ID: 919920953

View in Genome Browser
Species Human (GRCh38)
Location 1:202166141-202166163
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920945_919920953 11 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920942_919920953 24 Left 919920942 1:202166094-202166116 CCAGGGCCCAAAGCCTTTTCTTC No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920947_919920953 -9 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920943_919920953 18 Left 919920943 1:202166100-202166122 CCCAAAGCCTTTTCTTCCATTCT No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920946_919920953 2 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920944_919920953 17 Left 919920944 1:202166101-202166123 CCAAAGCCTTTTCTTCCATTCTC No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data
919920941_919920953 25 Left 919920941 1:202166093-202166115 CCCAGGGCCCAAAGCCTTTTCTT No data
Right 919920953 1:202166141-202166163 GTCTGTAGGTGGGAGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr