ID: 919920949

View in Genome Browser
Species Human (GRCh38)
Location 1:202166130-202166152
Sequence CATCCTCAGCTGTCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920943_919920949 7 Left 919920943 1:202166100-202166122 CCCAAAGCCTTTTCTTCCATTCT No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920945_919920949 0 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920940_919920949 27 Left 919920940 1:202166080-202166102 CCTGGGCTTCACTCCCAGGGCCC No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920941_919920949 14 Left 919920941 1:202166093-202166115 CCCAGGGCCCAAAGCCTTTTCTT No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920942_919920949 13 Left 919920942 1:202166094-202166116 CCAGGGCCCAAAGCCTTTTCTTC No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920946_919920949 -9 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data
919920944_919920949 6 Left 919920944 1:202166101-202166123 CCAAAGCCTTTTCTTCCATTCTC No data
Right 919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920949 Original CRISPR CATCCTCAGCTGTCTGTAGG TGG Intergenic
No off target data available for this crispr