ID: 919920947

View in Genome Browser
Species Human (GRCh38)
Location 1:202166127-202166149
Sequence CCTACAGACAGCTGAGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920947_919920959 16 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data
919920947_919920952 -10 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920952 1:202166140-202166162 TGTCTGTAGGTGGGAGCACCTGG No data
919920947_919920958 15 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data
919920947_919920954 3 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920954 1:202166153-202166175 GAGCACCTGGGTGAGCAGCTCGG No data
919920947_919920953 -9 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920947_919920960 27 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920960 1:202166177-202166199 GTGACTCAAGGGCTCTAGTCAGG No data
919920947_919920956 5 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data
919920947_919920955 4 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920955 1:202166154-202166176 AGCACCTGGGTGAGCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920947 Original CRISPR CCTACAGACAGCTGAGGATG AGG (reversed) Intergenic
No off target data available for this crispr