ID: 919933636

View in Genome Browser
Species Human (GRCh38)
Location 1:202237222-202237244
Sequence CTGGATGGAGGGAGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2022
Summary {0: 1, 1: 5, 2: 33, 3: 196, 4: 1787}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919933636_919933647 0 Left 919933636 1:202237222-202237244 CCCTCTCCTCTCCCTCCATCCAG 0: 1
1: 5
2: 33
3: 196
4: 1787
Right 919933647 1:202237245-202237267 CCTCACCCCTGGACAGGGCCAGG 0: 1
1: 0
2: 17
3: 285
4: 2478
919933636_919933652 22 Left 919933636 1:202237222-202237244 CCCTCTCCTCTCCCTCCATCCAG 0: 1
1: 5
2: 33
3: 196
4: 1787
Right 919933652 1:202237267-202237289 GCAACCCAGTGTGCCCCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 85
919933636_919933644 -5 Left 919933636 1:202237222-202237244 CCCTCTCCTCTCCCTCCATCCAG 0: 1
1: 5
2: 33
3: 196
4: 1787
Right 919933644 1:202237240-202237262 TCCAGCCTCACCCCTGGACAGGG 0: 1
1: 0
2: 4
3: 27
4: 275
919933636_919933643 -6 Left 919933636 1:202237222-202237244 CCCTCTCCTCTCCCTCCATCCAG 0: 1
1: 5
2: 33
3: 196
4: 1787
Right 919933643 1:202237239-202237261 ATCCAGCCTCACCCCTGGACAGG 0: 1
1: 0
2: 2
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919933636 Original CRISPR CTGGATGGAGGGAGAGGAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr