ID: 919920946

View in Genome Browser
Species Human (GRCh38)
Location 1:202166116-202166138
Sequence CTGAGGATGAGGAGTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920946_919920959 27 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data
919920946_919920958 26 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data
919920946_919920954 14 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920954 1:202166153-202166175 GAGCACCTGGGTGAGCAGCTCGG No data
919920946_919920955 15 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920955 1:202166154-202166176 AGCACCTGGGTGAGCAGCTCGGG No data
919920946_919920949 -9 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920946_919920953 2 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920946_919920952 1 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920952 1:202166140-202166162 TGTCTGTAGGTGGGAGCACCTGG No data
919920946_919920950 -8 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920950 1:202166131-202166153 ATCCTCAGCTGTCTGTAGGTGGG No data
919920946_919920956 16 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920946 Original CRISPR CTGAGGATGAGGAGTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr