ID: 919920956

View in Genome Browser
Species Human (GRCh38)
Location 1:202166155-202166177
Sequence GCACCTGGGTGAGCAGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920947_919920956 5 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data
919920951_919920956 -1 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data
919920946_919920956 16 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data
919920945_919920956 25 Left 919920945 1:202166107-202166129 CCTTTTCTTCCATTCTCACTCCT No data
Right 919920956 1:202166155-202166177 GCACCTGGGTGAGCAGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920956 Original CRISPR GCACCTGGGTGAGCAGCTCG GGG Intergenic
No off target data available for this crispr