ID: 919929744

View in Genome Browser
Species Human (GRCh38)
Location 1:202213601-202213623
Sequence AGCCCTGCTTCTCCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 284}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919929733_919929744 22 Left 919929733 1:202213556-202213578 CCTCCTCTACCCACAGCCTCCCC 0: 1
1: 1
2: 10
3: 135
4: 1434
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929737_919929744 6 Left 919929737 1:202213572-202213594 CCTCCCCAGCCTATCTTTCCTAA 0: 1
1: 0
2: 0
3: 26
4: 275
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929732_919929744 23 Left 919929732 1:202213555-202213577 CCCTCCTCTACCCACAGCCTCCC 0: 1
1: 1
2: 14
3: 515
4: 6754
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929739_919929744 2 Left 919929739 1:202213576-202213598 CCCAGCCTATCTTTCCTAACTTT 0: 1
1: 0
2: 4
3: 43
4: 448
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929740_919929744 1 Left 919929740 1:202213577-202213599 CCAGCCTATCTTTCCTAACTTTA 0: 1
1: 0
2: 3
3: 35
4: 336
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929741_919929744 -3 Left 919929741 1:202213581-202213603 CCTATCTTTCCTAACTTTATAGC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929738_919929744 3 Left 919929738 1:202213575-202213597 CCCCAGCCTATCTTTCCTAACTT 0: 1
1: 0
2: 0
3: 23
4: 277
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929736_919929744 12 Left 919929736 1:202213566-202213588 CCACAGCCTCCCCAGCCTATCTT 0: 1
1: 0
2: 5
3: 109
4: 1826
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929734_919929744 19 Left 919929734 1:202213559-202213581 CCTCTACCCACAGCCTCCCCAGC 0: 1
1: 1
2: 12
3: 126
4: 1667
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284
919929735_919929744 13 Left 919929735 1:202213565-202213587 CCCACAGCCTCCCCAGCCTATCT 0: 1
1: 0
2: 4
3: 37
4: 382
Right 919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919929744 Original CRISPR AGCCCTGCTTCTCCACCAGG AGG Intronic
900013362 1:133876-133898 AGCCCTGCCTCAACACCTGGGGG + Intergenic
900043428 1:489863-489885 AGCCCTGCCTCAACACCTGGGGG + Intergenic
900064866 1:724860-724882 AGCCCTGCCTCAACACCTGGGGG + Intergenic
900563819 1:3322674-3322696 AGAGCTGCTTCTCCCCCAGATGG + Intronic
900916712 1:5644674-5644696 AGTGTTGCTTCTCCGCCAGGTGG - Intergenic
901101182 1:6720277-6720299 AGCCCTGCTTCTGCACAAGCAGG - Intergenic
902201050 1:14833814-14833836 ATCCATGCTTCACCAGCAGGTGG + Intronic
902607070 1:17574729-17574751 ATCCCGGACTCTCCACCAGGTGG + Intronic
904442346 1:30539938-30539960 ACCCCTACTTCTCCAACAGGAGG + Intergenic
904834323 1:33324948-33324970 AGCCCTGCTGCTGCTCAAGGAGG - Exonic
905957843 1:42014035-42014057 AGCCGTGCTTCTCCAACATGGGG - Intronic
906237814 1:44222370-44222392 AGCCCTGCTTCTGTCCCAGTAGG + Intronic
906914731 1:49995920-49995942 AGCCCAGTATCTCCACTAGGTGG + Intronic
908141282 1:61187878-61187900 TGCCCTCCTTCTCCACAGGGTGG + Intronic
908167031 1:61468787-61468809 AGCCCTGCTTCTCCGCCAGTGGG - Intergenic
911019463 1:93372438-93372460 CGCCCTGATTCTCCTCCATGTGG + Intergenic
911912319 1:103652379-103652401 TGCCCTGCTTCGACACCTGGAGG - Intergenic
911916135 1:103699569-103699591 TGCCCTGCTTCGACACCTGGAGG + Intronic
911919734 1:103746517-103746539 TGCCCTGCTTCGACACCTGGAGG - Intronic
912464816 1:109864714-109864736 AGCCCAGCTGCTTCACCAGAGGG - Intergenic
912556408 1:110519328-110519350 ACCCCTGCTTCTGGACCAAGTGG + Intergenic
912687216 1:111777022-111777044 AGCCCTCCCTCACAACCAGGTGG - Exonic
913007455 1:114648732-114648754 AGCTCTTTTTATCCACCAGGTGG - Intronic
915428090 1:155843756-155843778 AGCCCTCGTTTTCCACCAGAGGG - Intronic
915625425 1:157111492-157111514 AGCCCTCTTTCTCCAACAGCCGG - Intergenic
915740929 1:158117941-158117963 TGCACTGCTTCTCCCCCAGGGGG + Intergenic
919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG + Intronic
920250614 1:204619987-204620009 TGCCCTGCAGCTCCACCATGAGG - Exonic
920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG + Intronic
921747101 1:218751724-218751746 CGCCCTGCTTCGGCACCTGGAGG - Intergenic
922099771 1:222470878-222470900 AGCCCTGCCTCAACACCTGGGGG + Intergenic
922261805 1:223950371-223950393 AGCCCTGCCTCAACACCTGGGGG + Intergenic
922735273 1:227975371-227975393 AGCCCTGCCTCAACACCTGGGGG - Intergenic
923385269 1:233459859-233459881 AGCCCTGGTACTTCCCCAGGTGG + Intergenic
924342971 1:243052546-243052568 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1063474751 10:6318455-6318477 AGCTCTCCTTCTTCCCCAGGGGG + Intergenic
1064152047 10:12873448-12873470 AGCCCTGCTTCTGTAGTAGGGGG + Intergenic
1064832063 10:19480063-19480085 AGCCATCCTTCTCCACCATGTGG + Intronic
1065124378 10:22560045-22560067 AGCCCTGCTTCTGCCCTAGTGGG + Intronic
1065888303 10:30098315-30098337 ACCCCTGTTTCTCCCCCAGCTGG + Intronic
1066026263 10:31362675-31362697 TGCCCTGCTGCTCCACCATCTGG - Intronic
1066082700 10:31947803-31947825 AACCCTGTTTTTCCACCAGATGG - Intergenic
1066733509 10:38453006-38453028 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1067529722 10:47061411-47061433 TGCCCTGCTGCCCCCCCAGGAGG + Intergenic
1067545543 10:47190028-47190050 AGCCCTCCTTCTCCACCTTGAGG - Intergenic
1068879823 10:62036350-62036372 AGCCCTTCCTCACCCCCAGGAGG + Intronic
1069415252 10:68194506-68194528 AACCCTGCGTCTCCACCTGGGGG - Exonic
1069560255 10:69424223-69424245 AGCCCTGCTCCTTCACCAGCTGG + Intergenic
1069566045 10:69464268-69464290 AGCCCTTCTGCCTCACCAGGTGG + Intronic
1070326876 10:75395488-75395510 AGCGCCGCGTGTCCACCAGGCGG - Intergenic
1070724909 10:78781253-78781275 AGCCCTGCTCCACCAGCAGCTGG - Intergenic
1070828822 10:79406448-79406470 GACCCTGCTTCTTCACCAAGGGG + Intronic
1072635462 10:97174793-97174815 AGTCCTGCTCCTCAACCAGCTGG - Intronic
1072733186 10:97861823-97861845 AGCCCTGCTGCTCCACCCTGGGG - Intronic
1072806228 10:98425494-98425516 AGCCCTGCCTCTTCCCCAGGTGG + Intronic
1073064456 10:100749965-100749987 AGCCCTGGGTCTCCAGCTGGAGG + Intronic
1073572408 10:104591702-104591724 CTCACTGCTTCTCCACCATGGGG - Intergenic
1074111126 10:110423465-110423487 AGCCCGGCTCCTCTTCCAGGAGG - Intergenic
1075440241 10:122474466-122474488 GGCCCTCCTCCTGCACCAGGGGG + Intronic
1076177234 10:128377380-128377402 GGCCCTGGTTCTCCACCCTGTGG - Intergenic
1076726451 10:132416328-132416350 AGCCCCAGTTCTCCACCAGCCGG - Intronic
1076746909 10:132519146-132519168 ATCCCAGCTACTCCTCCAGGTGG + Intergenic
1076969701 11:126080-126102 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1077111423 11:863824-863846 AGCCCTGCTGCTCCTCCATGCGG - Intronic
1077930001 11:6721144-6721166 AGCCCAGCTTCTCTACCATCTGG + Intergenic
1078389556 11:10925108-10925130 AGCTCTACTTCTTCAACAGGTGG - Intergenic
1078398209 11:11000809-11000831 AGCCCTCTCTCTCCACCATGTGG - Intergenic
1080587749 11:33696878-33696900 TACACAGCTTCTCCACCAGGAGG + Intergenic
1081812968 11:45923423-45923445 AGCCCCCCTTCTCCGCTAGGCGG - Intronic
1083367542 11:62150561-62150583 AGCTCTGCCTCTGCCCCAGGTGG - Intronic
1083643258 11:64157036-64157058 GCCCCTGTTTCTCCTCCAGGGGG - Intronic
1083839297 11:65294614-65294636 AGATCTGCTTTTCCACCTGGGGG + Exonic
1083882499 11:65555452-65555474 AGCTCAGTGTCTCCACCAGGAGG + Intronic
1083943994 11:65913768-65913790 GGCCCAGCTTCTCTCCCAGGTGG + Intergenic
1084179255 11:67438399-67438421 GGCCCAGCTGCTCCTCCAGGCGG + Exonic
1090644373 11:128755845-128755867 AGTCCTGCTTTTGCACCAGAAGG - Intronic
1091778011 12:3197357-3197379 AGCCCTGATGCTACATCAGGAGG + Intronic
1092815649 12:12310391-12310413 TGCTCTGCTTCTCCAACATGGGG - Intergenic
1096804599 12:54132932-54132954 AGTCCTGCTTGTCAACCAGCTGG - Intergenic
1098072885 12:66695160-66695182 AGCCCCACTTCTCCACCCAGAGG - Intronic
1098329842 12:69341597-69341619 AGCACTGCTTCACTACCAAGTGG + Intergenic
1100844446 12:98644729-98644751 AGGGCAGCTTCTTCACCAGGGGG + Exonic
1101386839 12:104265799-104265821 AGCCACGCTTCACCACCAAGAGG + Intronic
1101432956 12:104641888-104641910 AGCCATGGTTCTCAACCAGGGGG + Intronic
1101724695 12:107379191-107379213 AGCCCTTACTCTGCACCAGGTGG - Intronic
1103568306 12:121828116-121828138 GGCCCTGCTTCTGTGCCAGGAGG + Intronic
1109266891 13:60211738-60211760 AGCCTGGTTGCTCCACCAGGGGG - Intergenic
1109760115 13:66816930-66816952 AGCCCTCCTTATCCACCAGAGGG + Intronic
1109802850 13:67400870-67400892 TGCCCTGCTTCTGCACCTTGAGG + Intergenic
1113428579 13:110230117-110230139 AGCCCTCCCCCTCCACCACGTGG - Intronic
1113539997 13:111099555-111099577 TGCACTGCTTTTCCACCAGTAGG - Intergenic
1113693571 13:112328996-112329018 AGTCCTGCTTCTCAACTTGGGGG - Intergenic
1114357264 14:21924712-21924734 CGCCTTGGTTCTCCAGCAGGTGG - Intergenic
1114765158 14:25362234-25362256 AGCCCTGCTGGTCCACCAACAGG - Intergenic
1118321657 14:64757038-64757060 GGCCCTGCTTTTCCTCCAAGAGG + Intronic
1119805242 14:77478093-77478115 AGGTTTGCTTCTCCAACAGGGGG - Intronic
1121356959 14:93223616-93223638 AGCCACGCTTCACCACCAAGAGG - Intronic
1121559614 14:94864801-94864823 GGCCCTGTTTCCCCACCACGTGG - Intergenic
1122194058 14:100071742-100071764 AGCCCCTCCTCTCTACCAGGGGG - Intronic
1123153453 14:106203800-106203822 AGACCTCCTCCTCCTCCAGGAGG + Intergenic
1124512224 15:30336976-30336998 TGTCCTGCTTCTCCACCCGGAGG - Intergenic
1124730690 15:32193775-32193797 TGTCCTGCTTCTCCACCCGGAGG + Intergenic
1125599186 15:40906411-40906433 CGCCCTGCGTCTCCCCCAGGTGG - Intergenic
1126100138 15:45113798-45113820 GGCTCCGCTTCTCCTCCAGGAGG + Intronic
1126483631 15:49155338-49155360 GGCCCTGCTTCTCCAGCATGGGG - Intronic
1127771168 15:62232021-62232043 AGCCTTGCTTCCCTGCCAGGTGG - Intergenic
1128868950 15:71137613-71137635 AGCCCTGCTTTTCAAACTGGGGG - Intronic
1128998269 15:72312770-72312792 GTCCCTGCTTCTCCAGCAGGTGG + Intronic
1129602558 15:77008839-77008861 AGTCGTGTTTCTCCACCATGCGG + Intronic
1129694805 15:77734619-77734641 AGCTCTGCTCCTCCTCCAGGAGG + Intronic
1130654136 15:85780191-85780213 AGCCCAGCTGCTGCACCAGACGG + Intronic
1131462120 15:92624773-92624795 AGCCCTGCCTCCCCACCAAGAGG - Intronic
1132285410 15:100658777-100658799 AGCCCAGCATCGCCACCAGCGGG - Intergenic
1132310353 15:100852996-100853018 AGCCCTGGTTCCCCAACAGATGG + Intergenic
1132318075 15:100904844-100904866 AGCCCTGCCACCCCACCTGGAGG + Intronic
1132846675 16:2003962-2003984 CGCCAGGCCTCTCCACCAGGGGG + Intronic
1133796494 16:9050605-9050627 TGCTCCGCTTCTCCACCTGGGGG - Intergenic
1134475430 16:14569376-14569398 AGCGCTGCTGCCCAACCAGGTGG + Intronic
1135395186 16:22125966-22125988 AGCCCCCCTTCTCTCCCAGGAGG - Intronic
1136239924 16:28937436-28937458 ACCCCTCCTTCTCCACCAGATGG + Exonic
1136298547 16:29317736-29317758 GCCGCTGCTTCTCCACCTGGTGG + Intergenic
1136594920 16:31241621-31241643 ATCCCTGCTGCTCTACCTGGTGG + Intergenic
1137414428 16:48260859-48260881 AGTTCTGCTTCTCCAGCAAGTGG - Intronic
1139964635 16:70738578-70738600 AGCCCCCCTGCTCCACCAGCAGG - Intronic
1140234369 16:73145189-73145211 ACCCCTGCTCCCCCAACAGGAGG - Intergenic
1141734848 16:85845491-85845513 ACACCAGCTTCTCCACCGGGAGG + Intergenic
1142003200 16:87675782-87675804 AGCACTGCTTCTGACCCAGGAGG + Intronic
1142265375 16:89061983-89062005 ACCCCTGCTGCTCCCCCACGAGG + Intergenic
1142450976 16:90173042-90173064 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1142456587 17:60653-60675 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1142805670 17:2369931-2369953 GGCCCTTCAGCTCCACCAGGAGG - Intronic
1142810098 17:2391967-2391989 AGCCCAGTTTCTCCAGCAGGAGG - Intronic
1143119341 17:4597371-4597393 AGCCCAACTTCTTCCCCAGGTGG + Intronic
1143477995 17:7213968-7213990 GGCCCTGCTTATCCACCAGTGGG + Intronic
1143782150 17:9234516-9234538 AGCCCTGGTGCTCCACCATGGGG - Intronic
1144765339 17:17729462-17729484 AGCCCAGCTTCTCCGAGAGGAGG + Intronic
1146823273 17:36001493-36001515 AGCCCTGCCTGCCCACCAGGAGG - Exonic
1146825358 17:36017898-36017920 AGCCCTGCCTGCCCACCAGGAGG - Exonic
1146997042 17:37330258-37330280 AGCCCTCCTTCTCCTCCAGTAGG + Exonic
1147161888 17:38573160-38573182 CTCCCTGATCCTCCACCAGGCGG - Intronic
1147234346 17:39046084-39046106 AGGCCTGCGGATCCACCAGGGGG + Intergenic
1147308359 17:39578986-39579008 AGACCTGCTTTTCCAGGAGGAGG - Intergenic
1147466661 17:40616098-40616120 AGCCCTCGTTCTCCAAGAGGTGG + Intergenic
1147506901 17:41027102-41027124 ATCCCAGCTTCTCCATCAGTGGG - Exonic
1147507578 17:41034768-41034790 ATCCCAGCTGCTCCACCAGTGGG - Exonic
1147949355 17:44098345-44098367 AGCCTTCCTAGTCCACCAGGAGG - Intronic
1148110795 17:45143907-45143929 ACCCCTGCTTCTCCCCGAGGAGG + Exonic
1148133118 17:45274219-45274241 AGCCCTGCTCCTTGACCAGCTGG + Exonic
1148471509 17:47896452-47896474 AGCCCCGCTCCTCCTCCGGGCGG - Intronic
1148668863 17:49395199-49395221 GGCCCCTCTTCTCCACCAGATGG - Intronic
1150134159 17:62686497-62686519 TGCCCTGCTGATCCAACAGGAGG + Intronic
1150293954 17:63998204-63998226 AGCCCTCCCCCGCCACCAGGAGG - Intergenic
1151251273 17:72837247-72837269 AGCCCTGCTTTCCAACGAGGTGG - Intronic
1151759069 17:76090478-76090500 AGCCCTTCATCTCCAGGAGGGGG + Exonic
1152100072 17:78296231-78296253 AGCCCACCTTCTCCTCCAGGTGG - Intergenic
1152536635 17:80953862-80953884 AGCCCTGCTCCTCCGCTGGGAGG - Intronic
1155189048 18:23413417-23413439 TGCTCTCCTTCCCCACCAGGTGG + Intronic
1157128811 18:44983597-44983619 AGGCCTGCTGCTGCAGCAGGAGG - Intronic
1157701635 18:49764537-49764559 GGCCCAGCATCCCCACCAGGAGG + Intergenic
1157713291 18:49864670-49864692 AGCCCAGCATTTCCACAAGGAGG - Intronic
1158890106 18:61864602-61864624 CGCCCTTCTTCCCTACCAGGAGG + Intronic
1160026918 18:75225873-75225895 AAACCTGCCTCTCCACCAAGTGG - Intronic
1160080723 18:75724898-75724920 AGGTCAGCCTCTCCACCAGGAGG - Intergenic
1160646505 19:196006-196028 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1162647387 19:12059739-12059761 AGCCCTCCCTCCCCAGCAGGTGG + Intergenic
1163533335 19:17863223-17863245 AGCCACGCTTCACCACCAAGAGG + Exonic
1164414963 19:28039398-28039420 AGCCCTGCTCCTCTCCCATGTGG + Intergenic
1165049554 19:33132664-33132686 AGTCCTGGTTCCCCAGCAGGTGG - Intronic
1166165312 19:40983853-40983875 AGCATTGCTTCACCCCCAGGTGG - Intergenic
1166391612 19:42411696-42411718 AGTCTTGCTTCTCCCCCAGTGGG + Intronic
1166998625 19:46731947-46731969 AGCTCTGCTTCTCCACATGGGGG + Intronic
1167852527 19:52212996-52213018 CGCCCAGCTTCTGCCCCAGGAGG + Exonic
1168147943 19:54430083-54430105 AGCCCTGCTTCCCTTCCAGAGGG - Intronic
1168681617 19:58319982-58320004 AGCCCTGGTCCTACACCAGCGGG + Intergenic
925258247 2:2507809-2507831 AGCCCTGCGGCTCTGCCAGGGGG - Intergenic
926424235 2:12726840-12726862 AGGTCTTCTTCTGCACCAGGTGG - Intronic
927966752 2:27275248-27275270 AGCCCCTCTTCCCCAGCAGGAGG - Intronic
930112498 2:47690734-47690756 AGCCACGCTTCACCACCAAGAGG - Intergenic
935490138 2:103709450-103709472 AGTTGTGCTTCTCCATCAGGAGG - Intergenic
937543502 2:122988514-122988536 AGCACTGCTCCTCCACCGGTGGG - Intergenic
937808604 2:126174599-126174621 AGCCATGCTTCTCGACAGGGAGG + Intergenic
939858547 2:147390589-147390611 AAAACTGCTTCTCCTCCAGGAGG + Intergenic
940200653 2:151146451-151146473 AACCCTGCTTCTTCCCCAGCAGG - Intergenic
940907201 2:159179970-159179992 AGCCCTGTTACTACAGCAGGGGG - Intronic
942194495 2:173504149-173504171 AGCCTTCCTTCTCCATTAGGTGG - Intergenic
942212092 2:173681457-173681479 AGCCATGATTCTCCTCCATGTGG + Intergenic
942560229 2:177212191-177212213 AGCCCTGCGACTCCAACATGTGG - Intergenic
943811115 2:192190620-192190642 AGCACTACTTACCCACCAGGAGG + Intronic
945126826 2:206521061-206521083 AGCCCTGCTTCTTCACTAAAGGG + Intronic
945193967 2:207220554-207220576 AGCACTCCTTCTCTACCAGAGGG + Intergenic
946230293 2:218287071-218287093 AGGCCTGATTCTGCACCAAGGGG + Intronic
946416354 2:219541936-219541958 CGCCGTGCTGCTCCAGCAGGTGG + Exonic
948790820 2:240375985-240376007 AGCCCTCCTGCTGCACCAGGGGG - Intergenic
1168767171 20:389470-389492 AGCTCTGCTGCTGCCCCAGGAGG - Intronic
1170111518 20:12808887-12808909 ATCCCTCCTTCTCCAGCAGCAGG + Intergenic
1170919867 20:20667913-20667935 AGCCATGCTTCTCCAACCTGTGG + Intronic
1173861297 20:46285376-46285398 TGCAGTGCTTCTCAACCAGGGGG + Intronic
1175517562 20:59578662-59578684 AGCCCTCCTTCCCCACGAGGCGG + Intronic
1176279002 20:64290210-64290232 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1176373275 21:6075109-6075131 GGCCCTGCATGGCCACCAGGGGG - Intergenic
1178951615 21:36990240-36990262 AGCCCAGTTGCACCACCAGGCGG - Intergenic
1179028256 21:37698311-37698333 TGCCCTGCTTCTCCAGGCGGGGG + Intronic
1179409282 21:41149826-41149848 TGCCCTCCATCCCCACCAGGAGG - Intergenic
1179549918 21:42137444-42137466 AGGCCTGCTTCTGCATGAGGAGG - Exonic
1179659400 21:42864906-42864928 AGCCCTGCTTCCCCACCCCCAGG + Intronic
1179750202 21:43463134-43463156 GGCCCTGCATGGCCACCAGGGGG + Intergenic
1179935603 21:44601934-44601956 AGCCCTGCTTCCCCAGCAACAGG + Exonic
1180376213 22:12096431-12096453 AGCCCTGCTTCTGCTCCTGCAGG + Intergenic
1182304537 22:29358770-29358792 AGCCCTGGTCCTCCACCAGCTGG + Exonic
1183358922 22:37373428-37373450 AGGCCGGCTTCACCTCCAGGTGG + Exonic
1184852484 22:47128370-47128392 ACTCCTGATTCTCCACCATGGGG - Intronic
951080444 3:18445203-18445225 CGCCCGGCTTCTCCCCCTGGCGG + Intronic
952220654 3:31320862-31320884 AGAGCTGCTTCTCTAGCAGGAGG + Intergenic
952529812 3:34251909-34251931 TGCCCTGCCTCTCCACAATGTGG - Intergenic
953134821 3:40173358-40173380 ATGCCTGCTTCCCCACCAGATGG + Intronic
953804424 3:46055759-46055781 ATCCCTGCTTGTCCAGCAGTAGG + Intergenic
954290423 3:49647030-49647052 AGCCCTGCTGCCAGACCAGGGGG - Intronic
954440567 3:50519659-50519681 ACCCCTGCATGACCACCAGGGGG + Intergenic
954595379 3:51819790-51819812 AGCCCTGCTCCTTCAGCATGGGG - Intronic
959262840 3:104103161-104103183 AGCCCTAGTTCTTCACCAAGTGG - Intergenic
963851719 3:150216395-150216417 AGCCCTGCTTCCCCTCCACAAGG - Intergenic
963882749 3:150546558-150546580 CGCCCTCCTTCTCCAGCGGGAGG - Exonic
964522561 3:157584293-157584315 TGCCCTGCTTCGGCACCTGGAGG - Intronic
965444690 3:168760491-168760513 AGCCCTAATTCACCAGCAGGAGG - Intergenic
966665349 3:182465178-182465200 CTCCCTGTTTCTCCACCAGAAGG - Intergenic
968371176 3:198223520-198223542 AGCCCTGCCTCAACACCTGGGGG - Intergenic
968904065 4:3443642-3443664 GGCCCGGCCTCACCACCAGGCGG - Intronic
969402036 4:6962114-6962136 ATCCCTCCTTCTGCAGCAGGTGG - Intronic
970000675 4:11363144-11363166 ATCCCTGGTTCTCCATCACGTGG - Intergenic
973619726 4:52714091-52714113 TGCCAGGCTTCTCCACCAGTCGG - Intergenic
974187158 4:58459583-58459605 AGCCCTCCTAGACCACCAGGAGG - Intergenic
974896093 4:67940964-67940986 TGCCATGCTTCTCCACCTGCAGG + Intronic
976970167 4:91094080-91094102 TGCCCTGCTTCGACACCTGGAGG - Intronic
978652414 4:111021958-111021980 AGTTCTGCTTCTCCACCAAAAGG + Intergenic
979259860 4:118635993-118636015 AGCCCTGCCTCAACACCTGGGGG - Intergenic
980682942 4:136187469-136187491 AGCCCTGCTTCTCTCCCGTGAGG - Intergenic
983282852 4:165702937-165702959 AGCCCTGTTCCTCCACCTGTAGG + Intergenic
984936439 4:184893914-184893936 AGCCCTGAGTCACCACCTGGAGG - Intergenic
1202757811 4_GL000008v2_random:81871-81893 AGCCCTGCTTCTGCTCCTGCAGG + Intergenic
985627153 5:995029-995051 AGGCCTGCAGCCCCACCAGGCGG - Intergenic
986012391 5:3727391-3727413 AGCCATGCTGCTCCACGAGAAGG - Intergenic
986467922 5:8045494-8045516 TGCCCAGCTTATCCAACAGGTGG - Intergenic
986785507 5:11110754-11110776 AGCCCTGCATTTTCATCAGGAGG - Intronic
992439332 5:76784460-76784482 ACCCCTTCCTCTCCACCAAGGGG - Intergenic
992813009 5:80408193-80408215 AGCCCTGCTGTTCCCACAGGGGG + Intronic
995473678 5:112527575-112527597 TGCCCTGCTTCAGCACCTGGAGG + Intergenic
997375383 5:133393929-133393951 AGCCTTCCTTCTGCACCAGGAGG + Intronic
997690967 5:135827294-135827316 ATCCCTGCTCCTCCACCCGATGG + Intergenic
998138783 5:139688462-139688484 AGCCCTTGTTCTCCGGCAGGAGG - Intergenic
999703692 5:154251556-154251578 TGCCATGTTTCTACACCAGGAGG + Intronic
999976672 5:156918474-156918496 AGCCCAGCTGCTCAATCAGGAGG + Intergenic
1001028862 5:168247146-168247168 AGATCTGCTTGTCCACCAGGGGG - Exonic
1001051256 5:168416289-168416311 AGCCCTGATCCACCACCAGTTGG + Intronic
1002549850 5:179979575-179979597 AGCCCTGCTTCTCCGCTAGAAGG - Intronic
1002730415 5:181329066-181329088 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1002754117 6:145038-145060 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1003962612 6:11222932-11222954 ACCACTGCTTCTCAACTAGGAGG + Intronic
1004047477 6:12040243-12040265 ATCTTTGCTTTTCCACCAGGTGG + Intronic
1006090186 6:31624184-31624206 AGTCCTGAGTCTCCACCAGTTGG + Intronic
1006269658 6:32954018-32954040 GGCCCTGCTACGCCACAAGGAGG + Intronic
1006833166 6:36981200-36981222 GGCCCTGCTACTCCAGCAGGAGG - Intronic
1007011881 6:38426061-38426083 AGCCCCTCCTCTCCACCTGGAGG - Intronic
1010739748 6:79486557-79486579 AGCACTGGTTCTCCACCATCCGG + Exonic
1011377597 6:86706642-86706664 AGCGCACCTACTCCACCAGGGGG - Intergenic
1011565200 6:88665859-88665881 CGCCCTGCTTCAGCACCTGGAGG + Intronic
1014547242 6:122747807-122747829 AGCCCTTCCTCTCCATAAGGAGG + Intergenic
1016902961 6:149120114-149120136 ATCCCTGCCTCTCCACCTGGAGG - Intergenic
1018740267 6:166723135-166723157 AGCCCAGCCTTCCCACCAGGCGG - Intronic
1018956497 6:168413615-168413637 CGCTCTGCTTGTCCAGCAGGAGG + Intergenic
1022308659 7:29174419-29174441 AGGTCTGCTTCTCCCCCAAGAGG + Intronic
1023109479 7:36794935-36794957 AGTCCTCCTTCCCCACCATGTGG + Intergenic
1023838610 7:44082761-44082783 AGCCCAGCCTCTCCTCCCGGAGG - Intergenic
1024075560 7:45816239-45816261 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1024334241 7:48188965-48188987 AGCCCTCCTACTCTTCCAGGAGG - Intronic
1025128850 7:56365222-56365244 AGCCCTGCCTCAACACCTGGGGG + Intergenic
1031018771 7:116604200-116604222 AGCCCCACTTCTCCACCTGTGGG + Intergenic
1031135151 7:117875756-117875778 GGGGCTGCTTCTCCACCAGGAGG + Intergenic
1032804089 7:135338822-135338844 ACCCCTTCTTCACCACCAGCTGG - Intergenic
1033994605 7:147330155-147330177 AGCCCTGCTTCCCTTCTAGGAGG - Intronic
1034269652 7:149797412-149797434 AGCCCTGCTCCTGCACCAGCTGG + Intergenic
1034468944 7:151245629-151245651 AGCCCGGATGCCCCACCAGGGGG - Exonic
1034503456 7:151467308-151467330 ACCCCTCCTCCTCCACCAGTAGG - Intronic
1034534644 7:151719352-151719374 AGCCCAGCTCCCCCAGCAGGAGG - Intronic
1034567392 7:151926380-151926402 TGCCCTGCTTCTCCACCTCCAGG + Intergenic
1036039651 8:5061004-5061026 AGCCCTGCTTCTGAGCAAGGAGG - Intergenic
1036807563 8:11845901-11845923 GAACCTGCTGCTCCACCAGGAGG + Intronic
1037799674 8:22025479-22025501 AGCTCTGCTTCCCCTCCAGCTGG - Exonic
1038427656 8:27474604-27474626 CTCCCTGCTTCTCCCCCTGGAGG - Intronic
1038923509 8:32112565-32112587 TGCTCTGCTTCTTCAGCAGGAGG + Intronic
1039556866 8:38482834-38482856 AAGCCTGTTCCTCCACCAGGAGG + Intergenic
1043812486 8:84758587-84758609 GGCCCTGGTTCTTCACCACGTGG + Intronic
1044692970 8:94896553-94896575 CGCACTGCTCCTCCACCCGGGGG - Exonic
1048165816 8:132060388-132060410 AGTCCTGCTTCTTCAGGAGGTGG - Intronic
1048280564 8:133102548-133102570 AGCCCTGATGCTCCACCGGTAGG - Intronic
1048434047 8:134399324-134399346 AGACCTGATTCTCCATCACGTGG + Intergenic
1048791773 8:138110848-138110870 ACTCTTGCTTCTCCATCAGGAGG - Intergenic
1048972170 8:139651270-139651292 AGCACTGCTCCTCCACCTGTGGG + Intronic
1049045874 8:140151143-140151165 ACCCCTACTTCTCCTCAAGGGGG + Intronic
1049261240 8:141640359-141640381 CCCCCTGCTTCTCCGCCAGCCGG - Intergenic
1049348473 8:142151713-142151735 AGCCCTGCAACGCCAGCAGGAGG + Intergenic
1049441598 8:142612214-142612236 AGCTCTGATTCTTCTCCAGGCGG + Exonic
1049729430 8:144168335-144168357 AGACCTGCTCCTGCACCAGGGGG - Exonic
1049785615 8:144449302-144449324 AGCCCTGCTCAGCCACCACGGGG + Intergenic
1049799083 8:144509504-144509526 AGCCCTGCGCGTCCACCAGCGGG - Exonic
1051503767 9:17805850-17805872 GGCCCTTCTCCTCCACAAGGAGG - Intergenic
1054852990 9:69867756-69867778 AGCCTTGATTCTCCTCCATGTGG - Intronic
1056154185 9:83817981-83818003 AGCTCCCCTTCTCCAGCAGGTGG - Intronic
1057436395 9:95044783-95044805 AGCCCTGCCTTACCACCAGGTGG - Intronic
1057875879 9:98754227-98754249 AGCCTTGCTGCTTCAACAGGTGG + Intronic
1059298635 9:113295268-113295290 AGCCCTCCCTCTCCATCAGCGGG + Intergenic
1060802670 9:126554496-126554518 AGGCCTGCTACTCCCCCAGGCGG + Intergenic
1060939279 9:127534462-127534484 AGTCCTGGGTCCCCACCAGGAGG + Intronic
1061670812 9:132187156-132187178 GCCCCTGCTCCTCCCCCAGGGGG - Intronic
1062081746 9:134627715-134627737 AGCCCGGCTTCCACCCCAGGTGG - Intergenic
1062754825 9:138281576-138281598 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1203538601 Un_KI270743v1:66735-66757 AGCCCTGCTTCTGCTCCTGCAGG + Intergenic
1203578733 Un_KI270745v1:25745-25767 AGCCCTGCCTCAACACCTGGGGG - Intergenic
1186587670 X:10893708-10893730 AGTGCTGTTTCTCCACCTGGGGG + Intergenic
1187913725 X:24133632-24133654 AGCCATGCTTCACTACCAAGAGG + Intergenic
1189975940 X:46461438-46461460 AGGCAGGCTTCTCCAGCAGGAGG - Intronic
1191103727 X:56759547-56759569 AACCCTGCTCCTCCACCCCGAGG - Intergenic
1191110279 X:56798929-56798951 AACCCTGCTCCTCCACCCTGAGG - Intergenic
1193070067 X:77297523-77297545 TGCCCTGCTTCAGCACCTGGAGG + Intergenic
1194684148 X:96891103-96891125 ACCTATGCTTCTCCACCAGTGGG + Intronic
1196080363 X:111624228-111624250 AGCCACGCTTCACCACCAAGAGG - Intergenic
1198636407 X:138706075-138706097 AGCCATGCTTCTTCATCAGTTGG + Intronic
1200323207 X:155211731-155211753 AGCCCTTCTTCCTCCCCAGGAGG + Intronic
1200394234 X:155973991-155974013 TGCCCTGCTTCAGCACCTGGAGG - Intergenic