ID: 919905809

View in Genome Browser
Species Human (GRCh38)
Location 1:202077614-202077636
Sequence CTTCACCTGGGGCAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919905809_919905814 -7 Left 919905809 1:202077614-202077636 CCTGGGTGCTGCCCCAGGTGAAG No data
Right 919905814 1:202077630-202077652 GGTGAAGAATGCTGTGGTGAAGG No data
919905809_919905815 14 Left 919905809 1:202077614-202077636 CCTGGGTGCTGCCCCAGGTGAAG No data
Right 919905815 1:202077651-202077673 GGAGACAGACCCTGCCCTTATGG No data
919905809_919905816 15 Left 919905809 1:202077614-202077636 CCTGGGTGCTGCCCCAGGTGAAG No data
Right 919905816 1:202077652-202077674 GAGACAGACCCTGCCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919905809 Original CRISPR CTTCACCTGGGGCAGCACCC AGG (reversed) Intergenic
No off target data available for this crispr