonic
1182281170 22:29218529-29218551 TGCCCCCAGGCCTCAGGAGGTGG + Intronic
1183349997 22:37329773-37329795 TGCCTCCAGGACTCCAGCAGGGG - Intergenic
1183527875 22:38334760-38334782 TGCTCCCAGCCCACAAGGAGCGG + Intronic
1183964165 22:41431404-41431426 GGGCCCCAGCCCTGCAGCAGGGG - Intergenic
1184762194 22:46550942-46550964 TGCCCACTGCCCAGCAGAAGGGG - Intergenic
1185105699 22:48868557-48868579 TGCTTCCAGCCCTCCTGATGAGG - Intergenic
950431475 3:12953462-12953484 GTCACCCAGACCTCCAGAAGTGG + Intronic
953391180 3:42534759-42534781 TGCCCCCAGCCCTCCTGGCCTGG - Intronic
953703715 3:45215684-45215706 TGGGCCCAGCTCTCTAGAAGGGG - Intergenic
953791388 3:45950492-45950514 TGCCTCCACCCCTCCAGTAGGGG - Intronic
953884635 3:46708379-46708401 TGGCCCCAGCCCTAGAGGAGGGG - Intronic
954330836 3:49889496-49889518 TGCCGCCATCCCTCCAGGAATGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
955347721 3:58173357-58173379 GGCCCCCAGCCCTCCAGATGGGG + Intergenic
956141659 3:66152623-66152645 TTCCCCCAGCCGTCAAGAAAAGG + Intronic
960992240 3:123319567-123319589 TGCCCCCAGCACCACGGAAGGGG - Intronic
960996737 3:123345177-123345199 GGCCCCCAGCCCTCCAGCAAGGG - Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961243029 3:125428844-125428866 GGCACCCAGCTATCCAGAAGTGG + Intergenic
961603648 3:128078090-128078112 TGCCCACAGCCCTCCAGAGCAGG + Intronic
961615318 3:128174834-128174856 TGCCCCAAGGACTTCAGAAGTGG - Intronic
961648974 3:128408099-128408121 TGACACCCGCCCTCAAGAAGCGG + Exonic
961717651 3:128869732-128869754 TGCTCCTGGTCCTCCAGAAGGGG + Intergenic
961913512 3:130345917-130345939 CGCCCCCAACTCTCCAGAAGAGG - Exonic
966196939 3:177323203-177323225 TGCCCTCAGTACTCTAGAAGGGG + Intergenic
968582517 4:1401675-1401697 TGCCCCCAGCCCTCCCCCAGTGG + Intergenic
968647768 4:1748911-1748933 TGGCCACAGGCCTCCAGGAGGGG + Intergenic
968676415 4:1883338-1883360 TGCGCCCAGCCCTGCAGAGGGGG - Intronic
968732380 4:2275557-2275579 TGAGCCAAGCCCTCCAAAAGAGG - Intronic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
969057096 4:4408856-4408878 TGCCCCGTGCCCTCCAGCCGGGG + Intronic
969094224 4:4719889-4719911 TGCCACCCGGCCTCCAGAATGGG + Intergenic
969589247 4:8112257-8112279 TGCCACCAGCCAGCCAGAATGGG + Intronic
969613213 4:8238351-8238373 TGCGCCCAGCCCTGCAGGGGTGG + Intronic
969865606 4:10075260-10075282 TGCCCCCACCCCACCACAAGAGG - Exonic
974003770 4:56535798-56535820 TGCTCTCAACCCTCCAGAATGGG + Intronic
974237875 4:59205818-59205840 TGCCACCAACCTTCCAGAAATGG - Intergenic
978330576 4:107608776-107608798 TGCCTCCAGCTCACCAGAGGGGG - Intronic
978857162 4:113406345-113406367 TACCCCCAGCCCACTATAAGGGG + Intergenic
981088826 4:140711416-140711438 TGCCCCCAGGTATCCAGGAGGGG - Intronic
983455026 4:167952953-167952975 GGCCTCCAGGCCTCCAGGAGGGG - Intergenic
983958706 4:173727202-173727224 TGCCAGCAGACCTGCAGAAGAGG - Intergenic
984063137 4:175017018-175017040 AGACCACAGCCCCCCAGAAGTGG + Intergenic
985781505 5:1874118-1874140 TGCTCCCAGGCCTCCAGCATAGG - Intergenic
985782957 5:1880619-1880641 TGCCTCCCGCCTTCCAGAAAGGG + Intronic
986347051 5:6845419-6845441 TGTCCCCAGTGTTCCAGAAGAGG - Intergenic
987186537 5:15426190-15426212 TAGCCCCAACCCTCCAGATGAGG - Intergenic
991579225 5:68136863-68136885 TCCCCCCACCCCTCCAGTACAGG + Intergenic
993022254 5:82605685-82605707 TGCTCCCAGCCCTCCACAGCAGG + Intergenic
994087284 5:95773236-95773258 TGACCCCAGCCCTGCATAAAGGG - Intronic
994619998 5:102151449-102151471 TGTCCCCAACCCTGGAGAAGTGG + Intergenic
997199841 5:132003278-132003300 TGCCGCCTGACCTCCAGAGGGGG - Intronic
998850953 5:146350186-146350208 TGCCCCCAGACCTACTGATGGGG - Intergenic
1000038986 5:157471044-157471066 TGCCCCCAGTCCTCCTGAGCTGG - Intronic
1000426130 5:161093451-161093473 TGCTCCCTGCCCTCCAGAGCAGG - Intergenic
1001007661 5:168068061-168068083 TGCCACCAGCTAACCAGAAGGGG - Intronic
1001035208 5:168292171-168292193 TCCTCCCAGCCCTCCGGCAGGGG - Exonic
1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG + Intronic
1002059277 5:176616862-176616884 AGTCCCCAGCCCTCCATCAGTGG + Intergenic
1002417676 5:179129281-179129303 AGCCCCCAGCGCTCCACACGTGG - Intronic
1002685502 5:181006024-181006046 TGCCCTGAGCCCTGCAGCAGCGG + Exonic
1004314285 6:14572438-14572460 TGCCCCAATACATCCAGAAGGGG - Intergenic
1004916845 6:20340391-20340413 AGCCCCCAGCCCTGGAGAAAGGG + Intergenic
1005554189 6:26956633-26956655 TGCCCCCCGCCCCCCAGCCGCGG - Intergenic
1006317450 6:33298869-33298891 TGCCCCCACCCCTCCCGAGCAGG - Exonic
1007114596 6:39334669-39334691 TGCCCTCAGCCCTCTAGAGCTGG - Exonic
1007253271 6:40510904-40510926 TGCCCCCACCCCTCCAGCATTGG - Intronic
1007465653 6:42049401-42049423 TTCCCCCAGCTTTACAGAAGAGG + Intronic
1007626893 6:43251769-43251791 TGCCCCCTGCCCTGGAGAGGAGG + Intronic
1007761437 6:44135761-44135783 TCCTCCCAGGCCTCCAGAAGAGG - Intronic
1008851344 6:56026278-56026300 TTCCCCCTTCCCTCCAGAAAGGG - Intergenic
1009372515 6:62924559-62924581 TGCCCCCACCCCTTCATATGAGG - Intergenic
1010539248 6:77070565-77070587 TTCCCCCAGCCATTCAGAACTGG - Intergenic
1012009891 6:93770262-93770284 TCCCCCCACCCCACCACAAGGGG + Intergenic
1014413342 6:121153450-121153472 TGACCCCATACCTCCAGATGGGG - Intronic
1017613240 6:156213787-156213809 TGACCCCACCCCTCCAGCAGAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018995810 6:168709747-168709769 TGGCCCCTGCCCTCCCGCAGAGG + Intergenic
1019260199 7:77782-77804 GGTCCCCAGCCCTGGAGAAGAGG - Intergenic
1019992751 7:4703422-4703444 CGCCACCAGCCCTGCAGACGCGG - Intronic
1020180264 7:5916742-5916764 AGTCTCCAGCCCTCCAGAGGTGG + Intronic
1020302666 7:6808140-6808162 AGTCTCCAGCCCTCCAGAGGTGG - Intronic
1022870422 7:34472051-34472073 TGACCCCAACCCCCCAGCAGAGG - Intergenic
1025082881 7:55999330-55999352 TTCTCCCCACCCTCCAGAAGGGG + Exonic
1027233906 7:76286827-76286849 TGCCCCCAGCCCCACCCAAGAGG + Exonic
1027826771 7:83125294-83125316 TGCCCCCCACCTTCCAGAGGGGG - Intronic
1032508838 7:132455880-132455902 TCCTCCCAGGCCTCCAGAGGTGG - Intronic
1034200586 7:149281065-149281087 TGCCCCCAGACCACCCTAAGAGG - Intronic
1034434773 7:151058208-151058230 TGCTCCCAGCCCTCTTGAAAAGG + Exonic
1034729070 7:153367667-153367689 TGCCCCCACCCATTCAGATGCGG + Intergenic
1035538919 8:416596-416618 TTTCCCCACCCCTCCAGAAAGGG + Intronic
1036604018 8:10290575-10290597 TGCCCCCAGCTCTCCTGTATCGG + Intronic
1036694658 8:10966728-10966750 TGCCCTCAGACCTCTAGAATAGG + Intronic
1039404192 8:37298665-37298687 GGCCCCCAGCTCTGCAGAGGTGG - Intergenic
1041316815 8:56572597-56572619 TGCCCCAAGCTCTTCAGAACAGG + Intergenic
1046937983 8:119904035-119904057 TGCCTCTATCCCTCCACAAGAGG + Intronic
1047023996 8:120807727-120807749 TGTCCCCAGCACTTCAGGAGTGG + Intronic
1047402119 8:124556444-124556466 TCCCCGCAGCCCTCCAGTGGAGG - Intronic
1047407944 8:124600973-124600995 TGCCCCCACCCCTTCAAAACAGG + Intronic
1048875981 8:138837449-138837471 AGCCCCCAGCCCACCTGAACAGG + Intronic
1048889296 8:138933521-138933543 TGCCCCAAGTCATCCAGCAGAGG - Intergenic
1049433681 8:142576649-142576671 TGCCCCCAGCCCTCCTGCCAGGG + Intergenic
1049800721 8:144516346-144516368 AGCCCCCAGCCCAGCAGCAGTGG - Exonic
1052978378 9:34429022-34429044 TGCCCCCAGCCCACCTCAAGAGG - Intronic
1055745491 9:79439506-79439528 TGTGCCCTGCCCCCCAGAAGTGG - Intergenic
1057430254 9:94987544-94987566 TGCCCCCACCCTTCCAGCTGAGG - Intronic
1057906012 9:98984077-98984099 TGCCCTCTGGCCTCCAGAGGAGG + Intronic
1059160834 9:112033885-112033907 TGCCTCATTCCCTCCAGAAGTGG + Intergenic
1060494101 9:124105349-124105371 TGGCCCCAGCCCTCTGGAAGGGG + Intergenic
1060519474 9:124286179-124286201 GGCCCCCAGCCAGCCCGAAGAGG - Intronic
1061486609 9:130923572-130923594 TGACCCCACCCCTACAGAAGAGG - Intronic
1061487622 9:130928422-130928444 AGCCCCCAGCCCTGCTGATGAGG + Intronic
1061613788 9:131765953-131765975 TGCTCCCAGCCCTGCACACGTGG + Intergenic
1061743819 9:132725619-132725641 TGCCCCCAGCCCCCCAGCCTCGG - Exonic
1062064967 9:134521818-134521840 TGGCCCCACCCCTCCAGCAGAGG - Intergenic
1062408342 9:136408787-136408809 TGGCCCCAGCCCCCCAGGTGGGG + Intronic
1062467937 9:136689436-136689458 TGCCCACTGCTCTCCTGAAGAGG + Intergenic
1062507109 9:136883305-136883327 TGCCCACAGCCCTCGAGAGCAGG - Intronic
1062677226 9:137753614-137753636 CGCCCCCACCCCTCCACAGGAGG - Intronic
1185913060 X:4003778-4003800 TGCCACCAGCCTTCAGGAAGTGG + Intergenic
1186374717 X:8987482-8987504 TCCCACCAACCCTGCAGAAGAGG - Intergenic
1186468531 X:9803511-9803533 TGCCCCCAGGACTCCAGAGAAGG + Intronic
1187496480 X:19800074-19800096 TCCACCCAGGCCTCCAGAAGAGG + Intronic
1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG + Intergenic
1189772416 X:44439404-44439426 TTCCCCCAGCTCCCCAGAGGAGG - Intergenic
1192026448 X:67457332-67457354 TGCCAGCAGCCCTACAGAAGAGG + Intergenic
1192181472 X:68918373-68918395 TGCCCCCTGCCTGCCAGCAGGGG - Intergenic
1192338053 X:70238362-70238384 TGCGCACAGCCCTCCAGCATGGG + Exonic
1195966695 X:110435392-110435414 TGCTCCCAGCTCTGCAGCAGTGG - Intronic
1197590440 X:128402765-128402787 CACCCCCTGCCCTCCAGCAGTGG - Intergenic
1198763603 X:140059089-140059111 AGCCCCCAGACATCCATAAGCGG - Intergenic
1200064434 X:153497722-153497744 AGGCCCCACCCCTCCAGAGGAGG - Intronic
1200126062 X:153815699-153815721 AGGCCCCACCCCTCCAGAGGAGG + Intronic
1200251625 X:154557194-154557216 AGCCTCCAGGCCTCCAGAAGCGG - Intronic
1200253832 X:154568878-154568900 AGCCTCCAGGCCTCCAGAAGCGG - Intergenic
1200263937 X:154635530-154635552 AGCCTCCAGGCCTCCAGAAGCGG + Intergenic
1200266142 X:154647222-154647244 AGCCTCCAGGCCTCCAGAAGCGG + Intergenic
1201283680 Y:12361531-12361553 TTCCCTCAGCCCTGAAGAAGGGG + Intergenic