ID: 919933908

View in Genome Browser
Species Human (GRCh38)
Location 1:202239006-202239028
Sequence GCCCCAAGTGAGGACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 3, 1: 11, 2: 28, 3: 42, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919933902_919933908 -8 Left 919933902 1:202238991-202239013 CCCAAAATGGCGTCAGCCCCAAG 0: 11
1: 47
2: 46
3: 38
4: 93
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933897_919933908 24 Left 919933897 1:202238959-202238981 CCGGCGGGCTGAGGCGTAAAATG 0: 1
1: 2
2: 2
3: 2
4: 31
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933903_919933908 -9 Left 919933903 1:202238992-202239014 CCAAAATGGCGTCAGCCCCAAGT 0: 1
1: 1
2: 2
3: 11
4: 73
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933901_919933908 -7 Left 919933901 1:202238990-202239012 CCCCAAAATGGCGTCAGCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933900_919933908 -6 Left 919933900 1:202238989-202239011 CCCCCAAAATGGCGTCAGCCCCA 0: 1
1: 0
2: 2
3: 8
4: 132
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919933908 Original CRISPR GCCCCAAGTGAGGACGGGGC AGG Intronic
900399293 1:2466476-2466498 GCCCCAGGTGTGGAGGGGGAGGG - Intronic
900653394 1:3742414-3742436 GCACCAGGTGAAGGCGGGGCTGG - Intergenic
901454005 1:9353023-9353045 GCTCCCTGGGAGGACGGGGCAGG - Intronic
902234063 1:15046650-15046672 GCCCCAGGACAGGCCGGGGCAGG + Intronic
903078028 1:20787076-20787098 GCTCCCAGAGAGGAGGGGGCGGG - Intronic
904587259 1:31587182-31587204 CCTCCCAGTGGGGACGGGGCAGG + Exonic
905016339 1:34781360-34781382 GCGCCAAGCGGGGACCGGGCTGG + Exonic
905284899 1:36872955-36872977 GCCCTTAGTGAGGACGAGGGCGG - Intronic
906534337 1:46543491-46543513 GCCCAAAGTGAGGAGGGGATGGG - Intergenic
907069295 1:51519309-51519331 GCCGCAGGCGAGGCCGGGGCGGG + Exonic
909758988 1:79266052-79266074 CCACCAAGTGAGGACACGGCAGG + Intergenic
912388153 1:109282943-109282965 GCCCCCAGTGAGGAGAGGCCAGG - Intronic
912564949 1:110580749-110580771 CCCCCAAGTCAGGCCTGGGCTGG - Intergenic
915341570 1:155179441-155179463 GGCCCAAGAGAGAACGAGGCAGG - Intronic
918371987 1:183870165-183870187 GCCCCAAGTGAGGACGGGACAGG + Intronic
919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG + Intronic
920048920 1:203151620-203151642 GCCCCCTGTGAGGATGAGGCTGG - Intronic
920099104 1:203505790-203505812 GCCCCAGGGAAGGACGGGGAAGG + Intronic
922088346 1:222371940-222371962 CCCCCAAGTAAGGACAGGGCTGG + Intergenic
923288464 1:232520325-232520347 CCCCCAAGTGAGGAAGGGCTAGG + Intronic
924151532 1:241135062-241135084 GCCCCAAATGAGGACAGGACAGG - Intronic
924718951 1:246605534-246605556 GCGCCACATGAGGACGGGGCAGG + Intronic
924719320 1:246607564-246607586 GCCCCACGTGAGGACCGGGCAGG + Intronic
924722207 1:246634841-246634863 GCGCCACGTGAGGACGGGGCAGG + Intronic
924795693 1:247290715-247290737 GCACCAAGTGAGGACAGGGCAGG - Intergenic
1063655968 10:7989048-7989070 GCCCCAAGTGGTGGCAGGGCTGG + Intronic
1064637772 10:17386746-17386768 GCCCCAAATGAGGACGGGCAGGG + Intronic
1065867837 10:29928981-29929003 GCACCAAATGAGGATGGGGCAGG + Intergenic
1067057571 10:43061256-43061278 GACCCCAGTGAGGACGGAGATGG - Intergenic
1067278390 10:44853689-44853711 ACCCCAGCTGAGGAAGGGGCTGG - Intergenic
1067769784 10:49115185-49115207 GCCCCAGGCGAGGTCGGGACGGG + Intronic
1069550510 10:69360708-69360730 GCACCCAGAGAGGAGGGGGCAGG - Intronic
1069900581 10:71704676-71704698 GCACCAAGTGAGGCCGGTGATGG - Intronic
1069957140 10:72059160-72059182 TCCCCAAGTGGAGGCGGGGCGGG + Exonic
1071601374 10:86960148-86960170 GGCCCAGGAGAGGACTGGGCAGG - Intronic
1072289187 10:93947074-93947096 GGCCCAGGTCAGGAAGGGGCAGG + Intronic
1076066033 10:127448480-127448502 GCCCGACATGAGGATGGGGCTGG - Intronic
1076305104 10:129460807-129460829 GGCCCTGGTGAGGAGGGGGCTGG - Intergenic
1076321916 10:129589357-129589379 GGCCCAAGTGAGGCCCTGGCAGG - Intronic
1076406091 10:130213419-130213441 GCACCAAATGAGGGCGGGGCAGG + Intergenic
1076904589 10:133355694-133355716 GGCCCCAGTGGGGATGGGGCAGG + Intronic
1077026408 11:441858-441880 GCCCCAGGTGTGGGCGTGGCTGG + Intronic
1077028513 11:452428-452450 GCCCAAAGGTAGGAGGGGGCCGG + Intronic
1078003641 11:7516624-7516646 GCACCAAGTGAGGACGAGGCAGG + Intronic
1078004220 11:7520192-7520214 GCACCAAATGAGGACAGGGCAGG + Intronic
1078181762 11:9017591-9017613 GCCCCAGGAGAGGTCAGGGCTGG - Intergenic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1079318668 11:19431551-19431573 GGCCAAAGTGAGGTTGGGGCTGG + Intronic
1081011045 11:37812540-37812562 GCCCAAAGTCCGGAGGGGGCTGG + Intergenic
1081566674 11:44264822-44264844 TCCCGAGGTGGGGACGGGGCAGG + Exonic
1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG + Intergenic
1083744899 11:64729982-64730004 GCCAGAAGGGAGGGCGGGGCCGG + Intronic
1084118180 11:67053989-67054011 GCCCCAGGTGATGACTGTGCAGG + Intergenic
1085031636 11:73274836-73274858 GTCCCAAGGCAGGAGGGGGCAGG - Intronic
1085279406 11:75320257-75320279 GCCCAAGGTGGGGAGGGGGCTGG + Intronic
1087048176 11:93861869-93861891 CCCCAAAGTGAGGATGGGGCAGG + Intergenic
1087049385 11:93869962-93869984 GCCCCAAGTGAGGATGAGGCAGG + Intergenic
1087180242 11:95134888-95134910 GTCTCAAGTGAGGAAGTGGCAGG + Intergenic
1089642505 11:119857051-119857073 GCCCCAAGTGAGGACACTGCAGG + Intergenic
1090455066 11:126842007-126842029 GCACCAGGTGAGGATGGGGTAGG + Intronic
1091281207 11:134382921-134382943 GCCCCACGGGTGAACGGGGCAGG - Exonic
1092045930 12:5431947-5431969 TCCCGAAGTGAGGGCGGGGGGGG + Intergenic
1092265376 12:6976744-6976766 GCCCCAAATGAAGACTTGGCTGG + Exonic
1092283571 12:7115490-7115512 GCCCCAGGTGAGGACCAGCCAGG - Intergenic
1094508925 12:31084482-31084504 GCCCCCAGTGAGGAGGCGCCGGG + Intronic
1095215135 12:39538941-39538963 GCCCCAAGTGAGTATGGGACAGG - Intergenic
1096550152 12:52366930-52366952 TCCCCAAGGGAGGACAGGGCTGG + Intronic
1096870128 12:54587904-54587926 GCCCCCAGTTAGGAGGGGACAGG + Intronic
1098861410 12:75714984-75715006 GCACCAAGGAAGGAGGGGGCAGG - Intergenic
1098979203 12:76936805-76936827 GTAGCAAATGAGGACGGGGCAGG - Intergenic
1100089056 12:90947873-90947895 GCCCCAAGTGAGGACAGGACAGG - Intronic
1100299024 12:93290319-93290341 GCACCAAGTGAGGATGGGGCAGG + Intergenic
1100312704 12:93412260-93412282 GCCACAAGTGAGGATGGGGATGG - Intronic
1100482068 12:94988765-94988787 GCACCAAATGAGGATGGGGCAGG - Intronic
1102465378 12:113127924-113127946 GCCCCAAGAGAAGTGGGGGCAGG + Intronic
1103020279 12:117528445-117528467 CCCCCAAATGAGGATGGGGAAGG - Intronic
1103449460 12:121018252-121018274 GCACCAAATGAGGACGGGGCAGG + Intergenic
1103602684 12:122064149-122064171 GCCCCACTTAAGGACGGGGAGGG - Intergenic
1103692967 12:122790749-122790771 ACACCAAGTGAAGACAGGGCTGG - Intronic
1103905656 12:124326164-124326186 GCACCAGGTGGGGACAGGGCTGG - Intronic
1104479749 12:129097099-129097121 GCCCCAAATGTGGACAGGGCAGG - Intronic
1104806240 12:131591322-131591344 GCCCCAGGTGTGCAGGGGGCAGG - Intergenic
1106617925 13:31347469-31347491 GCCCCAAGTGAGGACGGGACGGG - Intergenic
1106831359 13:33586800-33586822 CACCCAAGTTAGGATGGGGCAGG - Intergenic
1110661374 13:78062119-78062141 GCCCCAAGTGAGGACAGGGCAGG - Intergenic
1114265490 14:21070627-21070649 GACCCAAGGGAGGATGGGGGAGG - Intronic
1114270551 14:21098059-21098081 GCCCCAAGGGAGGGGGGGCCAGG - Intronic
1116984260 14:51203296-51203318 GCCCCAAGGGAGGCCGTGGCAGG + Intergenic
1117969662 14:61239407-61239429 GCACCAAATGAGGACAGGGCAGG + Intronic
1120058095 14:79948917-79948939 TCCCCAAGTGAGGCCAGGTCAGG - Intergenic
1122360702 14:101160462-101160484 GCCCCAAATGAAGAGGGGGAAGG - Intergenic
1122599085 14:102912430-102912452 GCCCGCAGAGAGGGCGGGGCTGG - Intergenic
1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG + Intergenic
1123630264 15:22256274-22256296 GCCCAAGGTGTGGAGGGGGCTGG + Intergenic
1123909965 15:24956383-24956405 GCCGCCAGTGGGGAGGGGGCAGG + Intronic
1129110080 15:73332098-73332120 GCCCAGAGAGAGGACCGGGCTGG + Intronic
1129330855 15:74826515-74826537 GCCCCCAGTGAGGAGGGGTTTGG + Intergenic
1130306262 15:82713989-82714011 GCCCAGAGAGAGGAAGGGGCTGG - Intergenic
1130628043 15:85536096-85536118 GCCCAAAGAGAGGAAGTGGCCGG - Intronic
1131047460 15:89325417-89325439 GGCCCAGGGGAGGAAGGGGCTGG - Intronic
1132639820 16:972646-972668 GCCCCACCTGAGGACAGCGCAGG - Intronic
1133218400 16:4307397-4307419 GCGCCCAGGGAGGACAGGGCAGG - Intergenic
1133221628 16:4321392-4321414 CCCCCAAGTGAGGAGGGGAGGGG - Intronic
1134442517 16:14307712-14307734 GCCCAGAGTGAGAACTGGGCTGG + Intergenic
1137019888 16:35414705-35414727 GCCCCGTGGGTGGACGGGGCGGG - Intergenic
1137883374 16:52076355-52076377 GCCCCTAGTCAGGTCGGTGCTGG - Intronic
1140505731 16:75471028-75471050 GCCCTTAGTGAGGCCGAGGCAGG - Intergenic
1140820737 16:78660604-78660626 CCCCCAAGTGAGTAGGGAGCTGG - Intronic
1141972822 16:87494369-87494391 GCCCAAGGTGTGGAGGGGGCTGG - Intergenic
1142137563 16:88458663-88458685 GCCCCGAGTGTGGCCGGGCCGGG - Intronic
1142809066 17:2386860-2386882 GCCCCCAGTGGGGACAGGGAGGG - Exonic
1142904470 17:3033017-3033039 GCCCCATGTGGGGAGAGGGCTGG - Intronic
1143095716 17:4477287-4477309 GTCACAAGAGAGGACAGGGCTGG + Intronic
1143137376 17:4719414-4719436 GCACCATGTGAGGGTGGGGCTGG + Exonic
1144408354 17:14974592-14974614 GCCCAAAGGGAAGAGGGGGCAGG - Intergenic
1144663986 17:17089849-17089871 CCCCCAACTGAGGACGGGGCTGG - Intronic
1144944275 17:18961782-18961804 GCCCCAGGAGAGGAGAGGGCGGG - Intronic
1146120956 17:30194008-30194030 TTCCCAGGTGAGGATGGGGCTGG - Intergenic
1148125825 17:45236280-45236302 GCCCCCAGTGAGGACAGGCTGGG - Intronic
1148642911 17:49201583-49201605 GGCCCAAGGGTGGGCGGGGCTGG + Intergenic
1150069857 17:62141130-62141152 GCTCCAAGTGAGTCCGGGGCAGG - Intergenic
1150237887 17:63607825-63607847 GCACCAAGTGAGGAAGAAGCTGG + Exonic
1152342681 17:79733886-79733908 CCCCCCAGAGAGGACCGGGCAGG - Intronic
1152463603 17:80454020-80454042 GCCCTGAGGCAGGACGGGGCAGG + Intergenic
1152876519 17:82789599-82789621 GAGCCAGGTGAGGGCGGGGCAGG - Intronic
1153697527 18:7659518-7659540 GCTCCAAGTGAGGACAGGCCTGG + Intronic
1154293482 18:13130643-13130665 GCACCCAGTGGGGATGGGGCTGG - Intergenic
1155657466 18:28208966-28208988 GCACCAAATGAGAATGGGGCAGG + Intergenic
1155804226 18:30145487-30145509 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1156645496 18:39156452-39156474 TGCCCAAGTGAGGCCTGGGCAGG + Intergenic
1159915834 18:74186976-74186998 GCCCCAACTGAGGATGGGACAGG - Intergenic
1161128865 19:2576412-2576434 GACCCCAGGGAGGACAGGGCGGG + Intronic
1161222193 19:3122915-3122937 GCCCCATGGGGAGACGGGGCTGG + Exonic
1161257900 19:3320085-3320107 GCCCCGAGGCAGGACTGGGCTGG + Intergenic
1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
1163721510 19:18900210-18900232 GCCCCAGGTGAGGATGGGTTGGG + Intronic
1163722493 19:18904911-18904933 GCCCCAAGTGGGGACAAGGCAGG - Intronic
1163938747 19:20474095-20474117 GCACCAAATGAGGACGAGGCAGG + Intergenic
1164237622 19:23350850-23350872 GCCCCAAGTAAGGACAGGGCAGG - Intronic
1164308276 19:24024066-24024088 GCACTATGTGAGGACGAGGCGGG - Intergenic
1165422827 19:35730852-35730874 GCCACACCTGAGGAAGGGGCGGG - Exonic
1166210967 19:41306365-41306387 GCCCTAGGTGAGGGTGGGGCTGG + Intronic
1166249691 19:41560455-41560477 GCCCTAATGGAGGCCGGGGCAGG - Intronic
1167253611 19:48414654-48414676 GTCCCAAGGGAGGAGGGGGCTGG - Intronic
1167505175 19:49867453-49867475 GTCCCGGGTGAGTACGGGGCGGG - Exonic
1168325398 19:55536335-55536357 GGCCCAAGGGAGGAGGGGACTGG + Intronic
1168716088 19:58528260-58528282 GTCCCAAGTAAGGACAGGGCAGG - Intronic
926278728 2:11426493-11426515 GCCCCAAGTGATTACCGGACCGG - Intergenic
927931733 2:27049983-27050005 GGCCCACGTGAGGTCGGGGTCGG - Intronic
930533050 2:52614154-52614176 GGTCCAAATGAGGACAGGGCAGG - Intergenic
930762419 2:55050490-55050512 GCGGCAAGTGGGGACAGGGCGGG - Exonic
931275646 2:60741636-60741658 GCACCAAAAGAGGACGGGGCAGG + Intergenic
932023394 2:68111291-68111313 GTCCCTGGTGAGGACTGGGCAGG + Intergenic
932794608 2:74683437-74683459 CCCCGAGGTGAGGACGGGGATGG + Intronic
933246134 2:79976789-79976811 GCCCCAAGTGGGGAAGGAACTGG - Intronic
935754400 2:106265803-106265825 GCCCCAAGTAAGGATAGGGCAGG + Intergenic
935841528 2:107116890-107116912 TCCCCAGGTCAGGACCGGGCTGG - Intergenic
936151482 2:110024438-110024460 TCCCCAGGTGAGGCCTGGGCAGG + Intergenic
936193192 2:110346931-110346953 TCCCCAGGTGAGGCCTGGGCAGG - Intergenic
937902420 2:127031117-127031139 GCCCCAAGTGAGGACAGCCTCGG - Intergenic
938319796 2:130355530-130355552 GGCCCAAGGGAGGCCGGGGAGGG - Intergenic
939960568 2:148561673-148561695 GCCCGAAGTGGGGACCTGGCTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947384886 2:229580997-229581019 ACCCCCAGTGGGGATGGGGCCGG + Intronic
947524082 2:230868065-230868087 GCCCAGAGTGAGGGCGGGGTGGG + Intronic
948051568 2:234982853-234982875 GCTCCAAGGGAGGAAGAGGCAGG + Intronic
948683799 2:239658267-239658289 GACACAAGAGGGGACGGGGCGGG - Intergenic
949048719 2:241885398-241885420 GCCCCAGGTGGGGAGGTGGCAGG + Intergenic
1169324125 20:4661447-4661469 GCACCAGATGAGGACGGGGCAGG - Intergenic
1169327341 20:4686626-4686648 GACCCCAGTGAGGAGGGGCCGGG + Intronic
1171184853 20:23117992-23118014 GGCCCAAGGGAGGTCTGGGCAGG - Intergenic
1172117416 20:32581265-32581287 GGCCCAAGTGGGGGTGGGGCAGG - Intronic
1172326205 20:34037264-34037286 GCCCCAAATCAGCACTGGGCAGG + Intronic
1172697998 20:36835544-36835566 GACCCGAGTGGGGAGGGGGCGGG - Intronic
1172951648 20:38726468-38726490 GCCCCAAGGGAGGCCAGGGCAGG + Intronic
1174660702 20:52210485-52210507 GCCCGAAACGGGGACGGGGCAGG + Intergenic
1175903416 20:62368693-62368715 GCTCCAAGTGGGGGAGGGGCTGG + Intergenic
1178493882 21:33071052-33071074 TCTCCAAGTGAGGGCGGGCCTGG + Exonic
1178633486 21:34282440-34282462 GCCCCAAGAGAGGAAGTGTCCGG - Intergenic
1178824720 21:36005296-36005318 GCCCCAAATGAGCACGGGGCAGG - Intergenic
1179666563 21:42916867-42916889 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
1179667992 21:42925629-42925651 GCCCCAAGTGAGGAGGGGGCAGG + Intergenic
1180750462 22:18120898-18120920 ACCCCAAGAGAGGATGGGGAGGG - Intronic
1180953438 22:19730986-19731008 GCCCCTAGTGAGGGCGGGGAGGG + Intergenic
1181533986 22:23532395-23532417 TCCCCAGGTCAGGATGGGGCTGG - Intergenic
1181582629 22:23836656-23836678 ACACTGAGTGAGGACGGGGCAGG + Intronic
1181595473 22:23911762-23911784 GCCCCAGGTGAGGACGGGGCAGG - Intergenic
1182344142 22:29648498-29648520 GCACCAAGTGTGGAAGGGACGGG + Intronic
1182355582 22:29721040-29721062 GCCGCAGGTGGGGACGGGGGCGG - Intronic
1183485591 22:38086213-38086235 GCCCCAAGAGAGGGCGGGCAAGG + Intronic
1183934875 22:41256366-41256388 TCCCCAAGTGAGGATATGGCAGG + Intronic
1184168549 22:42744822-42744844 GCACCAAATGAGGACGGAGTGGG - Intergenic
1184409279 22:44317322-44317344 GCCCCGAGTAAGGACAGGCCTGG - Intergenic
1184596523 22:45517377-45517399 GCCCCAAGGGAGGAGCGGCCGGG - Intronic
1184662432 22:45971575-45971597 CCCCCAGGTGAGGACTCGGCAGG + Intronic
949877176 3:8633968-8633990 GCCCAGCGTGAGAACGGGGCAGG + Intronic
950860171 3:16140686-16140708 ACTCCAAGTGAGGTCGGAGCTGG - Intergenic
953064836 3:39459362-39459384 GCCCCAGGTGAGGAGGGGAAAGG - Intergenic
953465117 3:43113005-43113027 ACCTCAAGTGAGGACAGGCCAGG - Intergenic
954151009 3:48657075-48657097 GCTCCACGTGGGGCCGGGGCGGG - Exonic
954384847 3:50238579-50238601 GCCCCAGGTCAGGATGGGGAGGG + Intronic
954444444 3:50539366-50539388 TCCCCTAGGGAGGACGGGGGAGG + Intergenic
954558057 3:51533807-51533829 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
954573774 3:51663429-51663451 GCCCCAAGTGAGGTGGGGAGGGG - Exonic
954693752 3:52409826-52409848 GACCCAGGTGAGGAGGGGACCGG - Exonic
955161534 3:56468635-56468657 GCCGCTAGGGGGGACGGGGCTGG + Intergenic
960719908 3:120615914-120615936 GCACCAAATGAGGACGGGACAGG + Intergenic
960989295 3:123300379-123300401 GGCTCAAGTGAGGCCTGGGCTGG + Intronic
961328864 3:126127397-126127419 GCCCCAAGGGAGGGAGGGACGGG - Intronic
961812418 3:129529534-129529556 GCCCCCAGAGAGGAGGGGTCTGG - Intronic
965871800 3:173274314-173274336 GCACCAAATGAGGATGGAGCAGG - Intergenic
968462785 4:733574-733596 GCCCCCAGGGAGGACAGTGCAGG - Intronic
968589850 4:1451927-1451949 GCCCCCAGTGAGGACTCGCCAGG - Intergenic
969638624 4:8383594-8383616 ACCCCAAGTCAGGATGGGGCAGG - Intronic
971398332 4:26251387-26251409 GCCCCATGGGAGGCCGAGGCAGG + Intronic
971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
974489638 4:62548275-62548297 GCCCCAAATGAGGACGGGGGAGG + Intergenic
974950872 4:68582046-68582068 GCCCCAAGTGAGGATGGGACAGG - Intronic
974958413 4:68671998-68672020 GCCCCAAGTGAGGATGGGACAGG - Intergenic
977836207 4:101648499-101648521 GCCCCAAATGAGGGAGGAGCAGG + Intronic
980122010 4:128737444-128737466 GCCCCAAATGAGGACGGGGGAGG - Intergenic
980731952 4:136835290-136835312 GCCCCAAGTGAGGATGGCACAGG - Intergenic
983817993 4:172156110-172156132 GCGTCAAGTGAGGACGGGGCAGG + Intronic
985948073 5:3202098-3202120 ACCCCCAGTAAGGACGGCGCTGG + Intergenic
989003454 5:36784229-36784251 GCCCCAAATGAGGACTGGGCAGG - Intergenic
989043044 5:37249051-37249073 GCCCAGAGCGAGGACGGGCCCGG + Intronic
989095507 5:37777788-37777810 GCACCAAATGAGGATGGGGCAGG - Intergenic
989586186 5:43075393-43075415 GCCCCAAGTGAGGACGGTACAGG + Intronic
990184656 5:53200561-53200583 CCCCCAAATGAGGACGGGACAGG - Intergenic
990499312 5:56379504-56379526 GCCCCACCTGAGGATGGGTCAGG + Intergenic
991394666 5:66191705-66191727 TCCCCAAGTGAGGAAGTGGGAGG + Intergenic
992141937 5:73807179-73807201 GCCCCAAGTCTGGACAGAGCAGG - Intronic
994167845 5:96626466-96626488 GGCCCAAGTGAGGAAGAGGGAGG - Intronic
995852345 5:116559469-116559491 GCCCCAAGTGCGGATGGGGCAGG - Intronic
997749425 5:136330156-136330178 CCCCCATGTGGGGGCGGGGCAGG - Intronic
999413542 5:151374268-151374290 GCCCCAAGTGAGGACAGGACAGG - Intergenic
1001217608 5:169870341-169870363 GCCCCAAGTCATGACTTGGCTGG + Intronic
1001241234 5:170071296-170071318 GCTCCAAGTGAGCAGGGAGCAGG - Intronic
1002277771 5:178114465-178114487 GGCCCAAGTGAGGGCTGGCCTGG + Intronic
1002567059 5:180118215-180118237 GCCCCAAGTGGGGAGGAGCCTGG + Intronic
1006276844 6:33010901-33010923 CCCCCAAGTGAGGTGGGAGCTGG + Intergenic
1009950943 6:70394866-70394888 GCACCAAATGAGGATGGGGCAGG - Intergenic
1011813490 6:91160427-91160449 GCACCAAACGAGGATGGGGCAGG + Intergenic
1017015779 6:150098485-150098507 GCACCAAATGAGGACGGGGCAGG - Intergenic
1017016131 6:150100928-150100950 GCACCAAATGAGGATGGGGCAGG - Intergenic
1017822386 6:158059167-158059189 CCCTCAAGGGAAGACGGGGCAGG - Intronic
1018856955 6:167681692-167681714 CCCCCAAGAGAGGACGGGGGAGG + Intergenic
1019172801 6:170143681-170143703 GCCTTCAGTGAGGACGGGGAAGG + Intergenic
1019294399 7:266346-266368 CTCCCAGGTGAGGACGGCGCAGG - Intergenic
1019317029 7:391562-391584 GCCGCAAGTAAGGACAGGCCCGG + Intergenic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1020098489 7:5381313-5381335 GGCCCAAGTGGGGACCTGGCCGG + Intronic
1020117104 7:5482026-5482048 GCCCCAGGTGAGCCCGGGACGGG - Intronic
1023791874 7:43758909-43758931 GCCCGGAGTGAGGACGCGGTCGG + Intronic
1023908593 7:44538779-44538801 GGCCCAAGCGAGGAGTGGGCTGG - Intronic
1023915881 7:44588894-44588916 GTCCGAAGTGAGGAGTGGGCAGG - Intergenic
1026393498 7:69927757-69927779 GCCCCATGTGAGGCTGTGGCTGG + Intronic
1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG + Intronic
1029589834 7:101500100-101500122 GCCCCAAATGCAGAAGGGGCAGG - Intronic
1029739899 7:102485275-102485297 GTCCCTAGTGAGGGCTGGGCTGG + Intronic
1029757898 7:102584454-102584476 GTCCCTAGTGAGGGCTGGGCTGG + Intronic
1029775834 7:102683515-102683537 GTCCCTAGTGAGGGCTGGGCTGG + Intergenic
1029803349 7:102973468-102973490 GCACCAAATGAGTAGGGGGCAGG - Intronic
1029804148 7:102978581-102978603 GCACCAAATGAGTAGGGGGCAGG - Intronic
1030185412 7:106757058-106757080 GCACCAAATGAGGACAGAGCAGG + Intergenic
1030636483 7:111954718-111954740 GCCCCATGTGAGGACGGGGCAGG - Intronic
1034492199 7:151399410-151399432 GACCCAAGTAAAGACAGGGCTGG - Intronic
1034562973 7:151893669-151893691 TCCCCAAGCAAGGACAGGGCAGG - Intergenic
1034573835 7:151980437-151980459 GACCCAAGTGCAGACGGTGCAGG + Intronic
1034580324 7:152035838-152035860 GCCCCAAGTGAGGATGGGGAAGG + Intronic
1039794401 8:40899994-40900016 GCCCCAGGGGAGGCCAGGGCAGG - Intergenic
1040287276 8:46106860-46106882 CCCACAAGTGAAAACGGGGCCGG - Intergenic
1042157678 8:65863474-65863496 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1042158713 8:65870323-65870345 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1043506692 8:80909835-80909857 GCCCCAAATGAGGATGGGGCAGG + Intergenic
1043555061 8:81421077-81421099 TACCCAACTGAGGAAGGGGCTGG - Intergenic
1043768708 8:84169680-84169702 GCCCCAAGTGAGGACAGGCAGGG + Intergenic
1043856756 8:85273712-85273734 GCCCCAAGTGAGGATGGGGCAGG - Intronic
1043856790 8:85273896-85273918 GCCCCAAGTGAGGACAGGGCAGG + Intronic
1043857394 8:85277743-85277765 GCCGGAAGTGAGGACGGGGCAGG + Intronic
1050487524 9:6149616-6149638 GCACCAAATGAGGATGGGGCAGG - Intergenic
1053482256 9:38424299-38424321 GCCCCAAGTGTGGTCCGTGCCGG - Exonic
1058286822 9:103189077-103189099 GCCCCAACTGAGGATGGGACAGG + Intergenic
1059191797 9:112333720-112333742 GCCCCGAGGGAGGGCGGGGACGG - Intergenic
1060098199 9:120812765-120812787 GCCCCCAGTGAGGACAGTGGTGG - Intergenic
1060220049 9:121759733-121759755 GCCCTAAGTCAGGATGAGGCAGG - Intronic
1060798884 9:126531374-126531396 GCTCCAAGGGAGGACGTGCCTGG + Intergenic
1061050388 9:128191572-128191594 GGCCCAAATGCGGGCGGGGCCGG + Exonic
1061246500 9:129403568-129403590 TCCCCAGGTCAGGATGGGGCCGG + Intergenic
1061632758 9:131883527-131883549 GCACAAAGTGGGGAAGGGGCAGG + Intronic
1061713258 9:132502144-132502166 GCCTCAAATGAGGGCCGGGCAGG - Intronic
1061869423 9:133512991-133513013 ACGCCAGGTGAGGAAGGGGCAGG + Intergenic
1062040407 9:134401876-134401898 CCCCCAGGTGAGTGCGGGGCTGG + Exonic
1062326843 9:136016606-136016628 GCACCAAGTAGGGATGGGGCAGG - Intronic
1062608230 9:137358356-137358378 GCCACAGCTGAGGACAGGGCTGG - Intronic
1062677190 9:137753465-137753487 GTCCCACGTGAGGACGGTACCGG - Intronic
1187348836 X:18493045-18493067 GCCCCAAGTCAGGAGGGAACAGG - Intronic
1187888058 X:23907617-23907639 GCCCCAAGAGAGCGCGGGGAGGG + Intronic
1190302721 X:49065803-49065825 GCCCCGGGTGAGGACAGGGGTGG - Exonic
1192281948 X:69697160-69697182 GCACCAAATGAGGACAGGGCAGG + Intronic
1192282957 X:69703569-69703591 GCACCAAATGAGGCCAGGGCAGG + Intronic
1192946540 X:75969527-75969549 GCCCCAAGTGAGGACAGGGCAGG + Intergenic
1193911981 X:87317111-87317133 GCCCCAAAAGAGGACTGGACAGG + Intergenic
1195689700 X:107614215-107614237 GCGCCAGGTTAGGAAGGGGCAGG - Intergenic
1197947051 X:131851007-131851029 GCACCAAATGAGGACAGGGCAGG + Intergenic
1200084752 X:153598731-153598753 GCCCTAGGAGAGGACGTGGCCGG - Intronic