ID: 919916749

View in Genome Browser
Species Human (GRCh38)
Location 1:202144037-202144059
Sequence GTCCCGCGGGTAGAGGGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919916749_919916761 22 Left 919916749 1:202144037-202144059 CCGTGACCCTCTACCCGCGGGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 919916761 1:202144082-202144104 CCCGTCATGCCCCCTTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 49
919916749_919916759 21 Left 919916749 1:202144037-202144059 CCGTGACCCTCTACCCGCGGGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 919916759 1:202144081-202144103 CCCCGTCATGCCCCCTTGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 51
919916749_919916764 24 Left 919916749 1:202144037-202144059 CCGTGACCCTCTACCCGCGGGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 919916764 1:202144084-202144106 CGTCATGCCCCCTTGCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 12
919916749_919916763 23 Left 919916749 1:202144037-202144059 CCGTGACCCTCTACCCGCGGGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 919916763 1:202144083-202144105 CCGTCATGCCCCCTTGCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919916749 Original CRISPR GTCCCGCGGGTAGAGGGTCA CGG (reversed) Intronic
900300248 1:1973474-1973496 GTCCCGAGGAGAGAGGCTCACGG + Intronic
905869712 1:41396185-41396207 GCCCCACGGATAGAGGGTGAGGG - Intergenic
914513331 1:148353231-148353253 CCCCAGCGGGTAGAGGGTCTCGG + Intergenic
914880195 1:151540822-151540844 TTCCCGTGGGTCGAGGGTCCTGG + Intronic
915305411 1:154974395-154974417 GACCCTGAGGTAGAGGGTCAGGG - Intronic
919916749 1:202144037-202144059 GTCCCGCGGGTAGAGGGTCACGG - Intronic
1075267756 10:121019121-121019143 TTCCTGTAGGTAGAGGGTCAGGG + Intergenic
1077416295 11:2425800-2425822 GTCCCCCAGGCTGAGGGTCATGG - Intergenic
1103364022 12:120369358-120369380 GCCCCGCGGGAAGGGGGTCCCGG - Intergenic
1116381340 14:44272896-44272918 GTTCCGGGGTTAGAGTGTCAGGG - Intergenic
1129700064 15:77762752-77762774 GTCTCTCGGGTGGTGGGTCAGGG - Intronic
1131525706 15:93150861-93150883 GTCCCGGGGGAAGAGGTTAAAGG + Intergenic
1153904651 18:9650460-9650482 GTCCCTGGGGTAGAGGGAAAAGG + Intergenic
1160487820 18:79309514-79309536 CTCCAGCAGGTAGAAGGTCAGGG + Intronic
1162027803 19:7904201-7904223 GGCTCGCGGGGCGAGGGTCACGG + Intronic
1175904367 20:62372306-62372328 GCCCCAGGGGTAGAGGCTCAGGG - Intergenic
1184473730 22:44710008-44710030 GGGCGGCGGGTAGGGGGTCAGGG - Intronic
1185005828 22:48276535-48276557 GTACCCCTGGCAGAGGGTCAGGG + Intergenic
955195427 3:56801434-56801456 GACCGGCAGGTAGAGGGACAGGG + Intronic
962959662 3:140298996-140299018 GTACAGGGGGAAGAGGGTCAGGG - Intronic
967316266 3:188154276-188154298 CGCCCGCGGGTGGAGGGTGAGGG - Intronic
973028993 4:45311258-45311280 GACCCGTGGGTAGTGGGACATGG - Intergenic
981034183 4:140152977-140152999 GGTCCGCTGGTAGAGGCTCACGG + Exonic
1002434755 5:179224363-179224385 GACCCACAGGTCGAGGGTCAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1007652724 6:43433206-43433228 GTACAGCAGGTAGAGGGTGATGG - Exonic
1016863955 6:148747725-148747747 GTGCGGCGGGGAGAGGGTCGCGG + Intronic
1017898469 6:158701421-158701443 GAGCCGTGGGAAGAGGGTCATGG + Intronic
1018949830 6:168371962-168371984 GTCCCCCGTGCAGAAGGTCACGG + Intergenic
1022497289 7:30861104-30861126 GTCCTGCAGGCAGATGGTCAAGG + Intronic
1034704958 7:153133135-153133157 GGCCTGTCGGTAGAGGGTCAGGG - Intergenic
1049702902 8:144023136-144023158 GTCCTGAGGGAAGAGGGTCCTGG - Intronic
1060235577 9:121860341-121860363 GTCCCGCTGGTCCAGGGTCATGG + Exonic
1060975085 9:127760316-127760338 CTCCTGGGGGTAGAAGGTCAAGG + Intronic
1199728631 X:150608867-150608889 GTCCCCCGGCTAGAGGGCAATGG + Intronic