ID: 919933908

View in Genome Browser
Species Human (GRCh38)
Location 1:202239006-202239028
Sequence GCCCCAAGTGAGGACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 3, 1: 11, 2: 28, 3: 42, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919933897_919933908 24 Left 919933897 1:202238959-202238981 CCGGCGGGCTGAGGCGTAAAATG 0: 1
1: 2
2: 2
3: 2
4: 31
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933901_919933908 -7 Left 919933901 1:202238990-202239012 CCCCAAAATGGCGTCAGCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933902_919933908 -8 Left 919933902 1:202238991-202239013 CCCAAAATGGCGTCAGCCCCAAG 0: 11
1: 47
2: 46
3: 38
4: 93
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933903_919933908 -9 Left 919933903 1:202238992-202239014 CCAAAATGGCGTCAGCCCCAAGT 0: 1
1: 1
2: 2
3: 11
4: 73
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222
919933900_919933908 -6 Left 919933900 1:202238989-202239011 CCCCCAAAATGGCGTCAGCCCCA 0: 1
1: 0
2: 2
3: 8
4: 132
Right 919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG 0: 3
1: 11
2: 28
3: 42
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919933908 Original CRISPR GCCCCAAGTGAGGACGGGGC AGG Intronic