ID: 919920951

View in Genome Browser
Species Human (GRCh38)
Location 1:202166133-202166155
Sequence CTCCCACCTACAGACAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920951_919920956 -1 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data
919920951_919920955 -2 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920955 1:202166154-202166176 AGCACCTGGGTGAGCAGCTCGGG No data
919920951_919920958 9 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data
919920951_919920954 -3 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920954 1:202166153-202166175 GAGCACCTGGGTGAGCAGCTCGG No data
919920951_919920959 10 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data
919920951_919920960 21 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920960 1:202166177-202166199 GTGACTCAAGGGCTCTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920951 Original CRISPR CTCCCACCTACAGACAGCTG AGG (reversed) Intergenic
No off target data available for this crispr