ID: 919927431

View in Genome Browser
Species Human (GRCh38)
Location 1:202199502-202199524
Sequence CGGCCGGGTGGGGCGGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919927417_919927431 10 Left 919927417 1:202199469-202199491 CCTCTCGGCTCTGGCAGCAGCGG 0: 1
1: 0
2: 1
3: 16
4: 151
Right 919927431 1:202199502-202199524 CGGCCGGGTGGGGCGGCTGGCGG 0: 1
1: 0
2: 3
3: 63
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919927431 Original CRISPR CGGCCGGGTGGGGCGGCTGG CGG Intronic
900000168 1:10476-10498 CGGGCGGGCGGGCCGGCTGAGGG - Intergenic
900019873 1:181006-181028 CGGGCGGGCGGGCCGGCTGAGGG - Intergenic
900109722 1:1000358-1000380 GCGCCGGGAGGGGCCGCTGGGGG + Intergenic
900109848 1:1000734-1000756 CGGCCGGGTCGGCAGGCGGGAGG + Intergenic
900212235 1:1461815-1461837 GGGCCGGGTGTGGCAGCTGCAGG - Intronic
900224907 1:1528473-1528495 GGGCCGGGTGTGGCAGCTGGAGG - Intronic
900228034 1:1541743-1541765 CGGCCCGGTGGGGAGGAGGGAGG + Exonic
900236649 1:1594803-1594825 AGGCTGGGTGGGGAGGCAGGTGG - Intergenic
900280501 1:1864498-1864520 CGGCAGGATGGGTCGGCCGGAGG - Intronic
900316092 1:2057148-2057170 CGGGCAGGTGAGGTGGCTGGTGG - Intronic
900460496 1:2800272-2800294 CGGGGAGGTGGGGCCGCTGGTGG + Intronic
900531196 1:3154280-3154302 CGGCGTGGTGGGGGGGCAGGGGG + Intronic
901138850 1:7014818-7014840 GGGCCGGGTGGGGGAGCGGGTGG + Intronic
901448570 1:9322860-9322882 CGGGCGGGTGGGGTGGGTGCGGG - Intronic
901555613 1:10029142-10029164 CTCCCGGGTGGGGTGGCTGCCGG - Intergenic
901762505 1:11479897-11479919 CGGCCGGGGAGGGCGCGTGGGGG + Intronic
902090636 1:13900318-13900340 GGGCAGGGAGGGGCTGCTGGAGG - Intergenic
902315761 1:15617393-15617415 CGGCGGGGCGGGGCGCCGGGCGG + Intergenic
902444395 1:16452774-16452796 GGGCTGGGCGGGGCGGCGGGCGG - Intronic
902549456 1:17210753-17210775 GGGCTGGCTGGGGCTGCTGGAGG - Intronic
903044199 1:20553465-20553487 CGGCCTTGTGGCGCGCCTGGTGG - Exonic
903263447 1:22143173-22143195 CGGCCGGGGGGGCGGGCCGGGGG + Intronic
903597143 1:24503172-24503194 GGGCGGGGCGGGGCGGGTGGGGG + Intronic
904078786 1:27858947-27858969 AGGGCGGCTGGGGCAGCTGGCGG - Intergenic
905166976 1:36088575-36088597 CGGTGGGGAGGGCCGGCTGGGGG + Intergenic
905192187 1:36243941-36243963 CTCCCGGATGGGGCGGCTGGCGG + Intronic
905395764 1:37665466-37665488 CGGCAGGGTGAGGAGGATGGGGG - Intergenic
905449384 1:38046928-38046950 CGGCCGGGCAGGGTGGCGGGCGG - Intergenic
905485375 1:38292408-38292430 CGGGCCGGTGGGGAGCCTGGGGG - Intergenic
905670110 1:39785809-39785831 AGGCTGGGTGGGGCGGTGGGGGG - Intronic
905670875 1:39789149-39789171 CGGCCGGGTGGCACCACTGGCGG - Intergenic
905699357 1:39999923-39999945 CTCCCGGATGGGGCGGCTGCCGG - Intergenic
905806350 1:40880374-40880396 CAGTGGGGTGGGGAGGCTGGGGG + Intergenic
905847211 1:41242529-41242551 AGGCCGCGTGGGGCTGGTGGAGG + Intergenic
905901075 1:41582285-41582307 CGTCCGTGTGGGGCAGGTGGGGG + Exonic
906125051 1:43422656-43422678 CGGGGGGGTGGGGGGGCGGGGGG - Intronic
906296252 1:44650800-44650822 GGGGCAGGTGGGGCTGCTGGAGG - Exonic
906615770 1:47232013-47232035 TGGCCGGGGGGGGCGGTGGGGGG - Intronic
906654330 1:47536890-47536912 GGGCTGCGTGGGGCGGGTGGGGG + Intergenic
907216622 1:52869980-52870002 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
907743867 1:57193216-57193238 GGACCGGGTGGGGTGGGTGGTGG - Intronic
908242412 1:62198520-62198542 CGGCGGGGTGGGGCGGCGGCGGG - Intronic
910758879 1:90716901-90716923 CGGCCGGCGGCGGCGGCTGCTGG + Exonic
910815715 1:91289057-91289079 CTCCCGGATGGGGCGGCTGCCGG + Intronic
913681091 1:121187226-121187248 AGGCCGGGTGCGGCGGCGGCTGG - Exonic
914032921 1:143974866-143974888 AGGCCGGGTGCGGCGGCGGCTGG - Intergenic
914156525 1:145093100-145093122 AGGCCGGGTGCGGCGGCGGCTGG + Exonic
914893780 1:151651297-151651319 CTCCCAGATGGGGCGGCTGGCGG + Intronic
914959784 1:152196122-152196144 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
914959806 1:152196169-152196191 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
915208411 1:154287760-154287782 CGCCCGGACGGGGCGGCTGCCGG - Intergenic
915913554 1:159928641-159928663 GGACTGGGTGGGGCTGCTGGAGG + Exonic
916050068 1:161029761-161029783 CTCCCGGATGGGGCGGCTGCCGG - Intronic
916694350 1:167221199-167221221 CGGCGGGGTGGGCCGGGTGCAGG - Intronic
916797272 1:168178928-168178950 CGTCCGGGTCGGCCGGCAGGGGG + Exonic
917869645 1:179229774-179229796 CGGCAGGGCGGGGCGGCAGCCGG - Intergenic
918265675 1:182839551-182839573 CGGGCGGCGGCGGCGGCTGGGGG + Intronic
919848298 1:201655444-201655466 GGGCCGGGTGGGGAGGTAGGGGG + Intronic
919927431 1:202199502-202199524 CGGCCGGGTGGGGCGGCTGGCGG + Intronic
920468403 1:206205750-206205772 GGGCCGGGTGCGGCGGCGGCTGG - Intronic
921089693 1:211830763-211830785 TGGCGGGGAGGGGCGGCGGGAGG + Exonic
921109103 1:212015062-212015084 CTCCCGGATGGGGCGGCTGCCGG - Intronic
923127065 1:231041185-231041207 TCGCCGCGGGGGGCGGCTGGGGG + Intergenic
1062962780 10:1585886-1585908 TGGCTGGGTGGGGTGGCGGGCGG + Intronic
1063776675 10:9273166-9273188 CTCCCGGAAGGGGCGGCTGGCGG + Intergenic
1063776763 10:9273365-9273387 CTCCCGGAAGGGGCGGCTGGCGG + Intergenic
1063955013 10:11257565-11257587 TGGCAGGGTGGGGCGCATGGAGG + Intronic
1063967790 10:11360328-11360350 GGGCTGGGTGGGGAGGATGGAGG - Intergenic
1064948403 10:20818294-20818316 TAGCTGGGTGGGGGGGCTGGGGG + Intronic
1065025448 10:21535290-21535312 CGCCAGTGTGGGGAGGCTGGGGG + Intronic
1065069096 10:22003619-22003641 CGGGCGGGTGGGTAGGCGGGCGG + Exonic
1065100399 10:22325639-22325661 CGGGCGTGCGGGGCGGCGGGCGG - Intronic
1065712872 10:28533652-28533674 CGGCGGGGGGCGGCGGCGGGGGG + Intronic
1066126332 10:32346592-32346614 CGGCCGGGGGTCGAGGCTGGGGG + Intronic
1066190677 10:33052910-33052932 AGGCAGGATGGGGTGGCTGGGGG + Intergenic
1066382202 10:34911325-34911347 CGGGGGGGGGGGGCGGGTGGGGG - Intergenic
1067066233 10:43105675-43105697 CTGCTGGGTGGGCCGGCTGCAGG - Intronic
1067175609 10:43943539-43943561 TGGCCGGGTGGGGAAGCTCGGGG + Intergenic
1067872104 10:49970682-49970704 CTCCCGGATGGGGTGGCTGGCGG - Intronic
1069699602 10:70412388-70412410 CGGCCGGGGGGTGGGGGTGGGGG + Intronic
1070162541 10:73874646-73874668 CGGGCGGGGGGGGGGACTGGCGG - Intergenic
1070629670 10:78075939-78075961 CTCCCGGATGGGGCGGCTGCTGG + Intergenic
1072421112 10:95291101-95291123 AGGACGGGCGGGGCGGCGGGCGG - Intergenic
1073019575 10:100431843-100431865 AGGCCGGGTGGGGGGGGGGGGGG - Intergenic
1073076427 10:100827856-100827878 AGGCGGGGAGGGGCGGCAGGCGG - Exonic
1073208139 10:101779506-101779528 CGGCCGGTTGGGGCGCCCCGCGG - Intronic
1075206405 10:120453171-120453193 TGGCGGGGTGGGGTGGCGGGTGG + Intergenic
1076683732 10:132187487-132187509 CGGTCGGGTGGCGAGGCGGGCGG + Intronic
1076829204 10:132985809-132985831 AGACAGGGTGGGGCTGCTGGGGG + Intergenic
1076874170 10:133207890-133207912 GGGGCTGGTGGGGCGGCCGGGGG - Intronic
1076978922 11:195152-195174 CGTCCGGAGGGGGCGTCTGGAGG + Intronic
1077504642 11:2924372-2924394 CCGCAGGGTGGGGCGGCTGGAGG + Intronic
1077778219 11:5294664-5294686 CGGCCGGTGGGGCCGGCTGGCGG + Intronic
1077839688 11:5961065-5961087 CTCCCGGATGGGGCGGCTGCCGG - Intergenic
1078087604 11:8243549-8243571 CAGCAGGGTGGGCCGGCTGCTGG + Intronic
1080860289 11:36145224-36145246 CTCCCGGACGGGGCGGCTGGCGG - Intronic
1081406553 11:42705432-42705454 CGGCGGGATGGGGCGGTGGGGGG - Intergenic
1081700028 11:45146970-45146992 GGGCCGGGAGCGGCGGCTGGGGG + Intronic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1081907930 11:46680986-46681008 GAGGCGGGTGCGGCGGCTGGGGG - Intronic
1083272912 11:61580986-61581008 CGGGCGGGCGGGAGGGCTGGCGG - Intronic
1083595886 11:63918113-63918135 CGGGTGGGAGGGGCGGCGGGCGG - Intergenic
1083933277 11:65857576-65857598 CGCCCGGGAGGGGCGGGTGCTGG - Intronic
1083989706 11:66239311-66239333 CAGCCGGGTGGGCCTGATGGAGG - Intronic
1084165374 11:67372849-67372871 CGGCAGGTAGGGGCGGCGGGCGG - Intronic
1084433969 11:69127244-69127266 CGGCCGGGTGGGTGGGTGGGGGG + Intergenic
1085022543 11:73218431-73218453 AGGTGGGGTGGGGCGTCTGGAGG + Exonic
1085455104 11:76661157-76661179 CGGCCTGCTGGAGCGGCTGCTGG - Exonic
1087811162 11:102610359-102610381 GGGCGGGGCGGGGCGGCGGGGGG + Intronic
1089073882 11:115721618-115721640 CCCCCTGGTGGGGCTGCTGGGGG + Intergenic
1089148553 11:116347402-116347424 CTCCCGGATGGGGCGGCTGCCGG - Intergenic
1089346979 11:117796972-117796994 GGCCAGGGTGGCGCGGCTGGCGG - Intronic
1089498231 11:118918494-118918516 CCGCAGGGTGGGGCGGGTGGGGG + Intronic
1089520430 11:119059304-119059326 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1089573203 11:119423275-119423297 CGGCAGGGTGGGGTGGGGGGTGG + Exonic
1089876081 11:121723237-121723259 GGGCCGGGTGGGGAGGGTGGAGG - Intergenic
1090323069 11:125863414-125863436 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1090387582 11:126365707-126365729 CAGGCTGGTGGGGCAGCTGGAGG + Intronic
1091207746 11:133833001-133833023 CTGCGGGGAGGGGCGGCGGGAGG + Intergenic
1091373251 12:10593-10615 CGGGCGGGCGGGCCGGCTGAGGG - Intergenic
1091550198 12:1530723-1530745 CGGCCGGGGCGCGGGGCTGGCGG - Intronic
1092258042 12:6937567-6937589 CGGCCAGGTGGGGCGGAGGTGGG + Intronic
1092331418 12:7590176-7590198 CTCCCGGATGGGGCGGCTGGCGG + Intergenic
1092453601 12:8625288-8625310 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1092743263 12:11649948-11649970 GGGCGGGGCGGGGCGGCCGGCGG - Exonic
1095439550 12:42227865-42227887 CTCCCGGACGGGGCGGCTGGCGG - Intronic
1095533963 12:43224417-43224439 GGGCCGGTGGGGCCGGCTGGTGG - Intergenic
1096977476 12:55707814-55707836 CGGGCGGGCGGGAGGGCTGGCGG - Intronic
1096983609 12:55743117-55743139 CGGCCGGGGCGGGCGGCTGGGGG - Intergenic
1097222629 12:57460038-57460060 CGGCGGGCTGGGCCGGCGGGAGG + Intergenic
1097228605 12:57495231-57495253 CTCCCGGACGGGGCGGCTGGCGG + Intronic
1097779559 12:63686918-63686940 TGGCCGGACGGGGCGGCTGCCGG - Intergenic
1098626608 12:72678778-72678800 CGGCAGGGTGGGGAGGGTGTTGG - Intergenic
1101302316 12:103495390-103495412 GGGCCGGGCGGAGCGGTTGGGGG - Intronic
1101302359 12:103495474-103495496 CGGCCGGGTGGGGAGGGCGGCGG + Intronic
1101443865 12:104723356-104723378 CGGGCGGGGTGGGCGTCTGGGGG + Intronic
1102870798 12:116412504-116412526 CGGCCGGGTGCGGTGGCTCACGG - Intergenic
1103775670 12:123364848-123364870 CGGCGGGGCGGGGGGGCTGGGGG - Intergenic
1103779446 12:123389232-123389254 TGGCCGGGCCGGGCGGCGGGAGG + Intronic
1104376145 12:128267009-128267031 CCGCCGGGAGGGGCGGCAGATGG - Intergenic
1104376261 12:128267330-128267352 CGGCCGGCGGGGGCCGCGGGCGG + Intergenic
1104444738 12:128823950-128823972 CGGCGGGGCGAGGCAGCTGGCGG - Exonic
1104850808 12:131872626-131872648 GGGCCTGGTGGAGAGGCTGGCGG + Intergenic
1106799515 13:33242184-33242206 CTCCCGGATGGGGCGGCTGCTGG - Intronic
1107831091 13:44374151-44374173 CGGCGGGGTGGGGCGGAAGGTGG + Intronic
1107872497 13:44760224-44760246 TGGCCAGGTCAGGCGGCTGGTGG - Intergenic
1108864487 13:54905947-54905969 CGGCCAGGTGGGGTGGCTCACGG - Intergenic
1110064554 13:71087507-71087529 CGGGCGGGGGGGGGGGGTGGGGG - Intergenic
1110219661 13:73059528-73059550 CGGGCGGCTGGGCCGGCTGCGGG - Exonic
1110707171 13:78609012-78609034 CGGGAAGGAGGGGCGGCTGGCGG - Intergenic
1111940549 13:94602131-94602153 GGGCCGGGAGGAGCGGCCGGCGG - Intronic
1112344416 13:98577454-98577476 GGGCGGGGTGGGCTGGCTGGCGG - Intronic
1112590869 13:100762235-100762257 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1113656726 13:112072505-112072527 CGGCGGGGTGGGGCGGCGTCAGG + Intergenic
1113929893 13:113962667-113962689 CTGCCCAGTGGGGCTGCTGGTGG - Intergenic
1114536341 14:23425382-23425404 CGGGCTGCTGGGGCTGCTGGAGG - Exonic
1114604921 14:23988771-23988793 CTGCGGGGCGGGGCGACTGGCGG + Intronic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1115028147 14:28766484-28766506 CGGCGGGGTGGAGGGGGTGGCGG + Intergenic
1115769598 14:36656061-36656083 TGGCCGGGAGAGGCGGCTGGGGG + Intergenic
1117029196 14:51651777-51651799 CGGCCAGTTGGGGCGGGTCGGGG + Intronic
1117253632 14:53956954-53956976 AGGCGAGGTCGGGCGGCTGGAGG - Intronic
1117837151 14:59819427-59819449 TGGCCGGGGGGGGGGGGTGGGGG - Intronic
1119519747 14:75277276-75277298 CTCCCGGGCGCGGCGGCTGGAGG + Intergenic
1119603630 14:75995550-75995572 CGGCCGAGTGAGGCTGCTGGGGG - Intronic
1120953353 14:90061716-90061738 GGGCGGGGCGGGGCGGCGGGGGG - Intergenic
1121162884 14:91761424-91761446 AGGCCGAGGTGGGCGGCTGGCGG + Intronic
1121330504 14:93046591-93046613 GGGCGGGGGGGGGCGGCGGGGGG + Intronic
1121412490 14:93757550-93757572 CGGCCTGGGGTGGGGGCTGGAGG + Intronic
1121449174 14:93996730-93996752 CGGCAGGGTGGTGCGTGTGGTGG + Intergenic
1122151987 14:99730487-99730509 CGGCCGGGAGGCGCGCCGGGCGG + Intergenic
1122181127 14:99955572-99955594 GGGTAGGGTGGGGGGGCTGGGGG + Intergenic
1122388646 14:101365423-101365445 CATCAGGGTGAGGCGGCTGGTGG + Intergenic
1122626928 14:103089657-103089679 CGGCCGTGTTGGTCGGCGGGGGG - Intergenic
1122754770 14:103969821-103969843 GGGCGGGGTGGGGGGGCTGTGGG + Intronic
1122905783 14:104800840-104800862 CGGAGGCGTGGGGCGGGTGGCGG + Intronic
1124022723 15:25939031-25939053 CGGGGGGGGGGGGCGGCGGGGGG - Intergenic
1124025264 15:25959784-25959806 AGGTAGGGTGGGGTGGCTGGTGG + Intergenic
1125019042 15:34967172-34967194 GGGCCGGGTGCGGTGGCTTGTGG - Intronic
1125535877 15:40441082-40441104 CGGCCGGGCGGGGCCGTCGGGGG - Intronic
1125665427 15:41426699-41426721 CGGCGGGGGGGGGGGGCGGGGGG - Intronic
1125727915 15:41877511-41877533 CGGCCGGCTGGAGCCGATGGGGG - Intronic
1125742038 15:41972163-41972185 CGGCCGGGAGGGGCAGCGGCGGG + Intronic
1125742100 15:41972467-41972489 CAGCTGGATGGGGCGGCAGGCGG - Exonic
1125861614 15:43005306-43005328 CTCCCGGATGGGGCGGCTGCCGG - Intronic
1126335954 15:47586770-47586792 CTGCCGGGTGGGGTGGGGGGTGG - Intronic
1126573201 15:50172943-50172965 CTCCCGGATGGGGCGGCTGCCGG - Intronic
1127269200 15:57385731-57385753 CCCCCGGGTGGGGAGGTTGGGGG - Intronic
1127281530 15:57497373-57497395 GAGCAGGGTGGGGCGGGTGGTGG + Intronic
1127488178 15:59438213-59438235 CGGCTGGGTGCGGCGGCCGCTGG - Exonic
1127763792 15:62165337-62165359 CCTCCGGGTTGGGCCGCTGGCGG - Intergenic
1128146570 15:65335247-65335269 AGGCCAGGTGGGGAGGTTGGGGG + Intronic
1128149631 15:65355138-65355160 CAGCGGAGTGGGGCGGGTGGGGG + Intronic
1128385207 15:67142815-67142837 GGGCCCTGTGGGGCAGCTGGTGG + Exonic
1129808980 15:78490913-78490935 TGGCGGGGTGGGGAGGCGGGGGG + Intronic
1130056042 15:80526971-80526993 GGGCAGGGTGGGATGGCTGGGGG - Intronic
1130908935 15:88257739-88257761 CTGCCGGGTGAGGGGGCGGGCGG + Intergenic
1130946261 15:88552598-88552620 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1131001415 15:88941904-88941926 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1131053496 15:89362677-89362699 GGCGCGGGTGGGGCGGCTGTGGG - Intergenic
1131200080 15:90388524-90388546 CGTCCCGGTGGGGCGGCGGGCGG + Intronic
1131753227 15:95532425-95532447 CAGCCTGGTGGGAGGGCTGGGGG - Intergenic
1132055873 15:98649793-98649815 CGGCGGGGTGGGGCGCAGGGCGG + Intronic
1132251959 15:100341265-100341287 CGGGCGCGCGGGGCGGCTGGGGG + Exonic
1132894165 16:2219982-2220004 CTCCCGGATGGGGCGGCTGAAGG + Intergenic
1133213109 16:4273785-4273807 CGGCAGGGAGGGGAGGGTGGAGG + Intergenic
1133285512 16:4688832-4688854 AGGCCAGGTGGGGCTGGTGGTGG - Exonic
1133463014 16:6003468-6003490 GGGCCGGGTGGGAGGGGTGGTGG - Intergenic
1133711250 16:8403331-8403353 CGGCGGGGTGGAGAGGTTGGGGG + Intergenic
1134036062 16:11032317-11032339 GAGCCGTGTGGGGCTGCTGGGGG + Intronic
1135620652 16:23952526-23952548 TGGGAGGGTGGGGCGACTGGAGG + Intronic
1135694299 16:24574128-24574150 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1136477843 16:30524528-30524550 CCGCCGCGTGGGTCCGCTGGTGG + Exonic
1136593659 16:31232591-31232613 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1136593737 16:31232767-31232789 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1137283979 16:47000523-47000545 CTCCCGGATGGGGCGGCTGGCGG - Intergenic
1137561148 16:49503203-49503225 TGGGCAGGTGGGGCTGCTGGAGG - Intronic
1139364859 16:66427112-66427134 CGGCCGGGCGGGGCTGCGGCAGG + Intergenic
1140440634 16:74985011-74985033 CGGCCGGGCGGGGGAGATGGCGG - Exonic
1141472233 16:84246881-84246903 TGGCGGGGTGGGGCGGTGGGGGG + Intergenic
1141531326 16:84648704-84648726 CGGCCGGGGCGGGGAGCTGGCGG + Intronic
1141538641 16:84700453-84700475 CGGCCGGGGGAGGCGGCCCGGGG + Intronic
1141910729 16:87056853-87056875 GGGCCGGGTAGGGCGGGAGGAGG + Intergenic
1141993394 16:87622739-87622761 CGGCAGGGTGGGGCGGGGGGGGG - Intronic
1142009833 16:87708312-87708334 CTGGCGGGTGGCGCGGCTGCTGG - Intronic
1142130788 16:88430656-88430678 CCGGCGGCTGGGGCGGCGGGCGG + Intronic
1142175563 16:88643457-88643479 CGGCCGGGGGCCGCGGCGGGGGG + Exonic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142332335 16:89462869-89462891 CTCCCGGATGGGGCGGCTGCTGG - Intronic
1142335852 16:89489744-89489766 CGGCCGTGAGGGGCGGACGGGGG - Intronic
1142466412 17:139970-139992 CGTCCGGAGGGGGCGTCTGGAGG + Intergenic
1142518735 17:490287-490309 CGGGCGGGGGGGGCGCCTGGAGG - Intergenic
1142671941 17:1491552-1491574 CGGCCGCGGGGGGCGGGTGTGGG - Intronic
1142705227 17:1689802-1689824 CTCCCGGATGGGGCGGCTGGTGG + Intergenic
1142705251 17:1689851-1689873 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1143016378 17:3893095-3893117 CGGCCGGGCGCGGCGGTGGGCGG - Intronic
1143030351 17:3964088-3964110 GAGCCGGGTGGGGAGGCAGGAGG + Intronic
1143149812 17:4800931-4800953 AGGCAGGCTGGGGTGGCTGGGGG - Intergenic
1143389826 17:6553740-6553762 TGGCGGGGTGGGGCGGCGGGGGG - Intronic
1143627506 17:8118889-8118911 CGGCCGCGCGGGGCCGCTGCGGG - Exonic
1143884848 17:10057646-10057668 CTCCCGGACGGGGCGGCTGGCGG - Intronic
1144021082 17:11240788-11240810 CTGCGGGGCCGGGCGGCTGGGGG + Intergenic
1144851176 17:18244719-18244741 CGGCGGGGGGGGGGGGCAGGGGG + Exonic
1145418173 17:22741440-22741462 CTCCCGGATGAGGCGGCTGGCGG - Intergenic
1145811223 17:27765475-27765497 CAGCCAGGTGGGGCGGCCAGAGG + Intronic
1146009187 17:29180221-29180243 CGGCCGGGAGGGAGGGCGGGCGG - Intronic
1146022513 17:29292597-29292619 AGGCCTGGGGGGGCGGCGGGGGG - Intronic
1146062400 17:29614146-29614168 AGGACGGGTGTGGGGGCTGGGGG - Exonic
1146219878 17:31008835-31008857 CCGCCGGGTGGGCGAGCTGGCGG + Intergenic
1146403699 17:32519604-32519626 CGGCCGGCCGGGGCTGCGGGGGG - Intronic
1146913821 17:36665359-36665381 AGGCCGGGTGAGGGGGCTGAAGG - Intergenic
1147002611 17:37374913-37374935 CGGCCGGCTGGGGTGGCTCACGG + Intronic
1147184254 17:38705193-38705215 CGGCCGGGCAGGGGGGCCGGGGG + Intergenic
1147238090 17:39072290-39072312 CTGCTGGGTGGGGAGGCAGGGGG - Intronic
1147670846 17:42176011-42176033 CACCCTGGTGGGTCGGCTGGGGG - Intronic
1147705638 17:42423121-42423143 CGGCCGGGTGGGGCTGGAGCTGG + Exonic
1147722425 17:42547284-42547306 GGGCCTGCTGGGGCCGCTGGGGG + Intergenic
1147723607 17:42553455-42553477 GGGCCTGCTGGGGCCGCTGGAGG + Exonic
1147966968 17:44199164-44199186 CGGCCGGCCGGGGCTGCTGGCGG - Intronic
1148080995 17:44967757-44967779 CGGCCCTGTGGGGCCGCCGGGGG - Exonic
1148124976 17:45231811-45231833 CGGCGGGGAAGGACGGCTGGAGG - Intronic
1148178135 17:45585044-45585066 GGGCCGGGTGGGGAGGCCAGAGG + Intergenic
1148262123 17:46193129-46193151 CGGCCGGGAGGGCGGGCGGGCGG + Intronic
1148685377 17:49497679-49497701 CGTCCCGGCGGGTCGGCTGGCGG + Intronic
1148786578 17:50148887-50148909 CGGCGGGGCGGGGCAGCAGGCGG + Intronic
1149031988 17:52094138-52094160 CTGCGGGGTGTGGGGGCTGGGGG + Intronic
1149485523 17:57039795-57039817 TGGCTGGGAGGGGAGGCTGGAGG - Intergenic
1149575063 17:57706000-57706022 GGGGTGGGTGGGGAGGCTGGAGG + Intergenic
1149592989 17:57846177-57846199 CTCCCGGACGGGGCGGCTGGCGG - Intronic
1149981346 17:61313885-61313907 CGGGCGAGTGGGGCTGGTGGAGG - Intronic
1150408032 17:64919334-64919356 GGGCCGGGTGGGGAGGCCAGAGG + Intronic
1150675814 17:67245277-67245299 CGGGCGGGAGGCGCGGCCGGAGG - Intronic
1150747183 17:67825628-67825650 GGGCCGGGTGGGGAGGCCCGCGG - Intronic
1150778720 17:68101881-68101903 CTGGCGGCTGGGGCGGCGGGCGG - Intergenic
1150802188 17:68291298-68291320 CGGCCGGGGTGGGGGGCGGGGGG - Intronic
1151155393 17:72120802-72120824 CGGTAGGGTGGGGGGGCGGGGGG - Intergenic
1151555172 17:74843018-74843040 CGGCCGGATCGGTCGGCTCGAGG + Exonic
1151673886 17:75588369-75588391 CGGCCGCGGGGGGCGCCTGGAGG + Intergenic
1151718425 17:75843070-75843092 AGGCCTGGTGGGGAGGCAGGCGG + Exonic
1151765775 17:76132574-76132596 CGGGCGGGGGGGGAGGATGGGGG - Intergenic
1151866422 17:76806241-76806263 CGGCGGGGCCGGGGGGCTGGCGG - Intergenic
1151890442 17:76948096-76948118 CGGCTGGGTGGGGAGGGTGGGGG - Intronic
1151933342 17:77247013-77247035 CGGCCGGGAGCGGGGGCAGGGGG + Intergenic
1152336014 17:79700571-79700593 GGGCAGGGTGGGGGAGCTGGAGG + Intergenic
1152364824 17:79849582-79849604 GGGACGGGTGGGGATGCTGGTGG - Intergenic
1152462833 17:80450302-80450324 AGGCAGGGTGGGAGGGCTGGCGG + Intergenic
1152476883 17:80524146-80524168 GGGCCGGGTGGGGGGGACGGCGG + Intergenic
1152572979 17:81128595-81128617 GGGCCGGGTGAGGAAGCTGGGGG - Intronic
1152649985 17:81488272-81488294 CTGCCGGGTGGAGAGGCTGGGGG + Intergenic
1152690406 17:81715410-81715432 GGGCCGGGTGGCGAGGCTGAGGG + Intronic
1152716238 17:81902156-81902178 GGGCCGGGAGGGGCGGCGGGCGG - Exonic
1152782139 17:82231264-82231286 CGGGCCGGAGGGACGGCTGGAGG - Intronic
1152800332 17:82327940-82327962 GGGCAGGGTGGGGGGGCTGGTGG - Intronic
1152924041 17:83079535-83079557 GGGCGGGGCGGGGCGGCGGGTGG + Intergenic
1152924590 17:83081151-83081173 CGGCCGAGCGGGGCCGCGGGCGG + Intronic
1153285203 18:3450108-3450130 GGGACGGGGCGGGCGGCTGGGGG + Intronic
1153900487 18:9614160-9614182 CGGCCGGGGAGGGCGGGCGGCGG - Intronic
1153911182 18:9708054-9708076 GGGCCGGGAGGGGCGGATGCCGG + Intergenic
1154990207 18:21592571-21592593 CTCCCGGACGGGGCGGCTGGTGG + Intronic
1157095270 18:44680783-44680805 CAGCCGGCTGGCGGGGCTGGCGG + Intronic
1157332685 18:46714985-46715007 CGGCCGGCTGAGGCTGCTGGTGG - Intronic
1157687033 18:49650948-49650970 CCGGCAGGTGCGGCGGCTGGGGG + Intergenic
1158098679 18:53804699-53804721 CTGGCGGATGGGGCGGCTGTAGG + Intergenic
1158277094 18:55780398-55780420 CGGCCGCGAGGCGGGGCTGGAGG - Intergenic
1158643120 18:59220102-59220124 AGCCCGGGCGGGGGGGCTGGGGG - Intergenic
1158869934 18:61676422-61676444 CGGGGGGGTGGGGCGGTTGGGGG - Intergenic
1159670141 18:71212510-71212532 GGGCGGGGCGGGGCGGCGGGGGG + Intergenic
1159670158 18:71212539-71212561 CGGCGGGGCGGGGCGGCGGGGGG + Intergenic
1159670170 18:71212559-71212581 GGGCGGGGCGGGGCGGCGGGGGG + Intergenic
1159670182 18:71212579-71212601 GGGCGGGGCGGGGCGGCGGGGGG + Intergenic
1159798182 18:72868051-72868073 CGGCCGGGGGGGGGGCCGGGGGG + Intronic
1160036996 18:75310580-75310602 CTGTCGGGTAGGGCAGCTGGTGG - Intergenic
1160685061 19:430808-430830 GGGCCGGGCGGGGAGACTGGGGG - Intronic
1160693383 19:470661-470683 CTGCTGGGAGGGGCGGCTGGAGG - Intronic
1160715675 19:575524-575546 CGGCCGGTGGGGGTGGGTGGGGG + Intronic
1160783875 19:890927-890949 CGGCCGGGAGGGGAAGCAGGTGG + Intronic
1160792631 19:929619-929641 CGGCCGGGGGGTGCAGCAGGGGG - Exonic
1160872990 19:1285610-1285632 GGGCCGGGTGGAGCGCGTGGGGG + Intergenic
1160882056 19:1325367-1325389 CGGCGGGGGGCGGCGGCCGGGGG + Intergenic
1160928131 19:1556654-1556676 CTACCGGGTGGTGGGGCTGGTGG - Exonic
1160994028 19:1873567-1873589 CTCCCGGGTAGGGCGCCTGGGGG - Intergenic
1161088168 19:2344504-2344526 CGGCCGGGTGAGGGTCCTGGAGG + Intronic
1161306614 19:3572585-3572607 CTGCCGGATGGGGCGACCGGCGG - Intronic
1161494960 19:4581578-4581600 CGGCTGGGGAGGGGGGCTGGGGG + Intergenic
1161513281 19:4683309-4683331 CGGCCCCGTGGGGCTGCTGCAGG + Intronic
1161692979 19:5748052-5748074 TGGCCGGGTGGGTTGGGTGGTGG + Intronic
1161779142 19:6279704-6279726 GGGCCGGGCGGGCCGGCGGGCGG + Intronic
1161790205 19:6355547-6355569 CTCCCGGGTGGGGTGGCTGTCGG - Intergenic
1162035098 19:7934283-7934305 CGGCCGGGGGGCGGGGCAGGAGG + Intronic
1162064424 19:8116637-8116659 CGGTGGGGCGGGGCGGGTGGAGG - Intronic
1162329470 19:10018747-10018769 GGGCCTGGTGGGGCCCCTGGAGG + Exonic
1162779335 19:12998504-12998526 CGGCCGGGTGGGGCGGTTCCTGG + Intronic
1162931838 19:13961363-13961385 GGCCTGGGTGGGGAGGCTGGGGG - Exonic
1163138756 19:15332303-15332325 CGGCCGGCGGGGGCGGCGTGCGG - Intronic
1163158147 19:15449960-15449982 CGGGGGGGCGGGGCGGCGGGGGG - Intergenic
1163484226 19:17576782-17576804 GGGCTGAGTGGTGCGGCTGGGGG + Intronic
1164280270 19:23762853-23762875 CTGCCGAGCGGGGCGGGTGGTGG + Intergenic
1164834829 19:31350082-31350104 GAGCCGGGTGGGGCAGCTGGGGG - Intergenic
1165305449 19:35000331-35000353 CGGGCGGTTGGGTCGGGTGGGGG + Exonic
1165751855 19:38265003-38265025 GGGCCGGGCGGGTAGGCTGGAGG + Intronic
1165934413 19:39380675-39380697 CGGCCGGGTGGGAGGGCCCGGGG - Exonic
1165994453 19:39833989-39834011 GGGACGGGTGGGGCGGCAAGCGG - Intronic
1166162898 19:40966107-40966129 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1166301297 19:41913426-41913448 CGTCCGGGTGGGGCGGGTGTGGG - Intronic
1166367424 19:42284537-42284559 CCCCCGCGTGGGGCGGCCGGAGG + Intronic
1166373167 19:42313577-42313599 CCGCCAGGAGGGGCGGCAGGGGG - Intronic
1166373976 19:42316755-42316777 CGTGCTCGTGGGGCGGCTGGTGG + Intronic
1166765761 19:45251540-45251562 CGGCCGGGTGGGGGGGGCGGGGG - Exonic
1166807214 19:45494581-45494603 CAGCGGGGTGGAGCTGCTGGTGG + Exonic
1166979347 19:46623637-46623659 CGGCCTGGTGGCCCTGCTGGTGG - Exonic
1167120776 19:47515147-47515169 GGGCGGCGTGCGGCGGCTGGTGG - Exonic
1167393149 19:49210371-49210393 GGGCCGGGGAGGACGGCTGGGGG - Exonic
1168309881 19:55455087-55455109 CAGCCAGGTGGACCGGCTGGTGG - Exonic
1168370629 19:55831104-55831126 CGGGGGGGTGGGGGGGATGGGGG - Intronic
1168528421 19:57106638-57106660 CGGGCGGGCGGGGGGGGTGGGGG - Intergenic
925694048 2:6555694-6555716 CGGACGGGTGGGAAGGCTAGAGG - Intergenic
926095868 2:10080302-10080324 CGGCCGGGGCGGGCTGCAGGGGG + Exonic
926165654 2:10521130-10521152 AGGCCAGGAGGGGAGGCTGGAGG + Intergenic
926728126 2:16014334-16014356 CGGTGGGGTGGGGGAGCTGGTGG - Intergenic
926794441 2:16607304-16607326 AGGCAGGGAGGGGCGGGTGGGGG + Intronic
926901117 2:17753437-17753459 CGGGCGGGTCGGGCGGCCGGCGG - Intronic
927156761 2:20225197-20225219 GGGCCGGGAGGGGTGGCTGGGGG - Intronic
928602437 2:32916198-32916220 CGGGCGGGCGGGGCTGCGGGGGG + Intergenic
929452697 2:42047860-42047882 AGGCCGGGCCGGGCGGCCGGAGG + Intergenic
929515925 2:42605487-42605509 CTCCCGGACGGGGCGGCTGGCGG + Intronic
929515949 2:42605536-42605558 CTCCCGGACGGGGCGGCTGGCGG + Intronic
930259093 2:49124273-49124295 CGGCCGGGTGTGGTGGCTCATGG - Intronic
931029453 2:58155752-58155774 CGGCGGGGTGGGGGGGATGGTGG - Intronic
931206267 2:60148945-60148967 CGGCATGGTGGGGAGGCTGGGGG - Intergenic
931348732 2:61470531-61470553 CGGCCGGGCCGGGCGGCGTGCGG - Intronic
931584273 2:63809182-63809204 CTCCCGGGCGGGGCGGCTGCCGG - Intronic
931762597 2:65431284-65431306 CTGCGGGGTCGGGCGGCTCGGGG - Intronic
932621725 2:73268916-73268938 GGGCCAGGTGGGCCGGCTGCAGG - Exonic
932718978 2:74124141-74124163 CTCCCAGATGGGGCGGCTGGCGG - Intergenic
932761714 2:74442183-74442205 TGCCAGGTTGGGGCGGCTGGCGG - Intronic
932812281 2:74835058-74835080 CTGCCGCGTGGGGCCGCCGGGGG + Intronic
933647034 2:84821306-84821328 AGGCTGGGTGGGGGGGTTGGGGG - Intergenic
934309756 2:91852107-91852129 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
935009680 2:99121744-99121766 TGGCCGGGTGTGGTGGCTCGTGG - Intronic
936007744 2:108905851-108905873 CCGCTGGGAGGGGAGGCTGGAGG + Intronic
936217991 2:110576892-110576914 CGGCCGGGGGGGGAGGGGGGGGG - Intronic
936283420 2:111162139-111162161 CGGCCGGCTGGAGCTGCTGTTGG - Intronic
937439843 2:121906333-121906355 CGGCAGGGTGGGGCGGGGAGTGG - Intergenic
937857485 2:126682947-126682969 CGGCAGGGTGTGTCTGCTGGGGG + Intronic
938828918 2:135033544-135033566 CTCCCGGACGGGGCGGCTGGCGG + Intronic
938836249 2:135106072-135106094 CTCCCGGATGGGGCGGCTGCCGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
941602945 2:167563506-167563528 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
941917492 2:170822175-170822197 CGGCTGGGTGGCGCGGCGGGCGG + Intronic
943773458 2:191742159-191742181 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
944060791 2:195568171-195568193 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
945699420 2:213151733-213151755 CGGCGGCGGCGGGCGGCTGGCGG + Intronic
945891601 2:215436196-215436218 CGGTCGGCTGCGGCGGCCGGCGG - Intergenic
946249610 2:218404558-218404580 CCGCCTGGTGGGGCTGGTGGGGG - Exonic
946340031 2:219060757-219060779 CGGCGGCGGGGGGCGGCGGGCGG + Intergenic
947402407 2:229743081-229743103 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
948255846 2:236567726-236567748 CCGCCGGGCGGGGCTGCTGGAGG - Intergenic
948473833 2:238203753-238203775 GGGCTGGGCGGGGCGGCTGGGGG + Intergenic
948696315 2:239734796-239734818 CGGTGGGGTGAGGGGGCTGGGGG + Intergenic
948718915 2:239883825-239883847 CGGCCTGGTGGGGCAGCTGGTGG - Intergenic
948985449 2:241519879-241519901 AGGCCAGGAGGGGCTGCTGGAGG - Intergenic
1168812003 20:710377-710399 GGGCTGGGTGGGGGGGCCGGGGG - Intergenic
1168954905 20:1828030-1828052 GGGAGGGGTGGGGCGGCCGGTGG + Intergenic
1169076076 20:2760469-2760491 GGGCTGGGTGGGGCAGCTTGTGG + Intergenic
1169141130 20:3228077-3228099 GGGCGGGCTGGGGAGGCTGGCGG - Intronic
1169327437 20:4686919-4686941 GGGCGGGGAGGGGCGCCTGGGGG + Intronic
1169332925 20:4730682-4730704 AGGGCGGGAGGGGCGGATGGAGG - Intergenic
1169557561 20:6767505-6767527 CGGCGGGGTGGGGCGGAGGGCGG - Intergenic
1169824873 20:9756473-9756495 CTGCCGGGATGGGAGGCTGGGGG - Intronic
1170567785 20:17616524-17616546 TGGCCAGGTGGAGAGGCTGGAGG - Intronic
1171266582 20:23776369-23776391 GGGCCGGGCGGGGCGGGTAGGGG - Intergenic
1172059075 20:32176212-32176234 CTCCCGGATGGGGCGGCTGCCGG - Intergenic
1172118639 20:32585224-32585246 CGGCCGGGGGAGGCGGGAGGCGG + Intronic
1172124732 20:32618827-32618849 CAGCTGGGTGGGGCTCCTGGTGG + Intergenic
1172155315 20:32820044-32820066 GGCCCGGGGGGTGCGGCTGGGGG + Intronic
1172209129 20:33185209-33185231 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1172421999 20:34825600-34825622 CTGCCGGGTCGGGCTGCGGGCGG - Intronic
1172840781 20:37901874-37901896 GGCCCGGGTGGGGCGGGGGGCGG + Intergenic
1172910828 20:38407691-38407713 CTCCCCGATGGGGCGGCTGGCGG - Intergenic
1173430085 20:42979973-42979995 CGGCCGGGAAGGGGGGGTGGGGG + Intronic
1174298926 20:49568235-49568257 GGGCGGGGTGGGGGGGGTGGGGG + Intergenic
1174467900 20:50731563-50731585 CGGACTGGTGGCGCGGCAGGCGG - Exonic
1175451279 20:59070799-59070821 CGGCCGGGCGTGGTGGCTCGTGG - Intergenic
1175997147 20:62816999-62817021 CGGGCGGGCGGGGCGGGAGGTGG - Intronic
1176005566 20:62860904-62860926 CCGCCGGGAGGGCAGGCTGGGGG + Intronic
1176107433 20:63395954-63395976 TGGCCGGGTGGAGGGGCTGCAGG + Intergenic
1176235863 20:64053207-64053229 AGGGCAGGTGGGGCGGCAGGAGG + Intronic
1176243339 20:64085016-64085038 CGACCAGGTGGGGCGGGTCGTGG + Exonic
1177178507 21:17720605-17720627 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1179051606 21:37893132-37893154 CGGCCGGGTGCGGTGGCTCAAGG - Intronic
1179492699 21:41751692-41751714 CTGCCAGCTGGGGAGGCTGGCGG + Intronic
1179876605 21:44272058-44272080 TGGCCGGGTGGAGAGGCTGAGGG + Intergenic
1181031344 22:20150044-20150066 CAGCCGGGTCGGGGGGCTGTGGG + Exonic
1181511991 22:23393358-23393380 CAGCCGGGTCGGGGGGCTGTGGG - Intergenic
1181532210 22:23523086-23523108 TGGCCAGGTGGGGAGGCGGGTGG + Intergenic
1181636400 22:24176770-24176792 TGGCTGGTTGGGGCAGCTGGTGG - Intronic
1182222908 22:28772906-28772928 AGGCCGGCTGCGGCGGCTGCAGG - Exonic
1182271184 22:29154550-29154572 CGGCAGGAGGCGGCGGCTGGGGG - Intronic
1182531303 22:30960769-30960791 CAGCCGGGTGTGGCGGCTTATGG - Intronic
1183315776 22:37136172-37136194 AGGCAGGAGGGGGCGGCTGGAGG - Intronic
1183320903 22:37164475-37164497 GGGCCGGGTGGTGGGGGTGGTGG + Intronic
1183508337 22:38221389-38221411 TGGCCTGGTGGTGAGGCTGGAGG + Exonic
1183743160 22:39679374-39679396 GGGCCGGGAGGGGCGGGCGGCGG + Exonic
1183743570 22:39681017-39681039 CGGCCAGGTGGGCAGGCTGTGGG - Exonic
1184033947 22:41909951-41909973 GGGCCGGGCCGGGCGACTGGAGG + Exonic
1184101650 22:42344150-42344172 CGGGAGGGGGGGGCGGCCGGTGG - Intergenic
1184164983 22:42721712-42721734 CGGGTGGGTGGGGGAGCTGGTGG - Intergenic
1184236866 22:43187352-43187374 CGGCAGGGGCGGGGGGCTGGGGG - Intergenic
1184247373 22:43242472-43242494 CTGCCCGGTGGGGAGGTTGGGGG + Intronic
1184281372 22:43439491-43439513 CAGGGAGGTGGGGCGGCTGGAGG + Intronic
1184474054 22:44711207-44711229 AGGCCAGGTGGGGCGTCAGGAGG + Intronic
1184655639 22:45940725-45940747 CAGCAGGGTAGGGTGGCTGGAGG + Intronic
1184667556 22:45996829-45996851 CGGACGGGCGGGGCCGCTGCAGG - Intergenic
1184769165 22:46587869-46587891 CGTCGGGGTGGGGCCGCGGGAGG + Intronic
1185055327 22:48576045-48576067 CGGCCGGGCGGCGCGGGGGGGGG - Intronic
1185200427 22:49499580-49499602 GGGCAGGTTGGGGCTGCTGGGGG - Intronic
1185333362 22:50261354-50261376 GGGCCGGGCGGGGCGGCCGGCGG - Intronic
1185336195 22:50271828-50271850 CGGCCGGGCGGGGCGGGAGTCGG + Intergenic
1185368312 22:50446975-50446997 CGGCCGGGCGGGGCGGGGCGGGG + Exonic
949516783 3:4814596-4814618 GGGGCGGGTGGGGTGGTTGGTGG + Intronic
950098920 3:10345595-10345617 AGGCTGGGTGGGGTGGCCGGGGG + Intronic
950583508 3:13878202-13878224 CGGGCGGGCGGGGCGGCCAGGGG + Intronic
950759254 3:15206216-15206238 CGCCTGCGTCGGGCGGCTGGTGG + Intronic
951217724 3:20040494-20040516 GGGCCGGGCCGGGCGGCTGCGGG + Exonic
951951105 3:28200678-28200700 GGGCCGGCAGGGCCGGCTGGCGG + Intergenic
952093588 3:29921494-29921516 CAGGGGGGTGGGGGGGCTGGGGG + Intronic
953257709 3:41306318-41306340 CTCCCGGATGGGGCGGCTGGCGG - Intronic
953357357 3:42266227-42266249 AGGCGGGGTGGGGGGGTTGGGGG + Intergenic
953385410 3:42503113-42503135 CAGCGGGGTGGGGCGGCCAGTGG + Intronic
953404765 3:42654771-42654793 GGCCCGGGTGGAGGGGCTGGAGG + Intronic
954059548 3:48056587-48056609 CTCCCGGATGGGGCGGCTGGCGG - Intronic
954569144 3:51626060-51626082 CGGCGGGGTTGGAGGGCTGGTGG - Intronic
954882594 3:53846031-53846053 CGGCCGGGCGGCGCTGCTGCGGG + Intronic
955172991 3:56584167-56584189 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
955320936 3:57973779-57973801 GGGCCTGGTGGTGCTGCTGGTGG + Intergenic
955674428 3:61434616-61434638 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
955674502 3:61434790-61434812 CCTCCGGGACGGGCGGCTGGCGG + Intergenic
958560877 3:95745260-95745282 CTCCCGGATGGGGCGGCTGCTGG - Intergenic
958957351 3:100477829-100477851 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
959415169 3:106073633-106073655 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
959419166 3:106111403-106111425 CTCCCGGATGGGGCGGCTGGCGG + Intergenic
959419190 3:106111450-106111472 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
960977951 3:123194763-123194785 CGGCGGGGCGGGGCGGGGGGAGG - Intronic
961736311 3:129004036-129004058 GCGCTGGGTGCGGCGGCTGGAGG + Exonic
961820958 3:129575439-129575461 AGGCCATGTGGGGCGGGTGGGGG + Intronic
962198029 3:133380157-133380179 CGCTGTGGTGGGGCGGCTGGTGG - Exonic
962459241 3:135593540-135593562 CGGCCCAGTCGGGAGGCTGGGGG + Intergenic
962727992 3:138252749-138252771 AGGCCGGGTGGGGGGGGGGGGGG - Intronic
962843163 3:139253315-139253337 GGGCCGGGGTGGGCGGCGGGAGG - Intronic
963451128 3:145482849-145482871 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
963798959 3:149658232-149658254 CGGCCGGGAGGAGTGGGTGGGGG - Intronic
966411772 3:179652899-179652921 GGGCCGGGCGCGGCGGCGGGGGG - Exonic
966852088 3:184170636-184170658 CGGCCCGGAGGGGCTCCTGGGGG - Exonic
966919389 3:184602063-184602085 GGGGCGGGAGGGGAGGCTGGGGG + Intronic
967118217 3:186361045-186361067 CCGCCGCGGGGGGCGACTGGGGG + Intronic
967177531 3:186874078-186874100 CTCCCGGATGGGGCGGCTGGCGG - Intergenic
968323470 3:197791597-197791619 CGGCCGGGGGAGGCGGATGCGGG + Intronic
968516407 4:1017431-1017453 CAGCAGGGTGGGGCGTCTGTGGG - Intronic
968551328 4:1225253-1225275 GGGCGGGGTGGGGCTGCTGCAGG - Intronic
968651941 4:1763604-1763626 CGGGCGGGCGGGGCGCCGGGAGG + Intergenic
968659650 4:1793725-1793747 GCGGCGGGCGGGGCGGCTGGGGG + Intronic
968660027 4:1795012-1795034 GGGCCGGGGAGGGCGCCTGGAGG + Intronic
968701331 4:2059484-2059506 CGGCCGGGCGGCGCGGCAGCGGG - Intergenic
968870232 4:3238386-3238408 CGGGCAGGTGGGGCAGCTGTGGG + Intronic
968874061 4:3255984-3256006 CGGCGGGGCCGGGCGGCTGGTGG + Exonic
969239323 4:5888634-5888656 CGGCGGGGCTGGGCGGGTGGGGG - Intronic
969273022 4:6115830-6115852 AGGCAGGATGGGGCGGCTGCAGG + Intronic
969492913 4:7510212-7510234 CCGTCGGGTGGAGCGGCCGGCGG + Intronic
969533144 4:7740519-7740541 CGGCCGTGTGTGGGGTCTGGGGG - Exonic
969697024 4:8740777-8740799 CGGGCGGCTGGGGCTGCAGGAGG - Intergenic
970472725 4:16393496-16393518 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
971257976 4:25031039-25031061 GGGCCGGGTGGGGCGCCACGGGG - Intergenic
972396534 4:38663761-38663783 GGGCCGGGCGGGAGGGCTGGCGG + Intergenic
973274450 4:48292696-48292718 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
973673130 4:53238468-53238490 CTCCCGGATGGGGCGGCTGGTGG + Intronic
973907421 4:55546246-55546268 CGGCGGGGCCGGGCGGCTTGAGG - Intronic
974385706 4:61200839-61200861 CGGCCGGGCCGGGCAGCTGCGGG - Intergenic
977096275 4:92748946-92748968 CTGCTGGGTGAGGTGGCTGGTGG - Intronic
980056395 4:128083542-128083564 CTCCCGGACGGGGCGGCTGGCGG + Intronic
981713656 4:147732486-147732508 CGGCGTGGCGAGGCGGCTGGGGG + Intronic
982075312 4:151731886-151731908 CTCCCGGATGGGGCGGCTGCTGG - Intronic
983628770 4:169828528-169828550 CTCCCGGATGGGGCAGCTGGCGG - Intergenic
984771020 4:183436313-183436335 CGGTGGGGTGGGGCGGGGGGGGG + Intergenic
984803733 4:183735822-183735844 TGGGCGGGTGGGCCGGCGGGGGG + Intergenic
985334987 4:188882961-188882983 CGGCCGGGTGCGGTGGCTCAGGG + Intergenic
985508575 5:299025-299047 CAGCTGGGGGGAGCGGCTGGGGG - Intronic
985560395 5:583210-583232 CTGCTGGGTGGGGCGGCCTGAGG - Intergenic
985595172 5:784743-784765 GGGCGGGGCGGGGCGGCAGGGGG - Intergenic
985769021 5:1797508-1797530 AGGCCTGGTGGGGCGGCAGAGGG - Intergenic
987352258 5:17032519-17032541 CGGAGGGGTGGGCCGGCGGGCGG + Intergenic
988727320 5:33938039-33938061 CGGCCGCGTGGGGCGGCGCCGGG - Exonic
989061476 5:37415477-37415499 CTCCCGGAAGGGGCGGCTGGGGG + Intronic
989156191 5:38347066-38347088 AGGCATGGTGGGGTGGCTGGAGG + Intronic
989600041 5:43192436-43192458 TGGCGGGGTGGGGGTGCTGGCGG - Intronic
989633513 5:43511321-43511343 CTGCCGGACGGGGCGGCTGCCGG - Intronic
990347439 5:54884112-54884134 CGGCGGGATGGGGCGGTTCGGGG - Intergenic
991370269 5:65911447-65911469 AGGGAGGGTGGGGCAGCTGGGGG + Intergenic
992530137 5:77645306-77645328 CGGCGGCGCGGGCCGGCTGGGGG - Intergenic
992641533 5:78772433-78772455 GGGCTGGGAGGGGCTGCTGGGGG + Intergenic
992726430 5:79612335-79612357 AGGCGGGGTGGGGGGGGTGGGGG + Intronic
992866268 5:80960372-80960394 CGGCGGGCTGGGGCGGCAGCCGG - Intergenic
994107351 5:95961881-95961903 CCGGAGGGTGGGGCGGGTGGCGG - Exonic
994710291 5:103258249-103258271 TGGCGGGGTGGGGCGGGGGGGGG - Intergenic
995512442 5:112922306-112922328 CGGCCGGGCGGGGCGAGCGGAGG - Exonic
996900706 5:128538663-128538685 GGGCCCGGGGGGCCGGCTGGAGG + Intronic
999289544 5:150414820-150414842 AGTCGGGGTGGGGCGGGTGGGGG - Intergenic
999603839 5:153296172-153296194 CTCCTGGATGGGGCGGCTGGCGG + Intergenic
1000041373 5:157487512-157487534 CGGCCGGGTGGGGTGCCTTCTGG - Intronic
1000205181 5:159051431-159051453 CGGCGGGGTGGGGGGGTGGGGGG - Intronic
1000630206 5:163583701-163583723 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1001268078 5:170289511-170289533 CGGCAGGGTGGGGCTGGTGAAGG + Intronic
1001440311 5:171737794-171737816 GGGCCGGGAGGAGCGGCTGGAGG - Intergenic
1001589925 5:172858234-172858256 CGGCCGGCTGAAGCGGCTGCTGG + Intronic
1002042872 5:176527582-176527604 CGGCAGGCTGGGGCGGGAGGTGG + Exonic
1002054576 5:176591351-176591373 AGGCCTGGTGGGGTGGCTGAGGG + Intronic
1002210934 5:177599041-177599063 AGGAGGGGTGGGGGGGCTGGGGG + Intergenic
1002568647 5:180127976-180127998 CTGCGGGGTGGAGGGGCTGGTGG + Intronic
1003290848 6:4776841-4776863 GGGCCGGGAGGGGCGGCGGGCGG - Intronic
1003345307 6:5261030-5261052 CCGCCGCGTGGAGCGGCTGCTGG - Exonic
1004044398 6:12011632-12011654 CGGCCGGGCGGGGCGGGGAGGGG + Intronic
1004314355 6:14572863-14572885 GGGCGGGGTGGGGAGGTTGGGGG + Intergenic
1005952600 6:30642827-30642849 CGGGGGGGTGGGTGGGCTGGAGG - Exonic
1006064778 6:31454955-31454977 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1006065054 6:31455610-31455632 CTCCCGGATGGGGCGGCTGCTGG + Intergenic
1006180717 6:32151948-32151970 CGGCGGGGGGGGGGGGCGGGGGG + Exonic
1006180968 6:32153353-32153375 CGGAGAGGTGGGGCGCCTGGGGG + Intronic
1006281741 6:33059597-33059619 CTCCCGGACGGGGCGGCTGGCGG + Intergenic
1007697906 6:43745152-43745174 GGGCCGGGCTGGGCGGCTGTTGG - Intergenic
1007834822 6:44666341-44666363 GGGCCTGGTGGGGAGGCTGGAGG + Intergenic
1008553588 6:52655727-52655749 CTCCCGGATGGGGCGGCTGGCGG + Intergenic
1009622676 6:66096856-66096878 CTCCCGGATGGGGCGGCTGCCGG + Intergenic
1015910191 6:138161879-138161901 GGGCGGGGCGGGGCGGCGGGCGG + Intergenic
1015976434 6:138795990-138796012 CGTCCGGGCGCGGCGGCGGGAGG + Intronic
1016812912 6:148278315-148278337 CGGCCGGGTGCGGTGGCTCACGG - Intronic
1016969551 6:149749659-149749681 CGGCCGGGTGGGGCCGAGGGCGG - Exonic
1017516883 6:155164530-155164552 CAGCTTGGAGGGGCGGCTGGCGG - Exonic
1017718716 6:157229944-157229966 TGGCTGGGTGGAGTGGCTGGCGG + Intergenic
1017743733 6:157428618-157428640 GGGCGGGGTGGGGCGGGCGGGGG - Intronic
1017801160 6:157897658-157897680 CAGCCGGGTGTGGCGGTGGGCGG - Intronic
1017880671 6:158560439-158560461 CGGCCGGGCGGGCAGGCAGGAGG - Intronic
1019538369 7:1540379-1540401 CGGCCGGGGGCGGGGGGTGGCGG + Exonic
1020037678 7:4974483-4974505 CGGCCTGGAGGAGCGGCGGGAGG + Intergenic
1020162140 7:5781141-5781163 CGGCCTGGAGGAGCGGCGGGAGG - Intronic
1020263217 7:6543112-6543134 CGGCCGGGTGCGGTGGCTCACGG + Intronic
1022020883 7:26398548-26398570 CGGCCCGGCTCGGCGGCTGGGGG + Intergenic
1022234292 7:28446200-28446222 GGGAGGGGAGGGGCGGCTGGGGG - Intronic
1022973490 7:35537304-35537326 CGGCAGGGCGGGGCGGGGGGCGG + Intergenic
1023875855 7:44285868-44285890 CGGCGGGGGGGCGCGGCGGGGGG + Intronic
1024305148 7:47922711-47922733 TGGCCGGACGGGGCGGCTGCCGG - Intronic
1025636265 7:63322260-63322282 CAGGCGGGTGGGGGGGCTAGGGG + Intergenic
1025646431 7:63425916-63425938 CAGGCGGGTGGGGGGGCTAGGGG - Intergenic
1025803504 7:64809280-64809302 CTCCCGGACGGGGCGGCTGGAGG + Intronic
1026868259 7:73836102-73836124 CTCCCGGATGGGGCGGCTGGTGG - Intronic
1027182711 7:75951981-75952003 CTCCCGGACGGGGCGGCTGGCGG + Intronic
1027189522 7:75988968-75988990 AGGCCGGGTGGGGTGGGGGGTGG + Intronic
1027189538 7:75988997-75989019 AGGCCGGGTGGGGTGGGGGGTGG + Intronic
1028485562 7:91353661-91353683 CGGCGGGGTGGGGGAGGTGGAGG + Intergenic
1028621875 7:92835240-92835262 CAGGCGGGTTGGGCGGCCGGCGG - Intronic
1029490150 7:100866414-100866436 GGGCCGGGTGGGCCGGAGGGTGG + Exonic
1029490826 7:100868915-100868937 CGACTGGGTGGGGTGGCTGGTGG + Intronic
1029524216 7:101085383-101085405 GGGCCGGGTGGGGAGGAAGGCGG + Intergenic
1029888873 7:103905523-103905545 GGGCCAGGTGGGGTGGCGGGTGG - Intronic
1032156865 7:129476252-129476274 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
1034274829 7:149819509-149819531 TGCCCAGGTGAGGCGGCTGGGGG + Intergenic
1034347587 7:150396937-150396959 CGCCCGTGTGGTGCCGCTGGTGG - Exonic
1034455531 7:151167892-151167914 GGGCCGCGGGGGGCGGGTGGGGG - Intronic
1035179365 7:157078117-157078139 CGGCCGGGGGCGGAGACTGGCGG - Intergenic
1035221702 7:157410120-157410142 CGGTCGGGCGGGGCGGGAGGAGG + Intronic
1036162791 8:6405789-6405811 CGGCAGGGTGGAGCAGCTGGAGG + Intergenic
1036213889 8:6863523-6863545 GGGGAGGGTGGGGAGGCTGGCGG + Intergenic
1036536745 8:9657796-9657818 CTCCCGGATGGGGCGGCTGCCGG + Intronic
1037879494 8:22565936-22565958 CGGCCGGGCGGGGCGGACGGGGG + Intronic
1038041384 8:23726932-23726954 CAGCCGGGTGGCGCCGCAGGGGG + Intergenic
1039020370 8:33198077-33198099 CTGCGGGGTGGGGGGGCGGGGGG - Intergenic
1039454204 8:37696985-37697007 GGGCCGGGCGCGGCAGCTGGCGG - Intronic
1039650894 8:39339211-39339233 CTCCCGGATGGGGCGGCTGCTGG + Intergenic
1040052798 8:43033041-43033063 CTCCCGGGCGGGGCGGCTGGGGG + Intronic
1040512598 8:48108373-48108395 CGGCAAGCTGGGGCGGCTGCGGG - Intergenic
1041634223 8:60124815-60124837 TGTCAGGGTTGGGCGGCTGGGGG - Intergenic
1042290713 8:67167452-67167474 CTCCCGGATGGGGCGGCTGCTGG + Intronic
1043958493 8:86389802-86389824 CTCCCAGATGGGGCGGCTGGCGG + Intronic
1045098850 8:98825729-98825751 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098862 8:98825749-98825771 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098874 8:98825769-98825791 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098886 8:98825789-98825811 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098898 8:98825809-98825831 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098910 8:98825829-98825851 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098922 8:98825849-98825871 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045120208 8:99028409-99028431 CTCCCGGACGGGGCGGCTGGCGG + Intronic
1045235813 8:100351530-100351552 CTCCCGGATGGGGCGGCTGGCGG - Intronic
1045516332 8:102863739-102863761 TGGCCTTGGGGGGCGGCTGGGGG - Intronic
1047248877 8:123166762-123166784 CAGCCGGGTGGGTGGGGTGGAGG - Intergenic
1047616718 8:126568512-126568534 TGGCAGGGTGGGGCGGGTGTGGG + Intergenic
1047687616 8:127317230-127317252 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1048214137 8:132480492-132480514 AGGGCGGCGGGGGCGGCTGGCGG - Exonic
1049204893 8:141359110-141359132 CAGCAGGGTGGGGAGGCTCGTGG + Intronic
1049588097 8:143441139-143441161 CAGGTGGGTGGGCCGGCTGGAGG + Intronic
1049689722 8:143953246-143953268 GGGTGGGGTGGGGGGGCTGGGGG - Intronic
1049761327 8:144333095-144333117 CGTCCGGGTGGAGGGGCCGGAGG - Exonic
1052236113 9:26214821-26214843 CTCCCAGATGGGGCGGCTGGCGG + Intergenic
1053056548 9:34996391-34996413 GGGCCGAGTGGAGCGGCTGCTGG - Exonic
1055234597 9:74105337-74105359 GGGCCTGTTGGGGCGGGTGGGGG + Intergenic
1055298021 9:74853291-74853313 CTCCCGGATGGGGCGGCTGCCGG - Intronic
1055945183 9:81687419-81687441 CAGCCTGGTGCGGCGTCTGGGGG + Exonic
1056661143 9:88544254-88544276 AGGCTGGGTGGGGCACCTGGTGG + Intronic
1057230314 9:93317729-93317751 AGGCCAGGTGGGCCAGCTGGGGG + Intronic
1057298090 9:93860968-93860990 GGGCGGGGCGGGGCCGCTGGGGG + Intergenic
1057445090 9:95108320-95108342 CGGCAGGCTGGGCCGGCTGAGGG - Intronic
1057596366 9:96418646-96418668 CGGCGGGGCGGGGCGGCAGGCGG - Intergenic
1058851209 9:109013491-109013513 CGGGCGGGTGGGCTGACTGGCGG - Exonic
1058951914 9:109911960-109911982 AGGCTGGGTTGGGGGGCTGGGGG + Intronic
1059470936 9:114504718-114504740 CGGCCGGGGCGGGCGGCGGCGGG - Exonic
1060525971 9:124321579-124321601 TGGCGGGGTGGGGGTGCTGGGGG + Intronic
1060530634 9:124345367-124345389 GGGCAGGCTGGGGCGGATGGAGG + Intronic
1060549404 9:124477956-124477978 GGGCCGGGTGGGGGGTCCGGAGG - Intronic
1061035179 9:128109526-128109548 AGGCTGGGAGGGGCAGCTGGGGG - Intergenic
1061043689 9:128153315-128153337 CGGGCTGGTGCGGCAGCTGGCGG - Intronic
1061501935 9:131009102-131009124 CTGCGGGGCGGGGAGGCTGGAGG - Exonic
1061601548 9:131673692-131673714 CTGTTGGGTGGGGCGGCCGGGGG - Intronic
1061736790 9:132666857-132666879 TAGCCGGGTGTGGTGGCTGGTGG - Intronic
1062277148 9:135736499-135736521 CGGCCGGGTGCCGGGGCTGGGGG - Intronic
1062349391 9:136131685-136131707 TGGCAGGGTGGGCCTGCTGGGGG - Intergenic
1062352891 9:136147894-136147916 CAGCAGGGTGGGGCAGCTCGGGG - Intergenic
1062622382 9:137428757-137428779 GGGCCAGGTGGGGGGACTGGGGG + Intronic
1185463041 X:341081-341103 CGCCCGGTGGGGGCGGCAGGGGG - Intronic
1186426086 X:9465190-9465212 CGGCGGGGCGGGGGCGCTGGCGG - Exonic
1187112177 X:16313208-16313230 CGGCGGGGCTGGGCGGGTGGGGG + Intergenic
1188242654 X:27809497-27809519 CGGGCGGGGGGGGGGGCGGGCGG - Intronic
1189731830 X:44029104-44029126 GGGCCGGGCGCGGTGGCTGGTGG - Intergenic
1190267436 X:48835658-48835680 CGGTCGGGTGGGTGGGGTGGGGG - Intergenic
1192379663 X:70602183-70602205 CTCCCGGATGGGGCGGCTGGAGG + Intronic
1192473734 X:71420953-71420975 CGGGCGGCTGGGGCTGCAGGCGG - Intronic
1193318923 X:80097469-80097491 CTGTTGGGTGGGGGGGCTGGGGG + Intergenic
1197215026 X:123859759-123859781 CGGGCGGGGGGGTCGGGTGGGGG + Intronic
1199491347 X:148403674-148403696 CGGTCCGGTGGGTCGGGTGGCGG - Intergenic
1199586473 X:149421019-149421041 CTCCCGGACGGGGCGGCTGGCGG - Intergenic
1200231048 X:154444038-154444060 CGGCGGGGCGGGGCGGGCGGTGG + Intergenic
1200835385 Y:7726896-7726918 CAGCCGGGAGGGGTGCCTGGGGG + Intergenic