ID: 919920959

View in Genome Browser
Species Human (GRCh38)
Location 1:202166166-202166188
Sequence AGCAGCTCGGGGTGACTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919920946_919920959 27 Left 919920946 1:202166116-202166138 CCATTCTCACTCCTCATCCTCAG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data
919920947_919920959 16 Left 919920947 1:202166127-202166149 CCTCATCCTCAGCTGTCTGTAGG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data
919920951_919920959 10 Left 919920951 1:202166133-202166155 CCTCAGCTGTCTGTAGGTGGGAG No data
Right 919920959 1:202166166-202166188 AGCAGCTCGGGGTGACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919920959 Original CRISPR AGCAGCTCGGGGTGACTCAA GGG Intergenic
No off target data available for this crispr