ID: 919934928

View in Genome Browser
Species Human (GRCh38)
Location 1:202245178-202245200
Sequence GGCAGATGGCCTCCCTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 286}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919934923_919934928 -4 Left 919934923 1:202245159-202245181 CCCCAGGGACGCACGAGGTGGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934920_919934928 5 Left 919934920 1:202245150-202245172 CCGAGGGGTCCCCAGGGACGCAC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934924_919934928 -5 Left 919934924 1:202245160-202245182 CCCAGGGACGCACGAGGTGGCAG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934912_919934928 27 Left 919934912 1:202245128-202245150 CCAGCTGTGCTGTAGGGCCCAGC 0: 1
1: 0
2: 1
3: 24
4: 270
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934925_919934928 -6 Left 919934925 1:202245161-202245183 CCAGGGACGCACGAGGTGGCAGA 0: 1
1: 0
2: 1
3: 10
4: 178
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934911_919934928 28 Left 919934911 1:202245127-202245149 CCCAGCTGTGCTGTAGGGCCCAG 0: 1
1: 0
2: 2
3: 21
4: 169
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934918_919934928 10 Left 919934918 1:202245145-202245167 CCCAGCCGAGGGGTCCCCAGGGA 0: 1
1: 0
2: 1
3: 24
4: 197
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286
919934919_919934928 9 Left 919934919 1:202245146-202245168 CCAGCCGAGGGGTCCCCAGGGAC 0: 1
1: 0
2: 3
3: 22
4: 196
Right 919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG 0: 1
1: 0
2: 3
3: 18
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919934928 Original CRISPR GGCAGATGGCCTCCCTGGCA TGG Intronic
900604162 1:3516427-3516449 GGCAGACGGCCTCCCCTGCCCGG - Intronic
901692059 1:10980183-10980205 GGCATTTGGCCTCCCTGGGCTGG - Intronic
901712291 1:11125111-11125133 GCTAGATGGCCTCTCTGGCATGG + Intronic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
903893115 1:26583418-26583440 GGCCCATGGCATCCCAGGCATGG + Intergenic
904613879 1:31739447-31739469 GGCAGCAGGCAGCCCTGGCAGGG - Exonic
905446247 1:38030083-38030105 GGCAGCTGGCCTCCCTGGGCAGG - Intergenic
905824142 1:41016443-41016465 GGCACATGGCCTGCCCAGCACGG - Intronic
905942195 1:41873109-41873131 GGCAGGCGGCTTCCCAGGCAGGG + Intronic
906480300 1:46194978-46195000 GGCAGTTAGCCTGACTGGCATGG + Intronic
906551840 1:46671851-46671873 GGCAGATGGGCTGACTGGCTGGG + Exonic
907335078 1:53694412-53694434 GGCAGAAAGGGTCCCTGGCAGGG - Intronic
907550181 1:55298549-55298571 GGCAGATGGGGTGCCTGGCTAGG + Intergenic
907976415 1:59435450-59435472 GGCACAGGGCCTCTGTGGCATGG - Intronic
911050441 1:93666408-93666430 GAGAGAAGGCCTCTCTGGCATGG - Intronic
919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG + Intronic
920196034 1:204228035-204228057 GTCAGCTGGTTTCCCTGGCAGGG + Intronic
921787965 1:219254805-219254827 GGCTGTTGGCCTCTCTAGCAAGG + Intergenic
923796800 1:237164585-237164607 GGCAGTAGGCCACCGTGGCAGGG + Intronic
1064958279 10:20935532-20935554 GGCAGATCTCCTCCTTTGCAAGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065324400 10:24538228-24538250 GCAAGCTGGCCTCCTTGGCAAGG - Intronic
1065490828 10:26280029-26280051 GGCAGCTGCCCTCACTGGCCAGG + Intronic
1065887678 10:30093208-30093230 GGTAGATTCCTTCCCTGGCATGG - Intronic
1069894965 10:71674848-71674870 GGAGGAGGGCCTCCCTGGGATGG + Intronic
1069919082 10:71805525-71805547 GGAAGATGGTCACCCTGGGAAGG + Intronic
1070824601 10:79384007-79384029 GGCACCTGGCCTGCATGGCAGGG + Exonic
1070828653 10:79405602-79405624 GTCTGAAGGCGTCCCTGGCAAGG + Intronic
1071557310 10:86614558-86614580 AGCAGATGGCCTCACTGCCATGG - Intergenic
1072061599 10:91817276-91817298 GGCAAATTTCCTACCTGGCAAGG - Intronic
1073549348 10:104382966-104382988 GGCAGCTGGCATCCCTGGATTGG - Intronic
1073579937 10:104656205-104656227 GGCATATGGCTTCTGTGGCAGGG + Intronic
1075573644 10:123562972-123562994 GGCACATTCCTTCCCTGGCAGGG - Intergenic
1075710257 10:124526958-124526980 GGCAGGTGGCCGGCCTGGCTAGG - Intronic
1075721985 10:124592770-124592792 GGCAGCTTGTCTCCCTGGCCTGG + Intronic
1076110024 10:127852976-127852998 GGCAGTTGGCTTCCCTGGGCAGG - Intergenic
1076151521 10:128165786-128165808 GGAACCTGGCCTCCTTGGCAAGG + Intergenic
1076756866 10:132577131-132577153 GGCAGAGGGACCCCCAGGCAGGG + Intronic
1077136198 11:1000384-1000406 AGCAGAGAGCCTCCCTGGCCTGG - Intronic
1077164649 11:1129580-1129602 AGTAGATGGCCTCCCCTGCAGGG - Intergenic
1077192205 11:1260242-1260264 GGGGCATGGCCTCCCGGGCAGGG - Intronic
1077348394 11:2075805-2075827 GGCAGATGCCCTCCCCAGCGTGG - Intergenic
1077404852 11:2378267-2378289 GGGAGATCGGCTCCCAGGCAGGG - Intronic
1077972319 11:7207399-7207421 CACAGAGGGACTCCCTGGCATGG + Intergenic
1078870578 11:15340462-15340484 GACTGTTGGCCTCTCTGGCAAGG + Intergenic
1079225795 11:18603687-18603709 GGCATTTGGCCTCCCAGGCAAGG - Intergenic
1080584541 11:33669329-33669351 GCAAGTTGCCCTCCCTGGCATGG + Exonic
1083418335 11:62539582-62539604 GGCAGTTGGCTTCCCTGCCAGGG + Intronic
1083871570 11:65491339-65491361 GGCAGATGGCCTCTGGGGCCCGG - Intergenic
1084449829 11:69229928-69229950 GGCAAAAGGCCTACCTGACATGG + Intergenic
1084593610 11:70104595-70104617 GCCAGCTGGCTTGCCTGGCAGGG + Intronic
1085231580 11:74976031-74976053 AGCAGTTGGCATCCCTGGCCTGG + Intronic
1085389485 11:76175239-76175261 AGCAGATGCCCTCCCAGCCAAGG - Intergenic
1085395532 11:76205372-76205394 GGCAGAGGGGCTCCCTGAGAGGG - Intronic
1085953965 11:81368318-81368340 CCCAGCTGGCTTCCCTGGCACGG + Intergenic
1087909156 11:103733072-103733094 GGCAGTTGGCCACCCTTGTAGGG - Intergenic
1089168768 11:116498333-116498355 TGCAGATGGCCACCCCAGCATGG + Intergenic
1089169603 11:116502880-116502902 GGCTGCTTGGCTCCCTGGCATGG - Intergenic
1089281668 11:117379179-117379201 AGCAGAAGGGCTCCCTGCCAGGG - Intronic
1089369641 11:117946306-117946328 GACAGAGGCCCTGCCTGGCAAGG - Intergenic
1090581029 11:128159241-128159263 GTCACATGGCCTCACTTGCAAGG - Intergenic
1091596249 12:1881004-1881026 GGCAGGTGTCCGCCCTTGCAAGG - Intronic
1091837504 12:3596020-3596042 GGTAGATGGCCTCCATGGGGTGG - Intergenic
1093196025 12:16130289-16130311 GAAAGATGCCCTCCCTAGCAAGG - Intergenic
1095720848 12:45399083-45399105 GTCAGCTGGCCTCCTGGGCATGG + Intronic
1096108937 12:49017720-49017742 CGCAGTTGGTCTCCCAGGCAAGG - Intronic
1099137030 12:78918313-78918335 GGCAGATAACCTGCCTGGAATGG - Intronic
1101445466 12:104734075-104734097 GGAAGCTGGCCCTCCTGGCAGGG - Intronic
1101446750 12:104742358-104742380 GGTTGACGGCCTCCCTGGCTAGG + Intronic
1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG + Exonic
1103763375 12:123266490-123266512 GGAAGATGCTCTCCCTGGCTGGG - Intronic
1104604871 12:130180512-130180534 GACAGATGGTTTCCCTGGAAAGG - Intergenic
1105239736 13:18598690-18598712 GGCAGCTTCCCGCCCTGGCAAGG + Intergenic
1105840653 13:24251295-24251317 CACAGATGGCCACCCTGGCCGGG + Intronic
1106077488 13:26473948-26473970 GTCTGAGGGCCTCTCTGGCACGG + Intergenic
1107720018 13:43238554-43238576 GGCAGATGGACTTCCAGGCCTGG + Intronic
1109225999 13:59696440-59696462 GGCATTTGTCCTCCCTGTCATGG - Intronic
1109323983 13:60845657-60845679 GGAGGATTGCCTCCCTGTCAGGG + Intergenic
1112064620 13:95780169-95780191 GGCAGATGACCTCCTGGCCATGG - Intronic
1113615705 13:111679055-111679077 AGCAGGTGGGCTTCCTGGCACGG - Intergenic
1113621173 13:111763957-111763979 AGCAGGTGGGCTTCCTGGCACGG - Intergenic
1113709115 13:112452516-112452538 GGCTGCTGGCCTGCCAGGCATGG - Intergenic
1114278871 14:21171586-21171608 GACTGTTGGCCTCTCTGGCAAGG - Intergenic
1114535854 14:23422033-23422055 GGGAAAAGGCCTCCCAGGCAAGG - Intronic
1116258274 14:42586198-42586220 GGCAGCTGGCTTCTATGGCATGG + Intergenic
1118447434 14:65864449-65864471 AGCACATGGCTTCCCTGGAAAGG + Intergenic
1118730082 14:68659772-68659794 GGCAGGTGTGTTCCCTGGCAGGG - Intronic
1121017641 14:90558156-90558178 GCCAGAGGGGCACCCTGGCACGG - Intronic
1121315150 14:92956962-92956984 GGCAGGTGGCCTTCCTAGCTGGG - Intronic
1122179151 14:99943148-99943170 GACAGATGGCCTCCCTGCCCTGG - Intergenic
1122179455 14:99944611-99944633 GTGAGAGGGACTCCCTGGCAGGG + Intergenic
1122207446 14:100155045-100155067 GGCATTTGGCCTCCCTGGGAAGG - Intronic
1122500024 14:102191283-102191305 GGCAGATGGCTTCCCAGGCAGGG - Intronic
1122840875 14:104461962-104461984 GGCAGGGGGGCTCCGTGGCACGG + Intergenic
1123491510 15:20785394-20785416 GGCAGGTTCCCGCCCTGGCAAGG - Intergenic
1123548014 15:21354488-21354510 GGCAGGTTCCCGCCCTGGCAAGG - Intergenic
1123921195 15:25070996-25071018 GTCACAGGGCCTCCCTGGCAGGG + Intergenic
1124621995 15:31279086-31279108 GGAAGAAGGCCTCACGGGCAGGG + Intergenic
1125359267 15:38848522-38848544 GGTAGATGGTCTCCCTTGAAAGG - Intergenic
1125657141 15:41367319-41367341 GCCACATGCCCTCCCTGGAACGG - Intronic
1125922229 15:43531814-43531836 GGCAGAAGGCCTCCTGGGAAGGG + Intergenic
1126107473 15:45156121-45156143 GGAAGCTCGGCTCCCTGGCATGG + Intronic
1127331458 15:57943914-57943936 GGCAGAAGCCCTTCCTGGCATGG + Intergenic
1128773571 15:70301789-70301811 GACAGATGGCCAACCTGGGAGGG + Intergenic
1202956344 15_KI270727v1_random:81718-81740 GGCAGGTTCCCGCCCTGGCAAGG - Intergenic
1132524505 16:407648-407670 GGCAGCTAGGTTCCCTGGCATGG - Intronic
1132605500 16:792173-792195 GGCAGTGGGCGTCCCTGGCAGGG - Intronic
1132643779 16:989643-989665 AGCAGATGTCGTCACTGGCAGGG - Intergenic
1132688013 16:1170332-1170354 GGCAGCAGGGCTCCCTGGGACGG + Intronic
1132890061 16:2199403-2199425 GGCAGGTGGCCACTCTGGCTGGG + Intergenic
1134690855 16:16190332-16190354 GGCAGAAGGACTCACGGGCACGG - Exonic
1141691609 16:85599965-85599987 GGCAGCTGTCCTCCCTGTGACGG + Intergenic
1141788308 16:86216403-86216425 CACAGATAGCCTCCCTGTCATGG + Intergenic
1141798574 16:86291628-86291650 GTCAGATGGCCTCTCTGTCTGGG - Intergenic
1141893395 16:86942979-86943001 GGCTGCTGGCCTCCCTCACAAGG - Intergenic
1142287051 16:89175754-89175776 GGCAGAGAGCTTCCCCGGCAGGG + Intronic
1142647474 17:1324169-1324191 GGCAGATGACCTCCTTTGCAAGG - Intergenic
1143025008 17:3936375-3936397 GACAGACGGCCTACCTGCCACGG - Exonic
1144493186 17:15731848-15731870 GGCAGGTCCCCTCCCTAGCAGGG - Intergenic
1144907070 17:18644804-18644826 GGCAGGTCCCCTCCCTAGCAGGG + Intronic
1145213561 17:21034614-21034636 GGCAGGTGGCCTAGATGGCACGG - Intronic
1146751743 17:35388186-35388208 GACTGTTGGCCTCCCTAGCAAGG + Intergenic
1147902706 17:43799728-43799750 GGCAGCTGCCCTCCCTGGCCTGG + Intergenic
1148209542 17:45799948-45799970 GGGAGAGGGCCTTCCCGGCAAGG - Intronic
1148806278 17:50265574-50265596 GCCATATGGTCTCCCTTGCAGGG - Intergenic
1150333750 17:64315105-64315127 TGCAGATGGTGTCTCTGGCAGGG - Intergenic
1150511114 17:65754175-65754197 AACAGATGGCCTCCCTGAGAGGG + Intronic
1150656117 17:67040806-67040828 GGGAAATGGCCACCGTGGCAGGG + Intergenic
1151270937 17:72995540-72995562 GGCAGATGGCCCTCCCAGCATGG + Intronic
1151377384 17:73699204-73699226 TGCCGAGGGCTTCCCTGGCATGG - Intergenic
1151557078 17:74852014-74852036 TGTAGAAGGCCTCCCGGGCAGGG + Exonic
1152550428 17:81027206-81027228 CGCAGATGGCTTCCCTGCCCGGG - Intergenic
1152632350 17:81415911-81415933 GGCCCATGGTCTCCCTGGCAGGG - Intronic
1152795737 17:82305241-82305263 GGCAGATGGGATCTCTGACATGG + Intergenic
1154449093 18:14460084-14460106 GGCAGCTTCCCGCCCTGGCAAGG - Intergenic
1154981779 18:21508461-21508483 GGCTGATGCCCTCCATGGCGTGG - Exonic
1155074433 18:22342300-22342322 GGCCAGTGGCCTCCTTGGCAAGG - Intergenic
1157312395 18:46561881-46561903 GCAAGCTGGCCTCCTTGGCAAGG - Intronic
1157930076 18:51812106-51812128 TGCAGATGGCCACCCTTGCTGGG - Intergenic
1158068407 18:53441106-53441128 GGAAGATTCCCTCCCTGCCAAGG - Intronic
1160088977 18:75808164-75808186 GGCAGATGGGCTCCCCAGGATGG - Intergenic
1161211036 19:3065847-3065869 GGCAGGTGGCCTCCCAGGAGAGG - Intergenic
1161326255 19:3665657-3665679 GGGAGATGGTCTCACTGGCCAGG + Intronic
1162895913 19:13764690-13764712 CGCGGATGGCCTCCCAGGCCTGG - Exonic
1163686665 19:18715752-18715774 TGCAGGTGGGCTCCCAGGCAGGG + Intronic
1165063016 19:33214050-33214072 GGCAGAGGGGATGCCTGGCAGGG - Intronic
1165073146 19:33267250-33267272 GTCAGATGCGCTCCCTGGCCAGG + Intergenic
1165480209 19:36058850-36058872 GCCATGTGGCCTACCTGGCAGGG + Exonic
1165894210 19:39131723-39131745 AGCAGATGGCCTCCCAGCCTGGG - Intronic
1165990822 19:39812323-39812345 GGCAGATGTGATCCATGGCATGG + Intergenic
1166044759 19:40223400-40223422 GGCTGCTGGCCGCGCTGGCAGGG - Exonic
1166312503 19:41970573-41970595 GGGAGTGGGGCTCCCTGGCATGG - Intronic
1167467218 19:49656677-49656699 GGCAGAGAGCCTCCGAGGCAAGG - Intronic
1168303341 19:55419558-55419580 GGCAACTGCCCTCCCAGGCATGG + Intergenic
925091026 2:1156157-1156179 GGTAGAAGGGTTCCCTGGCAAGG + Intronic
926117414 2:10222189-10222211 CCCAGTTGGCCTCCCGGGCATGG + Intergenic
926157590 2:10465725-10465747 TGCAGATGGGCTCCAAGGCATGG - Intergenic
927100410 2:19783697-19783719 AGCAGCTCACCTCCCTGGCATGG + Intergenic
927483051 2:23469348-23469370 GGCAGCTGGCCTGCCCGTCAGGG + Intronic
927882808 2:26700504-26700526 GGCTGGTGGCCTCTCTGGCTGGG + Intronic
928100875 2:28436845-28436867 GTGAGATGTCCTCCCAGGCAGGG + Intergenic
930939328 2:56995875-56995897 GGCTGTTGGCCTCTCTAGCAAGG + Intergenic
937644699 2:124253479-124253501 GGCAGCTGGCATACCTGCCAAGG - Intronic
937775778 2:125774291-125774313 GGCAGATGGCTTACCTGGACAGG + Intergenic
940851279 2:158690198-158690220 AGCATCTGGCCTCCCTCGCAGGG + Intergenic
947728616 2:232416210-232416232 GGCAGGTGGCCTGCATGGCCCGG - Intergenic
948343248 2:237272468-237272490 GGCTGTTGGGCTCTCTGGCAAGG - Intergenic
948643507 2:239389794-239389816 GGGAACTGGCCTCCCTGGTATGG - Intronic
949049729 2:241890996-241891018 GACACCTGGCCTCCTTGGCAAGG + Intergenic
1168802201 20:650816-650838 GGCACAAGGCCTGCCTGGCACGG - Intronic
1168887249 20:1268089-1268111 TGCAGATGGTGTCCCTGCCAGGG + Intronic
1172262114 20:33576361-33576383 GGTAGATGGGCACTCTGGCAGGG - Intronic
1172795501 20:37534422-37534444 GGGAGAGGCCCTCCCTGCCAGGG - Intergenic
1173114861 20:40231502-40231524 CGGAGATGGCCTCTTTGGCATGG - Intergenic
1173849393 20:46208329-46208351 GGCAGCTGGGGTCCCTGGAAGGG - Intronic
1173947560 20:46963751-46963773 GGCAGCTGGCCTCCCTGAGGAGG + Intronic
1174121738 20:48271039-48271061 GGGAGATGGCCCTCCTGGCCAGG + Intergenic
1175173044 20:57093126-57093148 GGCACCTGGCCTCCCTGCCCAGG - Intergenic
1175179178 20:57133014-57133036 TGCATATGGACTTCCTGGCATGG - Intergenic
1175194504 20:57233570-57233592 GACAGAAGTCTTCCCTGGCATGG - Intronic
1175318570 20:58069638-58069660 GGCTGATGGCGTCCCTGCCCTGG - Intergenic
1176019401 20:62954772-62954794 GGCAGATTGCTTGCCTGGAAGGG + Intronic
1176296376 21:5075553-5075575 GGCAGATGTCATGCCAGGCACGG + Intergenic
1176447117 21:6830418-6830440 GGCAGGTTCCCGCCCTGGCAAGG + Intergenic
1176825288 21:13695444-13695466 GGCAGGTTCCCGCCCTGGCAAGG + Intergenic
1176920799 21:14685040-14685062 GGCAGATGGTGACCCTGGAATGG - Intergenic
1178676054 21:34632653-34632675 TGCAGATGACCTACGTGGCAGGG - Intergenic
1178678018 21:34647406-34647428 GGGAGATGGCATTCCAGGCAAGG - Intergenic
1178719211 21:34993034-34993056 CCCAGATGCCCTTCCTGGCAGGG - Intronic
1179860673 21:44186568-44186590 GGCAGATGTCATGCCAGGCACGG - Intergenic
1180075343 21:45459035-45459057 GGGACACGGCCTCCCTCGCACGG - Intronic
1180255740 21:46626163-46626185 GGCAAAGGGCCTCCCAGGGATGG - Intergenic
1180626904 22:17199561-17199583 GGGAGATGGATTCCCTGGAATGG - Intronic
1180941468 22:19662084-19662106 GGCAGATTTCCTCCCTCACAGGG + Intergenic
1180951175 22:19721298-19721320 GGCAGGTGGCCACCAGGGCAGGG + Intronic
1181433258 22:22895502-22895524 GGCAGATGGCAGCCCCGTCAAGG + Exonic
1181438264 22:22922721-22922743 GGCAGATGGCAGCCCCGTCAAGG + Intergenic
1183457725 22:37931878-37931900 GGCAGGTGGCCTCACTGGCTTGG - Exonic
1183662180 22:39227720-39227742 CCCAGGTGGCCACCCTGGCAGGG + Intronic
1184102673 22:42349026-42349048 GGCAGATATCCTCCCTCCCAGGG + Intergenic
1184812638 22:46847025-46847047 GGCTGATGGCCTCCAAGGCCCGG - Intronic
1184818069 22:46887149-46887171 GGCAGATGGCCTCATGGGAAGGG + Intronic
1184944732 22:47795109-47795131 GGTACATGGACTCCCTGCCATGG + Intergenic
1184973235 22:48042873-48042895 GGCAGCTGCTCTACCTGGCATGG - Intergenic
1185009384 22:48304810-48304832 CGCAGAAGGGCTCCCAGGCAGGG - Intergenic
1185302247 22:50088003-50088025 GGCTCATGGGCTCCCTGCCAGGG - Intergenic
1185330150 22:50248796-50248818 CCCAGAAGCCCTCCCTGGCAAGG + Intronic
954329339 3:49881191-49881213 GCCAGATGGCGTCCCTGTGAGGG + Intergenic
954368651 3:50158926-50158948 GGCAGAAGGACTTCCTGCCAGGG - Intronic
954422688 3:50426939-50426961 GGGAGCTGGTCTCCCTGGGAAGG - Intronic
954614773 3:51964055-51964077 GTCAGCAGGGCTCCCTGGCAGGG + Intronic
954791166 3:53134656-53134678 GCCAGGTAGCCTCCCTGCCAGGG + Intergenic
956497161 3:69840169-69840191 GACAGATGACCACCCTTGCAAGG - Intronic
956665978 3:71642458-71642480 GGGAGCTGGGCTCACTGGCAGGG + Intergenic
956789482 3:72669438-72669460 GGCAGAGGGACTCCATGTCATGG - Intergenic
959486801 3:106936170-106936192 TGCAGGTGGTCTCCCTGGAATGG - Intergenic
960763573 3:121099137-121099159 GGCAGATTGGTTCCCTGGTAAGG - Intronic
961449884 3:126997915-126997937 GGCTCATGGCCAGCCTGGCAGGG + Intronic
963053174 3:141159736-141159758 GACTGATGGCCTCTCTAGCAAGG - Intergenic
963926945 3:150960879-150960901 AGCTGAAGGCCTCCCTGCCAAGG + Intronic
965493316 3:169366618-169366640 GGCAGCTGGCCTCTGTGCCAGGG + Intronic
965810852 3:172590522-172590544 GACTGTTGGCCTCTCTGGCAAGG + Intergenic
966481237 3:180411502-180411524 CCCAGGTGGCCTCCATGGCAGGG + Intergenic
967502909 3:190221153-190221175 GACTGTTGGCCTCCCTAGCAAGG + Intergenic
968698450 4:2043622-2043644 GGCAGGTGGGCACGCTGGCATGG + Intronic
968902703 4:3438939-3438961 AGCAGGTGGCCAGCCTGGCAGGG + Intronic
974250332 4:59376618-59376640 AGGAGATGGCCTCTCTGCCAGGG + Intergenic
976053230 4:81031894-81031916 GGCAGGAGGCCTCACAGGCATGG - Intronic
976436084 4:85019709-85019731 TGGAGATGGCCTCACTGACAAGG - Intergenic
978154210 4:105471751-105471773 GCCAGATGGCATCACTGGCCAGG - Intronic
978364787 4:107970061-107970083 GGAAGGTGGCCTCACTGGGAGGG + Intergenic
979806375 4:124977105-124977127 GGAACATGGCATCCCTGGAAAGG + Intergenic
979831742 4:125314219-125314241 GGCAGGAGGCCTCCGTAGCAAGG - Intergenic
981057743 4:140383152-140383174 GGAAGATGGCTTCCCAGCCAGGG - Exonic
985497723 5:218805-218827 GGCCGGTGGCCGCCCTGGCTGGG + Intronic
985552046 5:538668-538690 GGGAGATGGCGTCCCTGACTTGG + Intergenic
986213401 5:5695127-5695149 TGGAGCTGGCCTCCCTGGCCAGG - Intergenic
986300090 5:6471532-6471554 GGCAGCTGGCCTCCCTCATAGGG + Intronic
987975500 5:25010210-25010232 GGCAGATGTCCACTCTGGTAGGG + Intergenic
989994231 5:50808555-50808577 CCCAGATGGCCTCCCTCACAAGG - Intronic
991157977 5:63460582-63460604 GGCTGTTGGCCTCTCTAGCAAGG - Intergenic
995375906 5:111474383-111474405 TGCAGATGGCCGCCCTCTCACGG + Intronic
998500292 5:142626768-142626790 GGCAAATGGCTGCCCTGACAAGG - Intronic
998666902 5:144308006-144308028 GACAGATGGTCTGCCTGGCTTGG + Intronic
1001935025 5:175697551-175697573 GGGAGCTTGCCTCTCTGGCAAGG - Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1005472716 6:26177754-26177776 AGAAGATGTCCTCCCTGGCTGGG - Intergenic
1005498466 6:26409557-26409579 GGTGGATCGCCGCCCTGGCAGGG + Exonic
1005672259 6:28118627-28118649 GGCATTTGGCCTACGTGGCATGG - Intergenic
1006389376 6:33749556-33749578 GGCAGATGGCCCCACTGACTAGG + Intergenic
1006389747 6:33751409-33751431 GGCAGATGGCCCCACTGACTGGG + Intergenic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1013045126 6:106478002-106478024 GGCTGTTGTTCTCCCTGGCAAGG + Intergenic
1013624107 6:111920080-111920102 GGCCGATGGGCACCCTGGCCTGG + Intergenic
1017233782 6:152098939-152098961 GGCAGAGGGTTTCCCTGCCACGG + Exonic
1018232670 6:161690613-161690635 AGCAGATGGCCTCCCCAGAATGG + Intronic
1019477939 7:1252937-1252959 AGCTGATGGCATCCCTGGCCAGG - Intergenic
1019927136 7:4200652-4200674 GGCAGCTGGCTTCCTTAGCATGG + Intronic
1021485781 7:21166926-21166948 GCCAGATCACCTCACTGGCAGGG + Intergenic
1022540845 7:31134392-31134414 AGCAGCTGGCCTCCCTGAGAGGG + Intergenic
1022749249 7:33206088-33206110 CGCAGATGACCTCCCTGCCAGGG - Intronic
1022785149 7:33631227-33631249 GGCTGAGGGTCTCCCTGGAACGG - Intergenic
1023763006 7:43484135-43484157 GGAAGCTGGGGTCCCTGGCAGGG - Intronic
1023959091 7:44912083-44912105 GGCAGATGGCCTCTGCAGCAGGG + Intergenic
1024977342 7:55126030-55126052 GGCAGGGGACCTTCCTGGCAGGG - Intronic
1026524222 7:71140471-71140493 GGCAGCTGCCCCCACTGGCAGGG - Intronic
1027946952 7:84759124-84759146 AGCAGATGGCCTCCATTGAAGGG + Intergenic
1028567912 7:92253303-92253325 GGGAGATGGTCTACATGGCAGGG - Intronic
1028667345 7:93362285-93362307 GGCAGAAGGCCTCCCTTGAGAGG + Intergenic
1031129552 7:117816075-117816097 GGAAGATTGCCCCCCTGGGAAGG - Intronic
1032464356 7:132134564-132134586 GACAGCTGTGCTCCCTGGCAAGG + Intronic
1036288754 8:7468395-7468417 ACAAGATGGCCTCCTTGGCAAGG + Intergenic
1036332721 8:7843133-7843155 ACAAGATGGCCTCCTTGGCAAGG - Intergenic
1037432966 8:18832977-18832999 GGCAGATATGCTCTCTGGCATGG + Intronic
1037645541 8:20789624-20789646 TGCAGCTGGCCACCCGGGCACGG - Intergenic
1038287024 8:26214277-26214299 GGCTGATGGCCTCTCTCTCATGG + Intergenic
1047333413 8:123913551-123913573 GGCAGGTGTCCTCCCTTGCTGGG + Intronic
1048338652 8:133522297-133522319 TGCAAATGGCTTCCCTGGAATGG + Intronic
1049661289 8:143820816-143820838 GGCAGGCGGCCTCCCTGGCAGGG - Intronic
1049758391 8:144320879-144320901 GACACAAGGCCTCTCTGGCAGGG - Intronic
1049797706 8:144504133-144504155 CGCAGCTGGCCTCACTGGGAGGG - Exonic
1051632761 9:19155600-19155622 GGCAGAGAGCCTCTCAGGCAAGG + Intergenic
1054756625 9:68965311-68965333 GGCAGAGGGTGTCCCTGGAAAGG + Intronic
1055079746 9:72257523-72257545 GGAGGATGGCATCTCTGGCAAGG - Intergenic
1055681470 9:78720233-78720255 GGCAGATGTGGTGCCTGGCAAGG + Intergenic
1056694370 9:88833658-88833680 GGCTGAGGGCCTCCCTGGCCAGG + Intergenic
1056804920 9:89721135-89721157 GGCCTCTGGCCTCCCTGGTAGGG + Intergenic
1057893216 9:98885136-98885158 GGAATGTGGCCTCCCTGGTAAGG - Intergenic
1058647012 9:107140170-107140192 GGCACGTGGCCACCCTGCCATGG - Intergenic
1059348069 9:113645768-113645790 CGCCGCTGCCCTCCCTGGCAGGG - Intergenic
1059404133 9:114089523-114089545 GGGAGGTGGCCTGACTGGCAAGG - Intronic
1059438587 9:114290289-114290311 ACCAGATGGGCTTCCTGGCAGGG + Exonic
1059445771 9:114336993-114337015 GGCAGGTGGCCTGCCAGGCCAGG - Exonic
1060112511 9:120916769-120916791 GGCAGAGGGCGGCCTTGGCAGGG + Intronic
1060407576 9:123380487-123380509 GGCAGCTGGCCTTCCTGGGTTGG - Exonic
1061677632 9:132227432-132227454 GGCAGGTGGCCCCCATGGGATGG + Intronic
1061822699 9:133237335-133237357 GCATGCTGGCCTCCCTGGCATGG + Intergenic
1061994988 9:134178670-134178692 GGCAGTTGCCCCACCTGGCAGGG - Intergenic
1062235372 9:135505444-135505466 CGCAGCTGGCCTCCCCAGCATGG - Intergenic
1062402616 9:136379090-136379112 CCCGGGTGGCCTCCCTGGCACGG + Exonic
1062429512 9:136520812-136520834 GGCAGATGGGGCCCCTGGCTGGG + Intronic
1062580128 9:137225752-137225774 GGCACAGGGCCCCACTGGCAGGG - Exonic
1203522073 Un_GL000213v1:54113-54135 GGCAGGTTCCCGCCCTGGCAAGG - Intergenic
1186510849 X:10128737-10128759 GGCTCATGCCCTCCCTGGAAAGG + Intronic
1188379292 X:29471482-29471504 CCCAGATGGCCTCCCTCACAAGG - Intronic
1198379160 X:136068105-136068127 GGGAGATGGCCAAACTGGCATGG + Intergenic
1200068355 X:153515668-153515690 GGCAGCTGGCCTCCCGGCCAGGG + Intergenic
1201579867 Y:15499991-15500013 TGCAGATGGGCTCTCTGGCTGGG + Intergenic