ID: 919910213

View in Genome Browser
Species Human (GRCh38)
Location 1:202106506-202106528
Sequence CCCCAGGAGCAGGTGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919910201_919910213 9 Left 919910201 1:202106474-202106496 CCCTGCCCCGGGCCTCTCATTTG No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910200_919910213 10 Left 919910200 1:202106473-202106495 CCCCTGCCCCGGGCCTCTCATTT No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910203_919910213 4 Left 919910203 1:202106479-202106501 CCCCGGGCCTCTCATTTGCTGTT No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910202_919910213 8 Left 919910202 1:202106475-202106497 CCTGCCCCGGGCCTCTCATTTGC No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910197_919910213 15 Left 919910197 1:202106468-202106490 CCCCACCCCTGCCCCGGGCCTCT No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910195_919910213 20 Left 919910195 1:202106463-202106485 CCTTGCCCCACCCCTGCCCCGGG No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910193_919910213 30 Left 919910193 1:202106453-202106475 CCAGTTTCAGCCTTGCCCCACCC No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910206_919910213 -3 Left 919910206 1:202106486-202106508 CCTCTCATTTGCTGTTTACCCCC No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910199_919910213 13 Left 919910199 1:202106470-202106492 CCACCCCTGCCCCGGGCCTCTCA No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910198_919910213 14 Left 919910198 1:202106469-202106491 CCCACCCCTGCCCCGGGCCTCTC No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910205_919910213 2 Left 919910205 1:202106481-202106503 CCGGGCCTCTCATTTGCTGTTTA No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data
919910204_919910213 3 Left 919910204 1:202106480-202106502 CCCGGGCCTCTCATTTGCTGTTT No data
Right 919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919910213 Original CRISPR CCCCAGGAGCAGGTGCACCT GGG Intergenic
No off target data available for this crispr