ID: 919920945

View in Genome Browser
Species Human (GRCh38)
Location 1:202166107-202166129
Sequence AGGAGTGAGAATGGAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920945_919920952 10 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920952 1:202166140-202166162 TGTCTGTAGGTGGGAGCACCTGG No data
919920945_919920955 24 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920955 1:202166154-202166176 AGCACCTGGGTGAGCAGCTCGGG No data
919920945_919920950 1 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920950 1:202166131-202166153 ATCCTCAGCTGTCTGTAGGTGGG No data
919920945_919920954 23 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920954 1:202166153-202166175 GAGCACCTGGGTGAGCAGCTCGG No data
919920945_919920948 -3 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920948 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
919920945_919920949 0 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920945_919920953 11 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920945_919920956 25 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920945 Original CRISPR AGGAGTGAGAATGGAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr