ID: 919930501

View in Genome Browser
Species Human (GRCh38)
Location 1:202218252-202218274
Sequence CCTGCTATTCAGGGGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919930493_919930501 18 Left 919930493 1:202218211-202218233 CCTGCACTAGCAAATTGAAGGAG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919930501 Original CRISPR CCTGCTATTCAGGGGGTGTT TGG Intronic
900943843 1:5818256-5818278 CCTGATATTCCTGGGGTGTTGGG - Intergenic
902223022 1:14978817-14978839 GCTGCTATTCAGAGTCTGTTAGG + Intronic
915222563 1:154386760-154386782 ACTGCTAGTCAGAGGGTGTGGGG + Intergenic
916860817 1:168803075-168803097 ACTGCCATTCAGGGGGTCCTGGG - Intergenic
917065766 1:171091593-171091615 CCTTCTCTCCGGGGGGTGTTGGG - Intronic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
920087286 1:203426831-203426853 CCTTCGATTCATGGGGTGCTAGG + Intergenic
922463848 1:225833106-225833128 CCAGCTATTCAGGAGGTCTGAGG - Intronic
1068220821 10:54043500-54043522 CCAGCTATTCAGGAGGTGAGAGG - Intronic
1070419070 10:76218428-76218450 CCTGCAATGCAGGGAGTGATTGG + Intronic
1070624554 10:78041372-78041394 CCTGCTGGCCAGGGGGTGGTTGG + Intronic
1073374770 10:103023580-103023602 AGTGCTATTCAGTTGGTGTTGGG - Intronic
1073713151 10:106068972-106068994 CCTGCCATGCAGGGGGTGAGTGG - Intergenic
1079354214 11:19716209-19716231 CCTTTTATTCAGGGGATTTTTGG + Intronic
1080543642 11:33294718-33294740 CCAGCTACTCAGGAGGTGTGAGG - Intronic
1085304785 11:75479161-75479183 CCTGATACTCAGGGTGTGTGAGG - Intronic
1089627436 11:119760633-119760655 CCTGCTGTGCATGGGGTATTGGG - Intergenic
1090959476 11:131543421-131543443 CCTGCTCTTCTGTGGGTCTTGGG - Intronic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1101801377 12:108025138-108025160 CCAGCTATTCAGGAGGTGGGAGG - Intergenic
1107227948 13:38073421-38073443 CCAGCTTTTCAGGGGTTCTTAGG + Intergenic
1109766958 13:66913498-66913520 CCGGCTATGTAGGGGGTGTTGGG + Intronic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1113469649 13:110535323-110535345 CCTGGTGTTCAGGGTGGGTTCGG - Intronic
1114648400 14:24268358-24268380 GCAGCTATTCAGGTGGTGATAGG - Exonic
1119543250 14:75454287-75454309 CCTGCTCTTCAAGGGGTGGGTGG - Intronic
1121183455 14:91947110-91947132 GCTGCGATTCAGGCGGTGTCAGG - Intronic
1122052983 14:99072870-99072892 CCTGCAGTACAGCGGGTGTTTGG - Intergenic
1126689558 15:51278690-51278712 CCTGGGGTTCAGGGGGTGCTTGG + Intronic
1127258610 15:57311389-57311411 CCAGCTACTCAGGGGGGGTGAGG - Intergenic
1129756639 15:78102963-78102985 GCTGCTATCCATGGGGTGTGTGG - Intronic
1130013523 15:80170477-80170499 CCTGCTATCCACGGGCTATTCGG - Intronic
1130581171 15:85137885-85137907 CCCACTATTCAGGAGGTGGTCGG - Exonic
1131054026 15:89365125-89365147 CCTGCAATTCAGGCTGTGTCTGG - Intergenic
1131264145 15:90905884-90905906 CATGCTATTGAGGATGTGTTGGG - Exonic
1132807391 16:1781457-1781479 CCTGCTGTTCCGGGGGCGTCTGG + Exonic
1133484820 16:6209646-6209668 CCTGCTATTCAGAAGGTCTCAGG - Intronic
1133626871 16:7578434-7578456 AATGCGATTCAGGGTGTGTTAGG + Intronic
1133635348 16:7659770-7659792 CATGCTATTCAGAGGCTGTTTGG - Intronic
1134111505 16:11518049-11518071 CTTGCTATTCTGGGAGTGGTGGG - Intronic
1138925349 16:61583502-61583524 CCCGCCATTCAGCTGGTGTTTGG + Intergenic
1140227799 16:73092772-73092794 CCTGCTATTTATGGGTTGCTTGG + Intergenic
1140603473 16:76506313-76506335 ACTGTGATTCAGGGGGTGTGGGG + Intronic
1141736450 16:85857367-85857389 CCTGGTATTCAGGGGACGTCAGG - Intergenic
1142130606 16:88430112-88430134 CTTGCTCTTAAGGGGGTGTCCGG - Exonic
1144092651 17:11871892-11871914 CCTGGTGCTCAGGGGGTGGTGGG - Intronic
1148832961 17:50447423-50447445 CCAGCTACTCGGGGGGTGCTGGG + Intronic
1151928765 17:77217618-77217640 CCTGCCAATCAGTGGGTCTTCGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155926331 18:31659466-31659488 GCTGCTAAGCAGAGGGTGTTGGG + Intronic
1157403682 18:47406264-47406286 CCTGATATTCGGGGCCTGTTGGG + Intergenic
1159263762 18:66051886-66051908 CCTGTAGTTCATGGGGTGTTGGG - Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1162303146 19:9855647-9855669 CCTGCTATTCCGGGGGGCTGAGG - Intronic
1165020564 19:32920834-32920856 CCAGTGATTCAGGGGGAGTTAGG + Intronic
1165554203 19:36615995-36616017 CCTACATTTCTGGGGGTGTTAGG + Intronic
925942564 2:8834955-8834977 CCAGCTATTCAGGGAGGGTGAGG - Intronic
926157341 2:10463901-10463923 CCTGCTTTTCAGGGGGCCTGTGG + Intergenic
927948171 2:27149787-27149809 CCTGCTTATCAGGGTGTGCTGGG - Intronic
929216077 2:39414758-39414780 CCAGCTACTCGGGGGGTGCTGGG + Intronic
932398204 2:71462546-71462568 CCTGCTGTTCAGTGGGTCCTGGG + Intronic
933700200 2:85249586-85249608 CCTGCTTTTCTGGGGGTCTGCGG + Intronic
935701492 2:105815990-105816012 CCTGCTGTTCACCGGGTGTGTGG + Intronic
939159754 2:138574008-138574030 GCTGCTTTTGGGGGGGTGTTGGG + Intergenic
941939684 2:171021046-171021068 CCTGTTTTTCTGGGGGTGTGTGG + Intronic
945340261 2:208644275-208644297 CCTGCTCTTCAGGTGGTGGGTGG + Intronic
1169789426 20:9393467-9393489 CCTGCCATCTAGTGGGTGTTGGG + Intronic
1175223982 20:57434100-57434122 TCTGCTCCTCAGGGGATGTTGGG + Intergenic
1175824722 20:61930703-61930725 CCGGCTTTTCAAGGGGTGATAGG - Intronic
1178661549 21:34511163-34511185 CCTTCTCTTCAGGTGGTCTTAGG + Intergenic
1181163329 22:20970393-20970415 CCTGCTACTCAGGAGGTGGGAGG - Intronic
1182442631 22:30373184-30373206 CTTTCCATTCAGTGGGTGTTAGG + Intronic
1183117339 22:35702127-35702149 CCTGATATCCAGGGGGTGAGTGG - Intergenic
1183611182 22:38907457-38907479 CCTCCTGCTCAGGGGGTGTTAGG + Intergenic
1183749434 22:39711422-39711444 CCTGCTCGTCAGGGGGTGGGGGG + Intergenic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
1184272938 22:43395225-43395247 CCTGCGATTCAGGAGGAGCTGGG - Intergenic
949853089 3:8438565-8438587 CCTGATATGCAGTGGGTTTTTGG + Intergenic
950126920 3:10515233-10515255 CCTGCAATTATGGGAGTGTTGGG + Intronic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
953725828 3:45397917-45397939 CCTGAGATTCAGGGGTTGGTGGG - Intronic
955960637 3:64337851-64337873 CCTGCTATTGTGCGTGTGTTGGG - Intronic
956781102 3:72604058-72604080 CCCGCTATTCAGTGGGTTTCTGG + Intergenic
957707145 3:83803729-83803751 TCTCCTATCCTGGGGGTGTTGGG - Intergenic
958885769 3:99725228-99725250 CCTGCTGTCCAGGGAGAGTTCGG - Intronic
966846241 3:184132434-184132456 CCAGCTATTCAGGGGGGCCTAGG + Intergenic
966850794 3:184164072-184164094 CCTGCTATTGACGGGGTTGTTGG - Intronic
968262495 3:197336232-197336254 CCTGCTCTTCAGTGGGATTTGGG + Intergenic
971025579 4:22585861-22585883 CCTGCTATCCAGGGGGTTTGTGG - Intergenic
972333712 4:38086758-38086780 CCTGCTATTCAGAGTGTGCTTGG + Intronic
976729152 4:88244889-88244911 CCTGCCATTCAGCGGGTCCTGGG - Intergenic
987147822 5:15009879-15009901 CCTACTATTCATGGGTTGATTGG - Intergenic
988781962 5:34530450-34530472 CCAGCTATTCAGGGAGTCTGAGG - Intergenic
993835738 5:92818089-92818111 CCTGCTGTTCAGTGGGTTTCAGG - Intergenic
997123077 5:131196217-131196239 CCAGCTATTCAGGAGGTGTGAGG - Intronic
997542221 5:134672848-134672870 CCTGCTACTCAGGGAGGGTGAGG - Intronic
997871110 5:137505838-137505860 CTTTCTATCCAAGGGGTGTTTGG - Intronic
1001980552 5:176034902-176034924 CCTGCTCCCCAGGGAGTGTTGGG - Intergenic
1002108744 5:176893847-176893869 CCTGCTCTTCCTGGGGTGTCAGG - Intronic
1003598978 6:7500779-7500801 CCAGCTATTCGGGGGGTGGGGGG + Intergenic
1003928634 6:10901580-10901602 CCTGCGCATCAGAGGGTGTTTGG + Intronic
1007426064 6:41746973-41746995 CCTGCCATTCAAGGGCTGCTTGG + Intronic
1018280092 6:162176096-162176118 CCTGCTAAGCAGGGGGAGCTTGG + Intronic
1020264147 7:6549220-6549242 CCTGCAAATCAGGGGTTGCTTGG + Intronic
1022758802 7:33325635-33325657 CCAGGTATTCAGGGGGACTTGGG + Intronic
1029039092 7:97554265-97554287 CCTGCTACTCCAGGGGTGATCGG + Intergenic
1033078334 7:138270369-138270391 CCAGCTATTCAGGAGGTGGGAGG - Intergenic
1036692977 8:10956404-10956426 CCTGCTTTGTATGGGGTGTTGGG - Intronic
1037305728 8:17501547-17501569 CCTGTTATTCTGGGTGTGTATGG + Intronic
1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG + Intergenic
1044801338 8:95960091-95960113 CCAGCTATTCAGCGGGTGCGGGG + Intergenic
1046112811 8:109747016-109747038 CCTGTTTCTCAGCGGGTGTTAGG - Intergenic
1053737803 9:41112531-41112553 CCTGATATCCAGGGGGTGAGTGG + Intergenic
1054690546 9:68318789-68318811 CCTGATATCCAGGGGGTGAGTGG - Intergenic
1055664273 9:78538023-78538045 CATGCTATTCACGGGGTATGTGG - Intergenic
1058521665 9:105818693-105818715 CCTGATATTCAGGGGGTGAGTGG + Intergenic
1061879949 9:133563621-133563643 CCTGCCATTCTCTGGGTGTTGGG - Intronic
1185851830 X:3496348-3496370 CCTGGAATTCAGTGTGTGTTTGG + Intergenic
1195715183 X:107811538-107811560 CCTGTTATTCAGGTGTAGTTTGG + Intergenic
1200031205 X:153297363-153297385 GGGGCTATTCAGGGGGTCTTTGG - Intergenic
1201553708 Y:15246294-15246316 CCTGCTATGCAGGGTGAATTGGG - Intergenic
1201791728 Y:17848512-17848534 ACTGTTTGTCAGGGGGTGTTTGG + Intergenic
1201799645 Y:17941098-17941120 ACTGTTTGTCAGGGGGTGTTAGG + Intergenic
1201801908 Y:17964858-17964880 ACTGTTTGTCAGGGGGTGTTAGG - Intergenic
1201809826 Y:18057477-18057499 ACTGTTTGTCAGGGGGTGTTTGG - Intergenic
1202353333 Y:24018167-24018189 ACTGTTTGTCAGGGGGTGTTTGG + Intergenic
1202361898 Y:24119510-24119532 ACTGTTTGTCAGGGGGTGTTAGG - Intergenic
1202363175 Y:24133586-24133608 ACTGTTTGTCAGGGGGTGTTAGG + Intergenic
1202507604 Y:25536531-25536553 ACTGTTTGTCAGGGGGTGTTAGG - Intergenic
1202508880 Y:25550603-25550625 ACTGTTTGTCAGGGGGTGTTAGG + Intergenic
1202517446 Y:25651948-25651970 ACTGTTTGTCAGGGGGTGTTTGG - Intergenic