ID: 919926228

View in Genome Browser
Species Human (GRCh38)
Location 1:202193263-202193285
Sequence GCTGCGGAGGGTTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919926228_919926234 -7 Left 919926228 1:202193263-202193285 CCTGCAGTGGAACCCTCCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 127
Right 919926234 1:202193279-202193301 CCGCAGCCTGGCCTCTTCCAGGG 0: 2
1: 0
2: 1
3: 22
4: 274
919926228_919926232 -8 Left 919926228 1:202193263-202193285 CCTGCAGTGGAACCCTCCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 127
Right 919926232 1:202193278-202193300 TCCGCAGCCTGGCCTCTTCCAGG 0: 2
1: 0
2: 2
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919926228 Original CRISPR GCTGCGGAGGGTTCCACTGC AGG (reversed) Intergenic
900516243 1:3083549-3083571 GCTGCGGAGGGATGCCCTGCAGG + Intronic
902660894 1:17902793-17902815 GCTGCTGAGGGCTCCCTTGCTGG - Intergenic
905019158 1:34796534-34796556 GCTGAGGATGGGCCCACTGCTGG + Intronic
909948503 1:81690897-81690919 GTAGCTGAGGCTTCCACTGCAGG - Intronic
912506332 1:110159217-110159239 GGTGCTGAGGGATCCACTGGGGG - Intronic
912927918 1:113929762-113929784 GCTGAGGAGGCTCCCCCTGCGGG + Exonic
914502623 1:148260603-148260625 GCTGCGGAGGCTGCTGCTGCTGG - Intergenic
915203420 1:154251145-154251167 GCTGTGGAGGTAGCCACTGCAGG - Exonic
919926228 1:202193263-202193285 GCTGCGGAGGGTTCCACTGCAGG - Intergenic
924384575 1:243489413-243489435 GCTGCGGAGGGTGCGAGAGCAGG + Intronic
1063161212 10:3420301-3420323 GCTGGGCAGGGCTCCCCTGCAGG + Intergenic
1065326570 10:24555077-24555099 CCTGCCCAGGGTTCCTCTGCTGG - Intergenic
1066523965 10:36255346-36255368 GCTGCGGAGGGTTCCACCTGTGG - Intergenic
1076014673 10:127018177-127018199 GCTGCGGAGGGCTGTCCTGCTGG + Intronic
1076701557 10:132275792-132275814 GCTGAGGAGGTTTCCGCTGAAGG - Intronic
1076916652 10:133425769-133425791 GCTGCGGTGCTGTCCACTGCCGG - Intergenic
1076936756 10:133570564-133570586 GCTGCGGTGCTGTCCACTGCCGG - Intergenic
1077352976 11:2101289-2101311 GCTGCCGAGGGGTCCAGTGAGGG - Intergenic
1083517440 11:63273469-63273491 GCTGGGGAGGCTTCCACCTCTGG - Intronic
1084319235 11:68364168-68364190 TCTGCAGAGGGGTCCTCTGCAGG - Intronic
1084831764 11:71774979-71775001 GCTGCGCAGGATCCCACGGCGGG - Intergenic
1088868927 11:113875335-113875357 GCTGCGGAGGGCGCCCCGGCCGG - Intronic
1091023390 11:132121130-132121152 GATGGGGAGGGTTTCACCGCAGG + Intronic
1093683421 12:22029678-22029700 GATGGGGAGGATTCCACAGCCGG + Intergenic
1097042373 12:56163599-56163621 GCTGGGGAGGGTCCCAGTGGTGG + Exonic
1097661445 12:62435536-62435558 GCTGCGGCAGGTGCCATTGCAGG + Intergenic
1100384214 12:94090947-94090969 GCTGAGGAGGTTCCCACTGGCGG + Intergenic
1101037484 12:100719443-100719465 TTTGCGGAGGGTTCCAGGGCTGG - Intronic
1104653691 12:130557251-130557273 GCTGTGGGGGGCTCCACTGCAGG - Intronic
1105018639 12:132801823-132801845 GCTGCTGCTGGTACCACTGCCGG + Exonic
1108663367 13:52606006-52606028 GCAGCAGTGGTTTCCACTGCAGG - Intergenic
1108686772 13:52826540-52826562 GCTGCGTAGGAGCCCACTGCGGG - Intergenic
1109881017 13:68476562-68476584 CTTGTGGAGGGTTCCTCTGCAGG - Intergenic
1112464853 13:99635052-99635074 GCTGCAGAGGGTGCCAGGGCTGG + Intronic
1112731182 13:102364713-102364735 GCTGTGGATGGTTCCAGTGAAGG - Intronic
1112889889 13:104216502-104216524 TCTGTGGAGTGTTCCACTTCTGG - Intergenic
1113015753 13:105826229-105826251 GCTGCTGTGGGTTCCTCTCCTGG - Intergenic
1113100691 13:106714324-106714346 GGTGAGGAGGGTCCCACTGAAGG - Intergenic
1113331081 13:109328351-109328373 GTTGCCCAGGGTTCTACTGCAGG - Intergenic
1113906312 13:113820868-113820890 GCTGCGGCGGGCTCCACGGGGGG + Exonic
1114069235 14:19094896-19094918 GCTAAGGGGGGTCCCACTGCGGG + Intergenic
1114367549 14:22046318-22046340 GCTGTGGAGGGTTCTCCTGAGGG + Intergenic
1118086778 14:62426716-62426738 GTTGCTGAAGGTTTCACTGCTGG - Intergenic
1119553355 14:75533708-75533730 TCTGTAGAGGGTTCCACTACGGG + Intronic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1121836177 14:97094200-97094222 GCTGGGGTGGGGTCCAGTGCTGG + Intergenic
1122015853 14:98796095-98796117 GCTGCGGAGGGTGACCCGGCAGG - Intergenic
1124238871 15:28013709-28013731 GCTCAGCAGGTTTCCACTGCCGG + Intronic
1125201069 15:37101061-37101083 TCTGCAGACGGTACCACTGCCGG + Intronic
1131509932 15:93044345-93044367 GCTGCTGTGGGTACCAGTGCAGG - Intronic
1132535331 16:476374-476396 GCTGAGGATGGTGCCCCTGCAGG - Intronic
1132626196 16:892743-892765 GCAGCGGAGGGTGCCCGTGCAGG + Intronic
1135254883 16:20933262-20933284 GGTGGAGAGGGTTCCTCTGCGGG + Exonic
1139964836 16:70739512-70739534 GCTGTGGAAGCTTCCAGTGCTGG + Intronic
1142294748 16:89213180-89213202 GCTGCGTAGCACTCCACTGCTGG + Intergenic
1145997682 17:29113903-29113925 GCTGCTGGGGGTGCCACTGTGGG - Intronic
1152743144 17:82027264-82027286 GCAGCGGAGGGTTCCACCCACGG - Intronic
1154281133 18:13004478-13004500 ACTGCGGACAGTTCCCCTGCGGG + Intronic
1161963082 19:7533644-7533666 GCTGCGGAAGGTTCGAGTCCCGG + Exonic
1163194174 19:15702980-15703002 GCTGGGGCTGGTACCACTGCTGG + Intergenic
1165465690 19:35973563-35973585 GCTGCTGTGGGTTCCCCTGCAGG - Intergenic
1166546044 19:43635455-43635477 GAGGCGGGGGATTCCACTGCAGG - Intronic
926636554 2:15185994-15186016 GCTGAGGTGGGATCCACAGCAGG + Intronic
926772761 2:16392934-16392956 ACTGCTGAGGGCTCCACTGGAGG - Intergenic
930755042 2:54965201-54965223 GAGGGAGAGGGTTCCACTGCTGG + Intronic
933759121 2:85662129-85662151 GCTGTGGAGGGTCCCTTTGCAGG + Intronic
935372599 2:102363476-102363498 TCTGGGTAGGGTTCCATTGCAGG - Intronic
936066228 2:109334539-109334561 GCGGGTGAGGGTTCCCCTGCTGG - Intronic
936541404 2:113355019-113355041 GCTGGGGAGGGTTCTAGTGGAGG + Intergenic
937264893 2:120609170-120609192 AGTGTGGAGGCTTCCACTGCAGG + Intergenic
947450986 2:230208747-230208769 GCTGGAGAGAGTTCCACAGCAGG - Intronic
948988934 2:241542019-241542041 GCTGCGGAGGGTTTGGCAGCGGG + Intergenic
1169089077 20:2846922-2846944 GCTGCTGAGATTTCCACTTCTGG + Intronic
1169351154 20:4869015-4869037 GCTGCTAAGGTTTCCACTACAGG + Intronic
1171169352 20:23001503-23001525 GGTGAGCAGGCTTCCACTGCAGG - Intergenic
1171293058 20:23993649-23993671 GCTGAGAAGGGTCACACTGCAGG + Intergenic
1174417220 20:50375432-50375454 ACTGAGTAGCGTTCCACTGCAGG - Intergenic
1176093981 20:63331199-63331221 GCAACAGATGGTTCCACTGCTGG + Intronic
1179150290 21:38804002-38804024 GCAGAGGAAGGTTCCACTGTCGG + Intergenic
1180487708 22:15817459-15817481 GCTAAGGGGGGTCCCACTGCGGG + Intergenic
1180824116 22:18851364-18851386 GCTGAGAAGGGTCACACTGCAGG + Intronic
1181124544 22:20694518-20694540 GCTGAGAAGGGTCACACTGCAGG + Intergenic
1181210579 22:21287309-21287331 GCTGAGAAGGGTCACACTGCAGG + Intergenic
1181398933 22:22639582-22639604 GCTGAGAAGGGTCACACTGCAGG - Intergenic
1181501662 22:23318928-23318950 GCTGAGAAGGGTCACACTGCAGG - Intergenic
1181650488 22:24256477-24256499 GCTGAGAAGGGTCACACTGCAGG + Intergenic
1181668620 22:24415040-24415062 GCTGGGGTGGGTTCCGGTGCTGG + Exonic
1181706893 22:24654261-24654283 GCTGAGAAGGGTCACACTGCAGG - Intergenic
1181861077 22:25818677-25818699 GCTGCAGAGACTTCCCCTGCAGG - Intronic
1203216369 22_KI270731v1_random:8121-8143 GCTGAGAAGGGTCACACTGCAGG - Intergenic
1203274256 22_KI270734v1_random:77268-77290 GCTGAGAAGGGTCACACTGCAGG + Intergenic
951024814 3:17817748-17817770 GCTGCGCAGGAGCCCACTGCAGG + Intronic
952893502 3:38060601-38060623 CCTGGGGAGAGTTCCACTGATGG + Intronic
953414250 3:42706425-42706447 CCTGCAGAGGGTTCCAATGAGGG + Intronic
953901405 3:46846022-46846044 TCTGCGGAGGCCTCCCCTGCAGG + Intergenic
961827399 3:129606315-129606337 GCTGCGGAGCGTGACACAGCGGG + Exonic
975324511 4:73044254-73044276 ACTGAGGAGGCTTCCACTTCTGG + Intergenic
976404034 4:84641722-84641744 GATCAGGAGGGTTCCACTGGAGG - Intronic
985191482 4:187378668-187378690 GCTTCAGGGGCTTCCACTGCAGG + Intergenic
985495444 5:202100-202122 GTTGAGGAGCGTTCCACTGTGGG + Exonic
985745120 5:1642525-1642547 GCTGGGGAGGGTCTCATTGCTGG - Intergenic
986106143 5:4661453-4661475 GCTGCCAAGGGTTCCTCTGGGGG - Intergenic
987070836 5:14335472-14335494 GCTGCGGAGGGGTCCACAGGTGG - Intronic
988566407 5:32322963-32322985 GCTGGTGAGGGCTCCACTCCAGG + Intergenic
990257521 5:53986554-53986576 ACTCCAGAGGGTTCCAATGCAGG + Intronic
995181060 5:109230651-109230673 GATGTGGAGGGTTGCACTGTGGG + Intergenic
1004903325 6:20212859-20212881 GCCGTAGAGGGTTCCTCTGCCGG + Intergenic
1008844876 6:55950593-55950615 GCTGCGCAGGAGCCCACTGCAGG - Intergenic
1013980633 6:116123519-116123541 GCTGCAGAGGATTCCACAGCTGG - Intronic
1015039099 6:128694758-128694780 GCTGCAGAGGGTTACAAAGCAGG - Intergenic
1016311189 6:142735282-142735304 GGGGCGGGGGGTTGCACTGCTGG + Intergenic
1016328653 6:142932686-142932708 GCTGGAGAGGGCTCAACTGCTGG + Intronic
1017674360 6:156797920-156797942 GCTGAGGAGAGTTCCACAGGGGG + Intronic
1017684807 6:156901501-156901523 GCTGCGGCTGGTACCTCTGCTGG - Exonic
1018899011 6:168041978-168042000 CCTGGGGAGGGTGGCACTGCAGG - Exonic
1019652223 7:2166151-2166173 GCTGCGGCGGGATCCCCTCCTGG - Intronic
1021840338 7:24717197-24717219 TCTGCTGAGGGATCCTCTGCTGG + Intronic
1024235181 7:47392390-47392412 GCTGCAGAGGGCTCCATTCCAGG + Intronic
1025253416 7:57367107-57367129 GCTGAGTAGTGTTCCATTGCAGG + Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1027050550 7:75018869-75018891 GCTGGGGAGGGCTCAGCTGCAGG - Intronic
1034980013 7:155469709-155469731 GCTGTGGAGGGTGCCACTGCTGG - Intergenic
1038571151 8:28663878-28663900 GCTGAGGAGGCTGCCATTGCTGG + Intronic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1047289041 8:123513150-123513172 CCTGTGGAGGGACCCACTGCCGG + Intronic
1048219246 8:132526390-132526412 GCTACTCAGGGTGCCACTGCAGG - Intergenic
1049709197 8:144056097-144056119 GATGTGGACGGGTCCACTGCGGG - Intronic
1055514190 9:77020263-77020285 GCTGCTGAGGCTGCGACTGCTGG - Exonic
1058930648 9:109715564-109715586 GCTGGGCTGGGTTGCACTGCAGG - Intronic
1060263272 9:122093640-122093662 ACTGAGGAGGGTCCCACTGGGGG - Intergenic
1062400927 9:136372313-136372335 GCTGCGGAGGGGCCCTCGGCTGG - Intronic
1189237458 X:39498216-39498238 GCTGCAGAGGGTCACACTGTAGG - Intergenic
1192191169 X:68992028-68992050 TTTCTGGAGGGTTCCACTGCAGG - Intergenic
1192759865 X:74085933-74085955 GCTGCTGCTGCTTCCACTGCTGG + Intergenic
1197946041 X:131840960-131840982 GCTGCCGAGGGGTCCGCAGCCGG - Intergenic