ID: 919920958

View in Genome Browser
Species Human (GRCh38)
Location 1:202166165-202166187
Sequence GAGCAGCTCGGGGTGACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920951_919920958 9 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data
919920947_919920958 15 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data
919920946_919920958 26 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920958 1:202166165-202166187 GAGCAGCTCGGGGTGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920958 Original CRISPR GAGCAGCTCGGGGTGACTCA AGG Intergenic
No off target data available for this crispr